ID: 1163598818

View in Genome Browser
Species Human (GRCh38)
Location 19:18235774-18235796
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1250
Summary {0: 2, 1: 1, 2: 18, 3: 147, 4: 1082}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163598818_1163598826 22 Left 1163598818 19:18235774-18235796 CCTCCCACCCTCCAGCCACACTG 0: 2
1: 1
2: 18
3: 147
4: 1082
Right 1163598826 19:18235819-18235841 ACCTGATCCTCTTGAGTCTGAGG 0: 1
1: 1
2: 1
3: 22
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163598818 Original CRISPR CAGTGTGGCTGGAGGGTGGG AGG (reversed) Intronic
900101633 1:964536-964558 CAGTGGGGCTGCGGGGAGGGGGG + Intronic
900154983 1:1200329-1200351 CTGTGGGGATGGAGGGTGTGTGG - Intergenic
900275970 1:1828340-1828362 TCTTGTGGCTGGAGGGTGGTGGG + Intronic
900299593 1:1970069-1970091 CAGTGGGGCCCGTGGGTGGGGGG + Intronic
900325081 1:2104655-2104677 CAGTGTGGGTGGGGACTGGGAGG + Intronic
900357198 1:2270679-2270701 CAGAGGGGCTGGAGGTGGGGCGG + Intronic
900405289 1:2490266-2490288 AAGTCTGGCTGGACGCTGGGTGG + Intronic
900680464 1:3913475-3913497 CGATGTGGATGGAGGGTGGCTGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900804370 1:4757529-4757551 GAGTGTGGCTGGAGGGGGTGAGG + Intronic
900956885 1:5891834-5891856 CTGTGGGGCTGGAGCCTGGGTGG - Intronic
900984532 1:6065806-6065828 AAGCGCGGCTGGAGGTTGGGGGG - Intronic
901013067 1:6211831-6211853 CAGTGTGGATGCAGGGGGGTGGG - Intronic
901523776 1:9806219-9806241 CAGGGGGGGTGGAGGGGGGGAGG + Intronic
901671028 1:10856552-10856574 CAGGGTGGCTGGGGCCTGGGAGG - Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901928832 1:12583943-12583965 CAGTGGGGCTGATGGGTGGGTGG - Intronic
902079673 1:13812526-13812548 CAGTGTGGCTGGAGCCTGGTAGG + Intronic
902192118 1:14771066-14771088 CAGTGTGGGAGGAGGGTGCGGGG + Intronic
902328554 1:15718672-15718694 CAGGGTGGGGGCAGGGTGGGCGG + Intronic
902447425 1:16476121-16476143 TATTGTGGCTGGTGGGTGGGTGG - Intergenic
902467278 1:16626071-16626093 TATCGTGGCTGGTGGGTGGGTGG - Intergenic
902507306 1:16946673-16946695 TATTGTTGCTGGTGGGTGGGTGG + Intronic
902833605 1:19033422-19033444 CAGTGATGCTGGCGGCTGGGTGG - Intergenic
902974649 1:20080151-20080173 CAGTGTGGTGGGTGGGAGGGAGG + Intronic
903323631 1:22556828-22556850 CAGTGTGGCTAGCGGCTGGAAGG + Intergenic
903378979 1:22883970-22883992 CAGTGAGGTGGGTGGGTGGGGGG - Intronic
903455507 1:23484264-23484286 GAGAGCGGCTGGAGGGTCGGGGG - Intronic
903471466 1:23590626-23590648 CCATGTGGCTGGAGTGTGGGAGG - Intronic
903714361 1:25353104-25353126 CACTGTCGGTGGAGGGTGGGGGG - Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904001710 1:27342502-27342524 GAGTGTGGATGGAGGCCGGGGGG - Intronic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904035586 1:27557023-27557045 CTGTGTGGCTGGGGGTAGGGTGG - Intronic
904251010 1:29224288-29224310 CTGTCTGGCTGGAGGCTGGGAGG + Intronic
904429593 1:30453453-30453475 CACTGTGGCTGGGGGTTGAGTGG + Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904466443 1:30710895-30710917 CTGTGAGGCTGGGGGTTGGGGGG - Intergenic
905046545 1:35007809-35007831 CTGTCTGGCTGGGGGATGGGGGG + Intronic
905127254 1:35724358-35724380 CAGTGTGGCTGGAGCTCGGTGGG + Intronic
905307853 1:37031908-37031930 CAGTTTGGGCGGAGGATGGGAGG - Intronic
905596962 1:39215794-39215816 CAGACTGGCGGGAGGATGGGGGG + Intronic
905876545 1:41435415-41435437 ATGTGTGGCTGGATGGAGGGTGG + Intergenic
905943751 1:41884796-41884818 AAGTGGGGCAGGTGGGTGGGTGG - Intronic
906026643 1:42679844-42679866 CAATGTGTATGGAGAGTGGGTGG - Intergenic
906114860 1:43349604-43349626 CAGTTTGGCTGAAGGGTGGACGG - Intronic
906948325 1:50314692-50314714 CAGTGTTGGTGGAAAGTGGGGGG - Intergenic
907281548 1:53350293-53350315 CAGTGTGGCTGGAGCATGGTGGG - Intergenic
907300276 1:53482635-53482657 CAGTGTGGCTGGCATGCGGGGGG - Intergenic
907374513 1:54024834-54024856 AATTGTAGGTGGAGGGTGGGAGG - Intergenic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
908333939 1:63100552-63100574 CAGGGTGGCTGAATGGTGAGTGG - Intergenic
909060671 1:70875618-70875640 ACTTGAGGCTGGAGGGTGGGAGG - Intronic
909184782 1:72472963-72472985 CAAGTTGGCTGGAGGGTGGAGGG + Intergenic
909508145 1:76418367-76418389 CAGTGTAGCTTGAAGGTGGAGGG + Intronic
909577766 1:77194632-77194654 ATTTGTGGGTGGAGGGTGGGGGG + Intronic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
910368094 1:86487742-86487764 CAGTATGGCTAGAGGCTGGATGG - Intronic
910374588 1:86554134-86554156 GAGTGGGGGTGGAGGTTGGGAGG - Intronic
910592239 1:88938530-88938552 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
910741630 1:90525467-90525489 AATTGAGGGTGGAGGGTGGGAGG + Intergenic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
912480802 1:109980983-109981005 AAGTGTGGCTAGAGGGGTGGAGG - Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912807665 1:112770744-112770766 CATTTTGGGTGGAGGGTGGGAGG + Intergenic
912960593 1:114192170-114192192 CAGTGTGGGTGGAGAGAGAGCGG + Intergenic
913173731 1:116255480-116255502 AAGTGTGGCTGGGGGGTGGGGGG - Intergenic
913186304 1:116373368-116373390 CCGCGGGGCGGGAGGGTGGGAGG - Intronic
913337116 1:117718600-117718622 TAGTGGGGTGGGAGGGTGGGAGG - Intergenic
913701724 1:121380935-121380957 GAGTGTGGGTGGAGGGGGTGTGG - Intronic
914042284 1:144061404-144061426 GAGTGTGGGTGGAGGGGGTGTGG - Intergenic
914049299 1:144118481-144118503 CTTTGAGGGTGGAGGGTGGGAGG + Intergenic
914129885 1:144846963-144846985 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
914135805 1:144899084-144899106 GAGTGTGGGTGGAGGGGGTGTGG + Intronic
914382382 1:147128809-147128831 CAGTGTAGTTGGAGGATGGTGGG - Intergenic
914899269 1:151703284-151703306 CAGAGAGGCAGGGGGGTGGGAGG + Exonic
915109284 1:153552907-153552929 CAGTGGGGCTTCAGGGAGGGCGG + Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915273622 1:154773159-154773181 CACTGAGGGTGGAGAGTGGGAGG - Intronic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915641497 1:157230667-157230689 CAGTTTGGGTGAAGGGTTGGTGG + Intergenic
915903048 1:159860017-159860039 CAGGGTTGCTGGAGACTGGGAGG - Intronic
915954436 1:160210707-160210729 CAGGCTGGCTGGGTGGTGGGGGG - Intronic
916498862 1:165369389-165369411 CAGTGCCGCTGGAGCGTTGGTGG - Intergenic
918107268 1:181425699-181425721 CAGTGTGGCTGGGGTATGAGCGG - Intronic
918180438 1:182082288-182082310 CTGTCTGGGTGGTGGGTGGGAGG - Intergenic
918205046 1:182300708-182300730 GTGTGTTGGTGGAGGGTGGGTGG + Intergenic
919506224 1:198400781-198400803 CAGTTTTCCTGGAGGGGGGGTGG + Intergenic
919643470 1:200067621-200067643 GCTTGGGGCTGGAGGGTGGGAGG + Intronic
920193565 1:204211364-204211386 CAGTGTGGTTGGAGCATGGCAGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920489148 1:206399655-206399677 GAGTGTGGGTGGAGGGGGTGTGG - Intronic
920920390 1:210293159-210293181 AAGTTTGGCTGGAGGGTGGAGGG + Intergenic
922020632 1:221700796-221700818 CACTGTTGATGGAGGGTTGGGGG - Intergenic
922618780 1:226978338-226978360 TCGGGTGGGTGGAGGGTGGGTGG - Intronic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
922899322 1:229123888-229123910 CTGAGGGGCTGGAGGCTGGGTGG - Intergenic
923014133 1:230112784-230112806 GTGTGTGGCAGGGGGGTGGGGGG + Intronic
924737513 1:246771591-246771613 CTTTGAGGTTGGAGGGTGGGAGG - Intergenic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1063092507 10:2879713-2879735 CTGTGAGCCTGGAGGGTGGCAGG + Intergenic
1063448040 10:6132458-6132480 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1064442218 10:15364038-15364060 TCGGGTGGGTGGAGGGTGGGGGG + Intronic
1064950401 10:20842868-20842890 TACAGAGGCTGGAGGGTGGGAGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1064998807 10:21318924-21318946 CAGTGTGGTTAGAGGCTGCGAGG - Intergenic
1065001971 10:21345526-21345548 CATTGGGGCTGGAGGGGGAGGGG + Intergenic
1066087946 10:31989300-31989322 CACTGTGGGTGGGGAGTGGGTGG + Intergenic
1066231224 10:33435752-33435774 CAGGGTGGTTGCAGGGTGGAGGG - Intergenic
1067030415 10:42875748-42875770 GGGTGTGGCAGGAGGCTGGGGGG + Intergenic
1067146057 10:43694732-43694754 CAGAGGGGCTGGAGGAGGGGAGG + Intergenic
1067298293 10:44988455-44988477 CAATTTGGCTGGGGGGTGGGGGG - Intronic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067776179 10:49166413-49166435 AAGTGTGGGCGGATGGTGGGAGG - Intronic
1067850549 10:49751302-49751324 GAGTGTGGCAGGAGGGTAGTGGG - Intronic
1067903118 10:50262819-50262841 CAGTGAGGCTGGGGGAGGGGCGG + Intergenic
1068344402 10:55754716-55754738 CTGGGAAGCTGGAGGGTGGGAGG + Intergenic
1068880872 10:62047645-62047667 CAGGGTGGCTGGAAGGAGGTGGG + Intronic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069852837 10:71421362-71421384 CTGTGTGCCTGGGGAGTGGGTGG + Intronic
1069859404 10:71461139-71461161 CTGTGTGGCTGCAGGGGTGGAGG - Intronic
1069941929 10:71962534-71962556 CATAGTGAATGGAGGGTGGGGGG + Intergenic
1069986309 10:72286561-72286583 AAGTGGGGCTGGAGGCAGGGTGG + Intergenic
1070369810 10:75771527-75771549 CAGTGTGGCTGGTGAGTGAGAGG + Intronic
1070660901 10:78304573-78304595 CACTGTAGCTGAAGTGTGGGAGG + Intergenic
1070685528 10:78477603-78477625 CAGAGTGGCTGGAGCGTTGGGGG - Intergenic
1070771218 10:79083395-79083417 CAGTGTGGCTAGATGGAGTGAGG + Intronic
1070939263 10:80328915-80328937 TACTGTGGCTGGAGGGAAGGAGG - Intergenic
1070941415 10:80351488-80351510 CAGTGTGGATGGAGTGGTGGGGG - Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071473770 10:86007295-86007317 CAGTGTCAGTGGGGGGTGGGAGG - Intronic
1071530481 10:86387596-86387618 CAGTGTGGGTGAATGGTGGGGGG - Intergenic
1071847500 10:89535631-89535653 GGGTGTGGCAGGAGGGCGGGCGG - Intronic
1071847881 10:89538135-89538157 CACTGAGGCTGGAGGATTGGGGG + Intronic
1072271735 10:93783506-93783528 CAGTGGGGCTGTGGGGAGGGAGG + Intronic
1072349800 10:94545727-94545749 CAGCGGGGCGGGAGGGCGGGTGG + Intronic
1072861574 10:99011003-99011025 CAGAGGGGTTGAAGGGTGGGAGG - Intronic
1072969675 10:100006683-100006705 CAGTGTGGATGTGGGTTGGGGGG - Intronic
1073002327 10:100294887-100294909 CCGTGGAGCTGGAGGGTGAGGGG + Intronic
1073177391 10:101564863-101564885 CCGTGTGGCTGGGGAGCGGGCGG - Intergenic
1073251295 10:102121483-102121505 AAGTGTGACTGAAGGTTGGGAGG - Intergenic
1073487212 10:103827121-103827143 CAGGGTGGATGAGGGGTGGGAGG + Intronic
1073650727 10:105355174-105355196 GGGTGAGGGTGGAGGGTGGGGGG - Intergenic
1073934074 10:108609612-108609634 TACTGAGGGTGGAGGGTGGGAGG + Intergenic
1074699930 10:116083890-116083912 CAGAGTGGCAGGAGGGATGGAGG - Intronic
1074831245 10:117250915-117250937 CAGTATGGCTGGTGGTTTGGGGG + Intronic
1074851132 10:117440494-117440516 GGGTGTGGCTGGAGGGCTGGAGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075650999 10:124128358-124128380 CAGAGCGGCTGGAGGGGGTGGGG - Intergenic
1075995361 10:126872407-126872429 CTGTGTGGCTGGATGCTGAGAGG - Intergenic
1076064722 10:127440152-127440174 GAGTATGGGTGGGGGGTGGGGGG + Intronic
1076064974 10:127441689-127441711 CAGTGGGGGTGGTGGGGGGGTGG - Intronic
1076547118 10:131252925-131252947 AAGTGTGCCTGGAAGGAGGGTGG - Intronic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076998923 11:312528-312550 AGGGGTGGGTGGAGGGTGGGGGG + Intronic
1077061241 11:618768-618790 GGGTGTGGCTGGTTGGTGGGAGG + Exonic
1077061268 11:618861-618883 GGGTGTGGCTGGTTGGTGGGAGG + Exonic
1077207817 11:1352752-1352774 CAGTGGGGATGAGGGGTGGGGGG - Intergenic
1077218923 11:1406713-1406735 CTGTGCTGCTGGAGGGTGCGGGG + Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077375993 11:2205363-2205385 TAGGGAGGCTGGAGGCTGGGAGG - Intergenic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1077783207 11:5354633-5354655 CAGTGTGGCTGGTGGCGTGGAGG - Intronic
1077892567 11:6430056-6430078 CATTGTCACTGGAAGGTGGGTGG + Intergenic
1077958643 11:7049009-7049031 GAGTGAGGGTGGAGGGTGGGTGG + Intronic
1078337837 11:10477746-10477768 CAGCAGGGCTGGAGGCTGGGTGG + Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078475102 11:11622684-11622706 CGGTGGGGGTGGGGGGTGGGGGG - Intergenic
1078524230 11:12088406-12088428 CAGGTTGGCTGGAGGATGGCTGG - Intergenic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1079115177 11:17635891-17635913 CTGTCAGGCTGGAGGGTGGGAGG + Intronic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080284798 11:30597795-30597817 CATGGTCGCTGGAGGGTGGCTGG - Intergenic
1080398629 11:31913524-31913546 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1080860281 11:36145216-36145238 CGGGGCGGCTGGCGGGTGGGGGG - Intronic
1081664006 11:44905913-44905935 TTCTGTGGCTGGAGGGTGTGTGG + Intronic
1081763026 11:45590497-45590519 CAGGGGAGGTGGAGGGTGGGTGG - Intergenic
1081960550 11:47133472-47133494 AAGAGTGGCTGGCAGGTGGGTGG + Intronic
1082014462 11:47474241-47474263 CAGGGTGGCTGGAGAATGGCTGG - Intronic
1082204380 11:49414668-49414690 CAGTGTGGCTTGTGGGTAGGAGG - Intergenic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1082847954 11:57741548-57741570 CAGCGGGACTGGTGGGTGGGGGG - Intronic
1083137487 11:60692567-60692589 CAGTGGGCCTGGTGTGTGGGTGG - Intergenic
1083201661 11:61124521-61124543 GACTGTGGCTGGAAGGAGGGAGG - Intronic
1083343196 11:61972135-61972157 CACTGTGGAGGGAGGGAGGGAGG + Intergenic
1083631284 11:64096820-64096842 CAGTGTGCTTGGAGGGTATGGGG - Intronic
1083681343 11:64353239-64353261 AGGTGTGGCTGGAGGGCCGGTGG + Exonic
1083742107 11:64716539-64716561 CCGTGTGGAGGGAGAGTGGGAGG + Intronic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1083838312 11:65287292-65287314 CAGTGTGGCTGGAGAATGTGGGG - Intronic
1083936766 11:65873424-65873446 CTTTGTGGATGGAGGGTGTGGGG - Intronic
1084006556 11:66326403-66326425 CAGTGGGGGTGGAGGGGTGGAGG + Intergenic
1084220546 11:67674948-67674970 CACTGTGGCTGGGGCCTGGGAGG - Intronic
1084258193 11:67956571-67956593 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1084403002 11:68955976-68955998 CAGGGTGGGGGTAGGGTGGGGGG + Intergenic
1084570668 11:69957790-69957812 GAGAGTGGCTGGGGGGTGGTAGG + Intergenic
1084742994 11:71151106-71151128 CAGTGTACCTGGATGGTGAGGGG - Intronic
1084835939 11:71801934-71801956 CAGCCTGGCTTGAGCGTGGGTGG - Intergenic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085052054 11:73384993-73385015 CAGCGTGGCAGGCGTGTGGGTGG + Intronic
1085126498 11:74005919-74005941 TAGTGAGGCTGGAGTCTGGGAGG + Exonic
1085173560 11:74467810-74467832 CAGTGTGGCTGTGTGGTGGTGGG + Intergenic
1085278298 11:75314060-75314082 CAGTGTGGCTGGAGGGTGTGTGG - Intronic
1085419506 11:76343437-76343459 CAGAGTGGCTAGAGGATTGGAGG - Intergenic
1085586018 11:77706819-77706841 GAAAGTGGGTGGAGGGTGGGAGG - Intronic
1086051082 11:82591193-82591215 CAGAATGGTGGGAGGGTGGGAGG - Intergenic
1086592179 11:88527928-88527950 CCATGAGGGTGGAGGGTGGGAGG + Intronic
1086650703 11:89285863-89285885 CAGTGTGGCTTATGGGTAGGAGG + Intronic
1086735083 11:90296461-90296483 CTGGGTGGCAGGGGGGTGGGTGG + Intergenic
1086974272 11:93114689-93114711 ATGGGTGGCTGGTGGGTGGGGGG - Intergenic
1087630212 11:100641473-100641495 CAGTGTGGCGGGTGGCGGGGGGG - Intergenic
1087807622 11:102572170-102572192 CAGTGTGGCTGGAGACAGTGAGG - Intergenic
1088992568 11:114966758-114966780 CAGTCTGGCTGCAGAGTGGAAGG + Intergenic
1089430971 11:118424200-118424222 CAGTGTGGCTGGAGGAAGAGTGG - Intronic
1089467821 11:118696957-118696979 GCCTGTGGCTGGAGGGAGGGTGG + Intergenic
1089565935 11:119371805-119371827 ATGTGTGGGTGGTGGGTGGGTGG - Intronic
1089572270 11:119418609-119418631 CACTGTGGGTGGAGGCAGGGAGG + Exonic
1089744202 11:120605718-120605740 CAGCGTGGCTGAAGGGCAGGGGG - Intronic
1089778769 11:120858177-120858199 CAGTGTGGCTGGGGCGGGGTTGG + Intronic
1089812385 11:121142716-121142738 CAGGGTGCATGGAGGGTGAGAGG - Intronic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090274241 11:125408492-125408514 CCGTGCGGCAGGTGGGTGGGAGG + Intronic
1090727690 11:129542501-129542523 ACTTGTGGGTGGAGGGTGGGAGG - Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091595701 12:1877714-1877736 CAGTGTGGCTGTTGGGACGGCGG - Intronic
1091609635 12:1994904-1994926 CATGGTGGGTGGGGGGTGGGAGG - Intronic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1091993605 12:4975745-4975767 CAGTGCGGCTCCAGGCTGGGCGG + Intergenic
1092059822 12:5539231-5539253 CAGAGAGGCTGGAGGATTGGGGG + Intronic
1092182017 12:6452476-6452498 TAGTGTGTGTGGAGGGAGGGTGG + Intronic
1092218108 12:6696338-6696360 CAATTTTGCTGGGGGGTGGGTGG - Intronic
1092231613 12:6778728-6778750 CACTGTGGGTGGAAGGTGGGTGG - Intergenic
1092244670 12:6856898-6856920 GAGAGTGGCTGGAGGAGGGGAGG - Intronic
1092429523 12:8397524-8397546 CGGTGGGGCTGGAGCGTGGTGGG + Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1094564799 12:31590319-31590341 CCGGGTGGCTGGCGGGTGGGAGG + Intronic
1094719907 12:33052804-33052826 AAGTGTCGCTGGAGGGTGGCTGG - Intergenic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1096075224 12:48799983-48800005 CAGTGTGGGGGCGGGGTGGGGGG - Intergenic
1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG + Intronic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097243478 12:57591831-57591853 GAGTGTAGGTGGAGGGTGAGGGG + Intronic
1097589472 12:61556608-61556630 AATTGAGGGTGGAGGGTGGGAGG - Intergenic
1098137570 12:67418583-67418605 GAGGGTGGCTTGAGCGTGGGAGG + Intergenic
1098823701 12:75266915-75266937 TAGGGTGGTTGGAGGGTGGGTGG + Intergenic
1099324022 12:81189069-81189091 CAGGGTGGTTGGAGGGGGAGAGG - Intronic
1099888564 12:88561743-88561765 CAGTGTGGCTAGAGCATGGTGGG - Intronic
1100337941 12:93650168-93650190 CAGGGTAGCGGGAGGGAGGGAGG - Intergenic
1100348647 12:93756834-93756856 CAGTGTGGATGAAGGCTAGGAGG - Intronic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1101272200 12:103159600-103159622 CAGGGAGGGTGGAGGTTGGGGGG - Intronic
1101324838 12:103706459-103706481 CTGTGATGCTGGAGAGTGGGAGG - Intronic
1101623694 12:106417309-106417331 CAGTGTGGCTGGAGTGAGTGAGG + Intronic
1101917884 12:108910363-108910385 CAGTGGAGCTGGGGGCTGGGGGG - Intergenic
1102585692 12:113921385-113921407 GGGTGTGGGTGGAAGGTGGGGGG - Intronic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1103133886 12:118491157-118491179 CAGGGTTGGAGGAGGGTGGGTGG + Intergenic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103583483 12:121933932-121933954 CAGAGTGGCTGGGGGAGGGGAGG + Intronic
1103626838 12:122226295-122226317 CCGTGACGCTGGCGGGTGGGCGG + Exonic
1103725547 12:122995820-122995842 CAGGGTGGCTGGTGGGTGGGAGG - Intronic
1103963156 12:124621973-124621995 CAGAGTGGCTGGACTGGGGGTGG - Intergenic
1104037476 12:125107522-125107544 CGGTGTGCCTTGGGGGTGGGGGG + Intronic
1104082828 12:125445876-125445898 GATTGAGGCTGGTGGGTGGGTGG - Intronic
1104365531 12:128173212-128173234 GTGGGTGGTTGGAGGGTGGGAGG + Intergenic
1104371598 12:128228508-128228530 CAGTGTGGTAGGAGTGAGGGAGG + Intergenic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104638187 12:130450792-130450814 TGGTGTGGCTGGAGAGGGGGCGG - Intronic
1104833058 12:131767828-131767850 CATTGAGGGTGGAGGGAGGGAGG + Intronic
1104859976 12:131918709-131918731 CATTCTGGCTGGAGGGTGTGTGG + Intronic
1104880005 12:132064087-132064109 CTGTGTGGCTGTAGGCCGGGGGG - Intronic
1104940543 12:132392543-132392565 CAGGGTGGCCGGAGGGTCCGGGG - Intergenic
1104971012 12:132530717-132530739 GGGTGGGGCTGGGGGGTGGGGGG + Intronic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984121 12:132587097-132587119 CAGTGCAGCTGGAGGGAGGGCGG + Intergenic
1104984126 12:132587120-132587142 CAGTGCAGCTGGAGGGTGGACGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1104984147 12:132587208-132587230 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984183 12:132587364-132587386 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105673950 13:22650272-22650294 TGGTGTGGCTGTAGGGAGGGTGG + Intergenic
1105732144 13:23228614-23228636 AATTGAGGGTGGAGGGTGGGAGG - Intronic
1105787055 13:23759863-23759885 CACAGTGGCTGCAGGGTAGGGGG + Intronic
1106413596 13:29527791-29527813 CAGGGTGGCTGGTGTGAGGGTGG - Intronic
1106478988 13:30122972-30122994 CAGTGTGAGTGCAGGGTGCGTGG - Intergenic
1106778652 13:33033476-33033498 CAGTGTGGCTGGATGGCGTGGGG - Intronic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107809475 13:44186462-44186484 CAGCGTGGTTGGAGGGTGGCTGG - Intergenic
1108035522 13:46286518-46286540 CATTGTGGGTGGGGGGAGGGGGG - Intergenic
1108391568 13:49952481-49952503 TAGAGTGGAAGGAGGGTGGGAGG + Intergenic
1108467294 13:50729176-50729198 AATTGAGGGTGGAGGGTGGGAGG - Intronic
1108482838 13:50892287-50892309 CTATGTGGCTGGAGGGGTGGGGG - Intergenic
1108716960 13:53090350-53090372 CATTGTAGATGGAGGCTGGGGGG + Intergenic
1108955986 13:56157425-56157447 CAGGGAGGATGGAGGGAGGGGGG + Intergenic
1109666571 13:65547742-65547764 TATTATGGGTGGAGGGTGGGAGG - Intergenic
1109817700 13:67607574-67607596 CATTGAGGGTGGAGGGTGGGAGG + Intergenic
1110383027 13:74876253-74876275 GTGTGTGGGTGGTGGGTGGGGGG - Intergenic
1110421173 13:75310797-75310819 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1111448326 13:88379948-88379970 AAGGGTGGATAGAGGGTGGGAGG - Intergenic
1111479794 13:88809894-88809916 CAGTGTTGGAGGTGGGTGGGAGG + Intergenic
1113709218 13:112452975-112452997 CAGTGTGGCTCCAAGGTGGCCGG - Intergenic
1113720628 13:112553302-112553324 CAGCGTAGCTGGTGGGTAGGAGG - Intronic
1113853926 13:113433717-113433739 AAGTGTGGGCGGGGGGTGGGAGG - Intronic
1113899611 13:113788889-113788911 GAGTGGGGCAGGAGGGAGGGAGG - Intronic
1114069063 14:19094044-19094066 GAGTGTGGATGGGGGGGGGGTGG + Intergenic
1114405693 14:22453927-22453949 GTGTGTGGCTGGAGGAGGGGAGG + Intergenic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1115023199 14:28708191-28708213 GAGTGTGACTGTAGTGTGGGAGG - Intergenic
1115183709 14:30659573-30659595 CAATGTATCTGGTGGGTGGGAGG + Intronic
1115528134 14:34301843-34301865 CAGGGTGGCTGGTGGCTGTGTGG - Intronic
1116641239 14:47466163-47466185 ATGTGAGGGTGGAGGGTGGGAGG + Intronic
1117539937 14:56737177-56737199 CAGTATGGTTGGAGTGTGGCAGG - Intergenic
1117604684 14:57415797-57415819 CAGTTTGGAGGGAGGGAGGGAGG - Exonic
1117738438 14:58791072-58791094 AACTGAGGGTGGAGGGTGGGAGG - Intergenic
1118227819 14:63919484-63919506 TAGTGTGGCTGGATTGTGGTGGG + Intronic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118389189 14:65282068-65282090 CAGGCTGGCTGGAGGGGGAGTGG - Intergenic
1118616035 14:67575060-67575082 CAGGGTGCCGGGAGGGAGGGAGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119477239 14:74937930-74937952 CAGTGTGGCTGGAGCATGATGGG - Intergenic
1120161738 14:81153082-81153104 GGGTGTGGCTGCAGGGTGAGTGG - Intergenic
1120923812 14:89778746-89778768 CAGTCTGGCTGAAGGGCGGAGGG - Intergenic
1121230672 14:92355277-92355299 GAGTGTGGCTGGAGCGGGGTGGG + Intronic
1121248566 14:92482836-92482858 TGGTGTGGCTGGTGAGTGGGGGG + Exonic
1121404771 14:93712980-93713002 CAGTGGGGATGCAGGGTGTGGGG + Intergenic
1121530789 14:94651714-94651736 CCCTGTGCCTGGGGGGTGGGGGG + Intergenic
1121567754 14:94923501-94923523 CAGTGAAGGTGGAGGGGGGGAGG - Intergenic
1121588209 14:95078627-95078649 CAGTGTGGCAGCGGGGTGGGGGG - Intergenic
1121632583 14:95432019-95432041 CAGGGTGCCTGGAGGGTTGGTGG - Intronic
1121767779 14:96502499-96502521 CACTGAGGCGGGAGGGAGGGGGG - Exonic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122117558 14:99535451-99535473 GAGTGTGGCTGGAGCTTGGAGGG - Intronic
1122295118 14:100701101-100701123 TAGTCTGGCTGGGAGGTGGGAGG + Intergenic
1122339790 14:101020464-101020486 CAGTGTGACTGGATGGGGTGTGG - Intergenic
1122353880 14:101112234-101112256 AAGTGAGGCTGGGGCGTGGGGGG - Intergenic
1122410903 14:101525741-101525763 CAATTTGGCAGGGGGGTGGGTGG - Intergenic
1122417984 14:101559554-101559576 GAGTGTGCCTGGAGGATTGGCGG - Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122870569 14:104636309-104636331 TGGGGTGGCTGGAGGCTGGGTGG - Intergenic
1122981397 14:105193788-105193810 CACAGTGGCTGGGGAGTGGGGGG + Intergenic
1123011379 14:105351089-105351111 CCAGGTGGCTGGAGGGCGGGCGG - Intronic
1202839652 14_GL000009v2_random:110133-110155 CGGTGTTGCTGGAGGGTCAGTGG - Intergenic
1202909026 14_GL000194v1_random:100273-100295 CGGTGTTGCTGGAGGGTCAGTGG - Intergenic
1124011536 15:25843220-25843242 CGGTGGGGGTGGGGGGTGGGGGG - Intronic
1124360961 15:29036158-29036180 AGGTGTGGCTGGTGGGTGGCGGG - Intronic
1124883364 15:33662048-33662070 CAGGGTGGGTGGAAGGTTGGAGG - Intronic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1125311074 15:38378724-38378746 CAGTGGGGCAGGATGGTGTGTGG + Intergenic
1125748728 15:42014538-42014560 CAGTGTGGCTGCGGGAAGGGGGG + Intronic
1125887246 15:43238139-43238161 CAGGGTGGCTGAAGGGCGGTGGG - Intronic
1125973949 15:43934874-43934896 CAGTCTGGCTGGGGTGAGGGTGG + Intronic
1126425553 15:48523701-48523723 AAGGGTGGCTGGGGGGGGGGGGG + Intronic
1126659302 15:51016449-51016471 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1126697222 15:51336505-51336527 CAGTGTGGTGGAAGGGTGGTGGG + Intronic
1126900593 15:53310429-53310451 GAGTATGTTTGGAGGGTGGGAGG - Intergenic
1126993338 15:54409525-54409547 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1127059693 15:55169787-55169809 CGGTGGGGGTGGTGGGTGGGGGG - Intergenic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127865626 15:63030220-63030242 AACTGTGGCTGGAGGGTGTAAGG - Intergenic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128660620 15:69498338-69498360 CAGTATGACTGAAGGATGGGAGG + Intergenic
1128727496 15:69998896-69998918 CAGTGGGGCTGGGGAGTGGCAGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1128878638 15:71223077-71223099 CAGTGTGTCTGGCAGGTGGAAGG - Intronic
1129154355 15:73708698-73708720 GAGTGTGACTGGAAGGTGGTGGG + Intronic
1129272100 15:74424468-74424490 CAGGGTGGCTGGAGGTTTGGTGG - Intronic
1129523741 15:76201313-76201335 CAGAGTGGCCTGAGAGTGGGAGG - Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129788396 15:78324069-78324091 CAGTGGGGTTGCGGGGTGGGGGG - Intergenic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1130987168 15:88852091-88852113 CAGTGTGCCTGGTGGGGCGGGGG + Intronic
1130989776 15:88869467-88869489 GGGTGAGGATGGAGGGTGGGAGG - Intronic
1131493100 15:92880066-92880088 CAGTGTGACTTGGGGGTGGGAGG + Intergenic
1132555993 16:572902-572924 GAGTGTGGCTCCAGCGTGGGGGG + Intronic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1132723103 16:1326499-1326521 CAGAGTCGCTGGAGGGGTGGTGG - Exonic
1132846232 16:2002084-2002106 CAGCCTGGCCGGAGGGTGGGAGG + Intronic
1132856558 16:2047677-2047699 CGCCGTGGCTGGAGCGTGGGAGG - Exonic
1132881127 16:2162174-2162196 CTGAGTGGCTCCAGGGTGGGTGG + Intronic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1132936400 16:2483448-2483470 CAGAGTGGCTGGTGGATGCGGGG + Intronic
1133039251 16:3051421-3051443 TAGTGTGGCTGGGGGTGGGGTGG - Intronic
1133129347 16:3667002-3667024 CACTGGGGATGGAGTGTGGGAGG - Intronic
1133361088 16:5174295-5174317 CAGGAAGCCTGGAGGGTGGGTGG + Intergenic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134112786 16:11525701-11525723 CATGGTGGCTGGAGGCTGGTGGG - Intergenic
1134349937 16:13427658-13427680 CAGTGTGGCTGGAGAGAGAGAGG + Intergenic
1134426138 16:14147583-14147605 CAGTGTGTTTGGAGCGAGGGAGG + Intronic
1135763485 16:25156602-25156624 CAGTGTGGCTGGGGCTCGGGTGG + Intronic
1136041095 16:27579570-27579592 AAGTCTGGCTGGAGTGAGGGAGG - Intronic
1136474694 16:30505473-30505495 ATGGGAGGCTGGAGGGTGGGAGG - Intronic
1138001197 16:53281685-53281707 CACTGTGGCTGGAGCATGGTGGG - Intronic
1138151176 16:54658553-54658575 CAGTGTGGCTGGAAGGTTAGAGG + Intergenic
1138275411 16:55730611-55730633 TAGTGTGGCTGGGGAGTGAGAGG - Intergenic
1139313934 16:66051366-66051388 CATTTGGGCTGGAGGGAGGGAGG + Intergenic
1139439655 16:66959697-66959719 GGGTGTGGCTGGGGGGTGGCAGG + Intergenic
1139550078 16:67668084-67668106 CATTGAGGCTGGAGCGTGAGTGG + Exonic
1139649770 16:68356437-68356459 CGGTGTGGCTGCAGGGTCTGGGG - Intronic
1139689563 16:68631578-68631600 CAGGGGGGCTGGAGGGTTGGTGG + Intergenic
1140372035 16:74419232-74419254 CAGAGTGGATGCAGGGAGGGGGG + Intronic
1140408628 16:74727509-74727531 CACTGAAGCAGGAGGGTGGGTGG - Intronic
1140420721 16:74816822-74816844 CTGTGAGGCCTGAGGGTGGGAGG + Intergenic
1140591813 16:76362745-76362767 AATTGAGGGTGGAGGGTGGGAGG + Intronic
1140884856 16:79234085-79234107 CAGGAAGGTTGGAGGGTGGGCGG - Intergenic
1140956795 16:79873942-79873964 AAGTGTGGTTTTAGGGTGGGTGG + Intergenic
1141028876 16:80570936-80570958 GAGTGTGGATGGAGGGAGAGTGG - Intergenic
1141126552 16:81404639-81404661 CAGTCTGGCTGCAGAGTGGATGG - Intergenic
1141517847 16:84558386-84558408 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1141651241 16:85394187-85394209 AGGCGGGGCTGGAGGGTGGGAGG + Intergenic
1141884268 16:86880966-86880988 CCGTGTGGCTGGTTGGGGGGTGG + Intergenic
1142005127 16:87686057-87686079 CTCCGTGGCTGGAGGGTGGCTGG + Intronic
1142021213 16:87783892-87783914 GGGAGAGGCTGGAGGGTGGGTGG - Intergenic
1142198683 16:88750859-88750881 GAGGGTGGGTGGAGGGTGGAGGG - Intronic
1142198689 16:88750870-88750892 TCCTGAGGCTGGAGGGTGGGTGG - Intronic
1142284373 16:89165743-89165765 CACTGTGACAGGAGGGAGGGAGG - Intergenic
1142405126 16:89884273-89884295 CAGGGTGGCTGCAGTGTGGCAGG + Intronic
1203137859 16_KI270728v1_random:1740673-1740695 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
1142621160 17:1166478-1166500 CAGTGTGGCCGGAGGCCCGGGGG + Intronic
1142876549 17:2854575-2854597 CGGTGGGGCGAGAGGGTGGGTGG - Intronic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143362372 17:6382557-6382579 CAATGTGGCCGGAGGCTGGATGG - Intergenic
1143508737 17:7383898-7383920 CCGTGCGGCAGGAGCGTGGGCGG + Intronic
1143602395 17:7956747-7956769 ACTTGAGGCTGGAGGGTGGGAGG - Intergenic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1143999071 17:11035750-11035772 CAGTGGGGCTGGAGCATGGAGGG - Intergenic
1144461341 17:15460894-15460916 CACTGTGGCTGGAGGGTGGTTGG - Intronic
1144517511 17:15928857-15928879 CAGAGTGGCTGGAGGTCTGGAGG + Intergenic
1144607302 17:16678254-16678276 CAGTCTTGTTGGAGAGTGGGAGG - Intergenic
1144771559 17:17762372-17762394 CAGTGTGGTTGGAGTGTGCATGG + Intronic
1144781703 17:17811616-17811638 CAGTGTGGCGGCAGGTCGGGAGG + Intronic
1144944701 17:18963942-18963964 CAGTGTGGCTGGAGCGGGTGGGG - Intronic
1145178329 17:20721507-20721529 CTGGCTGGCTGGAGGGAGGGCGG + Intergenic
1145279838 17:21458877-21458899 CAGTGCAGCTGCAGGGTGTGGGG - Intergenic
1145714146 17:27003691-27003713 ACCTGAGGCTGGAGGGTGGGAGG - Intergenic
1145780528 17:27560060-27560082 CCACGTGGCTGGAGGGTGGAAGG + Intronic
1145788854 17:27611656-27611678 CAGTAGGGCTGGAGGTGGGGTGG + Intronic
1145864208 17:28229525-28229547 CTGTGTGGGTGGGGAGTGGGAGG + Intergenic
1146056283 17:29582900-29582922 GAGTGGGGCTGGAGGGGTGGTGG - Intronic
1146312495 17:31779964-31779986 TAGTGGGGGTGGGGGGTGGGTGG - Intergenic
1146696370 17:34911679-34911701 CAGTGTGGCTGGAGAGAGTTGGG + Intergenic
1146792611 17:35760957-35760979 GAGTGGGGCTGGAGGCAGGGTGG + Intronic
1146939755 17:36836337-36836359 CACTGGGGCTGGAGGGTGAGAGG + Intergenic
1146968599 17:37054166-37054188 CAGTGGGGGTGGCTGGTGGGGGG + Intronic
1147170653 17:38616956-38616978 CTGTGTGGCTGGGGTGTTGGTGG - Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147436838 17:40421572-40421594 CAGAGTGGGGGCAGGGTGGGTGG - Intergenic
1147458124 17:40551439-40551461 CAGGGTTGCAGGAGGGTGTGGGG - Intergenic
1147587546 17:41661032-41661054 GAGTGGGGGTGGGGGGTGGGGGG - Intergenic
1147602527 17:41755145-41755167 CAGGGAGGCTGGAGGTTTGGAGG + Exonic
1147868944 17:43573773-43573795 CAGGGTGGGTGGGGGCTGGGAGG + Intronic
1148155856 17:45425051-45425073 CAATGTGGGGTGAGGGTGGGAGG + Intronic
1148240058 17:45994376-45994398 CAGGGAGGCAGGAGGATGGGAGG + Intronic
1148241064 17:45999596-45999618 CAGGGCAGCTGCAGGGTGGGAGG - Exonic
1148579531 17:48734170-48734192 TAGTGTGGCTGGTGGGTTCGCGG + Intergenic
1148675365 17:49441763-49441785 TGGTGTGGCTGCAGGGAGGGAGG - Intronic
1148769097 17:50056648-50056670 AAGTGAAGCTGGAGGGTGTGGGG + Intronic
1148780352 17:50117834-50117856 CGGGGTGGCTGGAGAGTGAGAGG + Intronic
1149585646 17:57784430-57784452 CAGTGTCGCTGATGGGTGGAGGG - Intergenic
1149613007 17:57971397-57971419 CAGGCTGGTTGGAGGGTGGAAGG - Intergenic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150204860 17:63395827-63395849 CAGTGTGACTGGACGATGGCCGG + Exonic
1150387546 17:64773689-64773711 CAATGTGGGGTGAGGGTGGGAGG + Intergenic
1150676076 17:67246222-67246244 CAGTGTGGCCGGCGGGCTGGGGG - Intergenic
1151129662 17:71883265-71883287 CAGGGTGCCTGGAGTGTGTGAGG + Intergenic
1151210821 17:72542630-72542652 AAGTGGGGCTGGACGGTAGGAGG - Intergenic
1151334243 17:73430659-73430681 CTGTGTGGCTGGACTCTGGGTGG + Intronic
1151392576 17:73797659-73797681 AGGTGTGGATGGAGGCTGGGAGG - Intergenic
1151406920 17:73893939-73893961 CTGATTGCCTGGAGGGTGGGTGG - Intergenic
1151546712 17:74797742-74797764 CAGAGTGACTGGAGGAAGGGGGG + Intronic
1151553852 17:74836841-74836863 CAGACTGGGTGGAAGGTGGGTGG - Exonic
1152001665 17:77649764-77649786 CTGTGTGGTTGGAGGGATGGAGG + Intergenic
1152197529 17:78925950-78925972 CAGTTTAGTTGGGGGGTGGGGGG + Intergenic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152504768 17:80741536-80741558 CCATGAGGCTGGAGGGTGGATGG + Intronic
1152520423 17:80852878-80852900 CAGTGAGGGTGGAGGATCGGGGG - Intronic
1152574319 17:81133476-81133498 CAGGGAGGGAGGAGGGTGGGAGG - Intronic
1152635349 17:81428576-81428598 CAGGGTGGGTGGAGGGAGTGGGG - Intronic
1152641838 17:81452516-81452538 CAGTGTGTGTGGATGGTAGGAGG + Intronic
1152655561 17:81517762-81517784 GAGTGGGACTGGAGGGGGGGGGG - Intronic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1153904795 18:9651712-9651734 TAGTTTGGCAGGTGGGTGGGTGG - Intergenic
1154286152 18:13058639-13058661 CAGTGAGGAGGGAGGGTGGCTGG + Intronic
1154428203 18:14288338-14288360 TAGGGTGGTGGGAGGGTGGGGGG + Intergenic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155060081 18:22220604-22220626 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
1155356646 18:24960125-24960147 CAATGGGGCGGGGGGGTGGGGGG - Intergenic
1157302736 18:46491137-46491159 CAGTGAGGATGAATGGTGGGAGG - Intronic
1157369522 18:47097877-47097899 CAGTCAGGGTGGAGGGTGGGAGG - Intronic
1157466973 18:47955778-47955800 CAATTTGGCTGGTGGTTGGGAGG - Intergenic
1157579304 18:48764199-48764221 CATTGTGGCTGCAGGATGAGAGG - Intronic
1157606525 18:48929422-48929444 CAGGGTGGCAGGTGGGTAGGTGG - Intronic
1157804524 18:50648323-50648345 CTGTGTGGCTGTGGTGTGGGGGG + Intronic
1157907386 18:51581679-51581701 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907391 18:51581690-51581712 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907396 18:51581701-51581723 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907401 18:51581712-51581734 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907406 18:51581723-51581745 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1158392233 18:57053029-57053051 CAGTATGGCTGGAGTGTGCATGG - Intergenic
1158934625 18:62353173-62353195 CAGTGTGACTGGAGGCTTGCAGG - Intronic
1159351121 18:67274049-67274071 CTTTGTGGGTGAAGGGTGGGAGG + Intergenic
1160158992 18:76456736-76456758 CATGGGGGCTGGGGGGTGGGGGG + Intronic
1160500964 18:79400875-79400897 GAGGGTGGCTGGGGGGAGGGAGG - Intronic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160612758 18:80101399-80101421 CAGTGTGGTTTGGGGGTAGGAGG - Intergenic
1160677539 19:399425-399447 CACAGTGGCTGGTGGGCGGGGGG + Intergenic
1160837351 19:1131200-1131222 AGCTGAGGCTGGAGGGTGGGTGG - Intronic
1161064917 19:2232889-2232911 GAGTGTGGCTGGGGCCTGGGCGG - Intronic
1161125055 19:2551115-2551137 CAGCGTGGCTGGACGGCAGGTGG - Intronic
1161204605 19:3034461-3034483 CAGGGTGGCTGGAGGGGGTTGGG - Intronic
1161325598 19:3662194-3662216 CTGTGTGGCCCGAGGGAGGGTGG - Intronic
1161405787 19:4090486-4090508 GGGTGAGGCAGGAGGGTGGGTGG + Exonic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161649419 19:5475118-5475140 CAGTGTGGCTGGAGTGAGCTGGG + Intergenic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161878488 19:6930326-6930348 AAGTCTGGATGGAGGTTGGGAGG - Intronic
1162063429 19:8110713-8110735 CAGTCTTGCTGGGGGGTGGGGGG - Intronic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162480325 19:10923713-10923735 CAGAGTGGGTGGTGGCTGGGGGG - Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162801921 19:13116081-13116103 CAGTGTGGATGGCGGGGGCGGGG - Intronic
1162946834 19:14049087-14049109 GAGTGGGGCTGGAGGATGGGGGG + Intronic
1163126514 19:15247176-15247198 GAGTGGGGCTGGGGGGTGGGTGG - Intronic
1163273610 19:16268897-16268919 CAGACGGGCTGGTGGGTGGGCGG - Intergenic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163720133 19:18894870-18894892 CCGTCTGGCTGGAGGGTGCAGGG - Intronic
1163774119 19:19208044-19208066 TAGTGTGGCTGGGGTGTGGCTGG + Intergenic
1164149826 19:22541431-22541453 GGGTGTGGCTTGAGGGTGGCGGG - Intergenic
1164797040 19:31041666-31041688 CAGTTTGGGTGGAGGGATGGAGG - Intergenic
1165093315 19:33397590-33397612 CAGTGTGGGTGGTAGGTGTGGGG + Intronic
1165307585 19:35011826-35011848 GAGTGTGGATAGAGGCTGGGAGG + Intronic
1165312810 19:35039264-35039286 TAGGGTGGCTGGGAGGTGGGAGG + Intronic
1165422894 19:35731270-35731292 CAGTGTGGCTGTAAGGGGGCCGG - Intronic
1165454941 19:35904941-35904963 TACAGTGGCTGGAGTGTGGGGGG - Intronic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166088257 19:40491283-40491305 CAGAGTGGCTAGAGAATGGGAGG + Intronic
1166199002 19:41224196-41224218 AAGTGTGCCTGGAGGGTAGTGGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166634024 19:44433555-44433577 AAGTGTGGCGGGAGAGTTGGGGG - Intronic
1166851742 19:45764641-45764663 CAGAGTGGCTGGGGAGGGGGTGG - Intergenic
1166852153 19:45766181-45766203 CTGTGCAGCTGGAGGGCGGGCGG + Intronic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1167288843 19:48613761-48613783 CTGTGTGACTGGTGGGTTGGAGG - Intronic
1167423135 19:49415393-49415415 CTGTGTGGCTGCAGGCAGGGGGG - Intronic
1167429674 19:49447262-49447284 CAGTGTGGGAGGATGGAGGGAGG + Intronic
1167503479 19:49859851-49859873 CAGGGTGGGTGGGGGGTGTGAGG + Intronic
1167513525 19:49909598-49909620 CTGTGTGGCCGGAGTCTGGGTGG + Exonic
1167721592 19:51183696-51183718 CTGTGTGGCTGCAGGCTGAGAGG - Intergenic
1167902647 19:52633515-52633537 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167917898 19:52756965-52756987 CAGGGAGGCTGGAAGGAGGGTGG + Intergenic
1167918144 19:52759227-52759249 CAGTGAGGTTGGAAGGAGGGTGG + Intergenic
1167925231 19:52816082-52816104 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167929565 19:52853248-52853270 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167989082 19:53342550-53342572 CAATGAGGCTGGAAGGAGGGTGG - Intronic
1167992647 19:53373531-53373553 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168001318 19:53448439-53448461 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168005704 19:53485002-53485024 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168112805 19:54203774-54203796 CAGTTGTGCTGGGGGGTGGGGGG - Intronic
1168266789 19:55227778-55227800 CAGAGTGGCTGGAGAGCTGGAGG - Intronic
1168274443 19:55269387-55269409 GAGGGTGGGTGGAAGGTGGGCGG - Intronic
1168355412 19:55696917-55696939 CAGGGTGTCTGGAGGGTTGTCGG + Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168488819 19:56790016-56790038 CAGGGTGGCATGAGGGTGGCTGG - Intronic
1202645363 1_KI270706v1_random:134079-134101 TACTGTGGGTGGAGCGTGGGGGG + Intergenic
1202688747 1_KI270712v1_random:71376-71398 CTTTGAGGGTGGAGGGTGGGAGG + Intergenic
925017597 2:543661-543683 CAGGGAGGGGGGAGGGTGGGAGG + Intergenic
925017619 2:543730-543752 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017627 2:543753-543775 CAGGGAGGCAGGAAGGTGGGAGG + Intergenic
925017633 2:543768-543790 GTGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017666 2:543860-543882 CAGGGAGGCGGGAAGGTGGGAGG + Intergenic
925017690 2:543929-543951 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017704 2:543967-543989 CAGGGAGGCAGGAGGGTGGGAGG + Intergenic
925142984 2:1562648-1562670 CCCTGTGGCTGGAGGGTGCTGGG - Intergenic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
925875876 2:8310738-8310760 TGGTGTGGCGGGAGGGTGTGTGG + Intergenic
925926520 2:8675161-8675183 GAGTGGGGCTGGGGGATGGGTGG - Intergenic
926189883 2:10721013-10721035 CCCTGTGGATGGGGGGTGGGGGG - Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
927123461 2:19990377-19990399 AGGTGTGGCGGGAGGGAGGGCGG - Intergenic
927334755 2:21908901-21908923 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927736330 2:25525938-25525960 GAGTGTGGCTGGAGGTGGTGGGG - Intronic
927824506 2:26298718-26298740 CAGAGTGGCTGGGGGGCGGCAGG + Intergenic
927963279 2:27254223-27254245 CAGGCTGGCTGGAGGGAGGCTGG - Intronic
928065767 2:28163182-28163204 CAGGGTGGCTGCCGGCTGGGAGG - Intronic
928177393 2:29044155-29044177 GGGTGTGGCTGGATGGTTGGTGG + Intronic
928200783 2:29246479-29246501 CATGGTGTCTAGAGGGTGGGTGG - Intronic
928317943 2:30260258-30260280 CACAGGGGCTGGAGGGTGAGTGG + Intronic
928445339 2:31329088-31329110 CAGTGGGGATGGAGAATGGGGGG + Intergenic
928458186 2:31443798-31443820 AGTTGTGGGTGGAGGGTGGGAGG - Intergenic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929652130 2:43691081-43691103 GTGTGTGGCTGGAGGTTGAGTGG - Intronic
930027563 2:47038646-47038668 CTGTGTGTCGGGGGGGTGGGTGG - Intronic
930033540 2:47072229-47072251 CAGGGTGGCTGCAGGCGGGGTGG - Intronic
930036110 2:47086146-47086168 CAGTGTGGCCTGAGCCTGGGAGG - Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931401241 2:61933371-61933393 CAGGGTGGCAGGGGTGTGGGGGG + Intronic
931502171 2:62881236-62881258 ACTTGTGGGTGGAGGGTGGGAGG + Intronic
932222579 2:70011101-70011123 CCTTGAGGGTGGAGGGTGGGGGG + Intergenic
932401401 2:71483172-71483194 AAGTGTGGCTGCAAGGTGTGGGG + Intronic
932497758 2:72155114-72155136 TAGCTTGGGTGGAGGGTGGGGGG - Intergenic
932852862 2:75203282-75203304 ACTTGTGGCTGGAGGGTGGGAGG - Intergenic
933559917 2:83876357-83876379 CAGTTTGGTTGGAGAGAGGGAGG + Intergenic
934492610 2:94771937-94771959 TAGGGTGGTGGGAGGGTGGGTGG - Intergenic
934507765 2:94907661-94907683 TACTGTGGGTGGAGGGTGGGGGG + Intergenic
934714126 2:96533426-96533448 CAGATTGGCTGGAGGTTGGAGGG + Intergenic
934810341 2:97271911-97271933 CAGTGTTGCTGGTGGCTGGCTGG - Intergenic
934827351 2:97436028-97436050 CAGTGTTGCTGGTGGCTGGCTGG + Intergenic
934865972 2:97811555-97811577 CAGTGTGCCTGAAAGGTTGGTGG - Intronic
935046581 2:99489296-99489318 CGCTGTGGCTGGAGTGCGGGTGG + Intronic
935141114 2:100353876-100353898 GAGGGTGGCTGGAGGGAGGCTGG + Intergenic
935182717 2:100704886-100704908 CAGTGTAGCTGTGGGTTGGGGGG + Intergenic
935336904 2:102024468-102024490 CAGGTTTGCTGGTGGGTGGGAGG + Intronic
935708107 2:105873634-105873656 CAGTGAGGCTGGGGGAAGGGTGG + Intronic
936013301 2:108939572-108939594 CAGTGTGGGTGAGGGCTGGGAGG + Intronic
936145868 2:109980359-109980381 CAGCGTGGCTGGAGGGAGCTGGG - Intergenic
936198822 2:110391119-110391141 CAGCGTGGCTGGAGGGAGCTGGG + Intergenic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
937454756 2:122031768-122031790 CAGTGTGGGTGGAGGCTGTTAGG + Intergenic
937861507 2:126714969-126714991 CAGTGTGGATGGCAAGTGGGAGG - Intergenic
938228003 2:129634356-129634378 GAGGGTGGCTGGAGCCTGGGAGG + Intergenic
938798842 2:134741296-134741318 CAGGGTGGCTGGAGTATGGTGGG + Intergenic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
939480593 2:142742832-142742854 CATTGGGGGTGGAGGGAGGGGGG - Intergenic
940100456 2:150031748-150031770 CAATGGGGGTGGGGGGTGGGGGG + Intergenic
940165335 2:150764515-150764537 CAGTGTGGCTGGAAGAGGGGAGG - Intergenic
940398668 2:153222298-153222320 GAGTCTGGCTGGGGGGGGGGGGG + Intergenic
941120464 2:161523829-161523851 CTGTGTGGTTGGAGGATTGGAGG + Intronic
941124641 2:161570765-161570787 CAGTGGGCCAGGAGTGTGGGTGG + Intronic
941539788 2:166768046-166768068 GAGTGTGGGAGGAGGGTGTGGGG - Intergenic
942178347 2:173355677-173355699 GAGTAAGGCTGGGGGGTGGGGGG - Intronic
942328867 2:174800637-174800659 CAGAGTGAAGGGAGGGTGGGTGG - Intronic
942407018 2:175667027-175667049 CAGTGTAGGAGGAGGTTGGGGGG - Intergenic
942512996 2:176722687-176722709 CAGTGGGGATGGCAGGTGGGAGG + Intergenic
944136636 2:196406680-196406702 CAGAGTGGCTGGAGCATGGCGGG - Intronic
944531314 2:200670308-200670330 CAGTGTGAGTGGAGGATGGGAGG - Intronic
944739620 2:202599121-202599143 CAGGATGGCTGGAGCCTGGGAGG - Intergenic
945838849 2:214864818-214864840 AAGGGTAGTTGGAGGGTGGGGGG + Intergenic
946119083 2:217493411-217493433 GAGGGTGAATGGAGGGTGGGAGG - Intronic
946159093 2:217825314-217825336 GAGTGTGGCTAGAGGGAGGTGGG - Intronic
946232725 2:218302556-218302578 TGGTGTGGCTGGAGAGTGGTGGG + Intronic
946308627 2:218870898-218870920 CAGTTTGGAGGTAGGGTGGGAGG + Intronic
946378225 2:219327170-219327192 CAGTGTGGCTGGGATGTGGCTGG + Intergenic
946482049 2:220066575-220066597 GGGTGGGGCTGGAGGATGGGAGG - Intergenic
947459461 2:230290667-230290689 CAGTTTGGCTTGAGGGAAGGAGG + Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
947903896 2:233745709-233745731 CAGAATGGCTGGAGGGTAAGAGG + Intronic
948077841 2:235180193-235180215 ACTTGTGGGTGGAGGGTGGGAGG - Intergenic
948197430 2:236106198-236106220 CAGTGTGGCTGGAGCTGGAGAGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948654999 2:239471080-239471102 CAGGAGGGCAGGAGGGTGGGTGG - Intergenic
948701917 2:239765925-239765947 CAGAGAGGCTGGAGGCTGGCGGG + Intronic
948799569 2:240425855-240425877 CAGTGTTCCTGCTGGGTGGGAGG + Intergenic
948861629 2:240755341-240755363 GAGTGTGGCGGGAGGGAGGGAGG + Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
949079062 2:242082218-242082240 ACTTGAGGCTGGAGGGTGGGAGG + Intergenic
1168852576 20:986645-986667 CATTGGGGGTGGGGGGTGGGGGG + Intronic
1168857627 20:1019832-1019854 GAGGGTGGGTGGAGGGTGGATGG - Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1168862523 20:1056062-1056084 CTGTGTGGCTGGAGGGTGACAGG - Intergenic
1169001248 20:2169411-2169433 CACTGTGGCTGGAAGAGGGGTGG + Intronic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169473781 20:5911668-5911690 CCGTGGGGCTGGCGGGTGAGTGG + Exonic
1169557921 20:6768898-6768920 CGGGGTGGGTGGTGGGTGGGAGG + Intronic
1169973966 20:11302646-11302668 AAGTCTGCCTGGAGGGTGGGAGG + Intergenic
1170199407 20:13726344-13726366 CAGTGTGGCTGGAGCATTGTCGG - Intronic
1170369677 20:15635585-15635607 GAGGGTGGGTGGAGGGAGGGAGG + Intronic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1170789176 20:19493806-19493828 CAGTGTTTCTGGAGTGTGGAGGG - Intronic
1171138547 20:22720530-22720552 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1171321579 20:24248943-24248965 CAGTGTCACTGGAGGCTGTGTGG + Intergenic
1171851771 20:30313851-30313873 CTATGTGGGTGGAGGCTGGGAGG - Intergenic
1171883683 20:30636178-30636200 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1171895321 20:30752999-30753021 TACTGTGGGTGGAGGGTGGGGGG + Intergenic
1171981374 20:31631683-31631705 CAGTGTGGCTGGGGCATGGTGGG + Intergenic
1172020370 20:31909651-31909673 CAGGGTGGCTGGTGGATGTGTGG + Intronic
1172387086 20:34541565-34541587 GAGTGTGGCTGGATGAGGGGTGG - Intergenic
1172440964 20:34966156-34966178 CAGATGGGTTGGAGGGTGGGTGG + Intergenic
1172468681 20:35175328-35175350 AGAAGTGGCTGGAGGGTGGGGGG - Intronic
1172646701 20:36474731-36474753 CAGTGTGTGGGAAGGGTGGGGGG + Intronic
1172799825 20:37567953-37567975 CAGAATGGCTGGTGGGGGGGGGG + Intergenic
1172808724 20:37632033-37632055 CAGAGTGGCTGGGTGGAGGGTGG - Intergenic
1172899183 20:38321348-38321370 CAGTGTGTCTGGTTGGAGGGTGG - Intronic
1172969264 20:38861589-38861611 CAGGCTGGCTGAAGGGTGGGGGG - Intronic
1172997869 20:39084004-39084026 CAGTGGGGCTGGGGGCAGGGTGG + Intergenic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173787304 20:45803505-45803527 CAGTGTGGCTGGAGGTGGAGAGG - Intronic
1173822958 20:46030522-46030544 CAGCGCCGCTGGAGAGTGGGGGG - Intronic
1173909303 20:46652083-46652105 ATGGGAGGCTGGAGGGTGGGAGG + Intronic
1174087473 20:48019366-48019388 ATGTGTGGCTGGAGGGTGAAGGG + Intergenic
1174128814 20:48327604-48327626 ATGTGTGGCTGGAGGGTGAAGGG - Intergenic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1174182709 20:48684805-48684827 CATTGTGGCTGGAGCCTGAGTGG - Intronic
1174403845 20:50291292-50291314 CAGAGTGGCTGGTGGGGAGGTGG + Intergenic
1174555306 20:51391056-51391078 CAGAGTGACTGGAGCTTGGGGGG - Exonic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175313961 20:58032936-58032958 CGGGGTGGGTGGAGGGTTGGGGG + Intergenic
1175392627 20:58636698-58636720 CCGTGAGGCTGGAGTGTGGCAGG - Intergenic
1175472817 20:59244592-59244614 CAGTGTGGCTGGAAGTTGTCAGG - Intronic
1175784392 20:61703431-61703453 CAGTGTGGCTGGGATATGGGCGG + Intronic
1175853601 20:62107061-62107083 CAGAGTGGCTGGAGGGGCAGAGG - Intergenic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1175983589 20:62753400-62753422 CCTTGTGGCAGGAGGTTGGGAGG + Intronic
1175984163 20:62755737-62755759 GAGGATGGCTGGAGGGAGGGAGG - Intronic
1176095095 20:63337831-63337853 CAGTGTGGCTGGTGTGTGGGAGG + Intergenic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176245092 20:64093622-64093644 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245148 20:64093808-64093830 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245177 20:64093891-64093913 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245210 20:64093986-64094008 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245259 20:64094125-64094147 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245281 20:64094197-64094219 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176245367 20:64094464-64094486 CAGTGTGGGGGCAGTGTGGGGGG + Intronic
1176299218 21:5090739-5090761 AGCTGGGGCTGGAGGGTGGGAGG + Intergenic
1176591264 21:8652389-8652411 CTGTGCGGCTGTGGGGTGGGGGG + Intergenic
1176725913 21:10432368-10432390 GACTGTGTGTGGAGGGTGGGGGG - Intergenic
1176843871 21:13861763-13861785 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1176846556 21:13881084-13881106 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1177956685 21:27606644-27606666 CAGTGTGGCTCTCAGGTGGGCGG + Intergenic
1178377061 21:32075543-32075565 AAGTGTGGCCGGGGGGCGGGGGG - Intergenic
1178628420 21:34238292-34238314 ACTTGAGGCTGGAGGGTGGGAGG + Intergenic
1178640011 21:34338013-34338035 CAGTGTGGCTGGCGAGGGTGTGG + Intergenic
1178695059 21:34785760-34785782 GAGGGTGGGTGGAGTGTGGGTGG + Intergenic
1178903569 21:36616958-36616980 CAGCGAGGCTGGAGTGGGGGGGG + Intergenic
1179083297 21:38193308-38193330 ACTTGTGGGTGGAGGGTGGGAGG - Intronic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179363608 21:40735551-40735573 CAGTGTGTCTGGAATGTAGGTGG - Intronic
1179400096 21:41075805-41075827 CAGTACCGGTGGAGGGTGGGAGG - Intergenic
1179549643 21:42135733-42135755 CACTTTGGCTGGAGGGTGGGAGG + Intronic
1179576177 21:42309900-42309922 CCGTCGGGCTGGGGGGTGGGTGG + Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179750818 21:43466534-43466556 CAGGGTGGTCGGAGGGGGGGGGG - Intergenic
1179857808 21:44171208-44171230 AGCTGGGGCTGGAGGGTGGGAGG - Intergenic
1179937455 21:44614359-44614381 CACTGTGGCTGGAGGGAGCCCGG + Intronic
1179971267 21:44837627-44837649 CAGGGTGGCTGTGGGCTGGGGGG + Intergenic
1179986966 21:44927515-44927537 CAGGCAGGTTGGAGGGTGGGCGG - Intronic
1180274112 22:10629500-10629522 CTGTGCGGCTGTGGGGTGGGGGG + Intergenic
1180356599 22:11848365-11848387 TACTGTGGGTAGAGGGTGGGGGG - Intergenic
1180381663 22:12143966-12143988 TACTGTGGGTGGAGGGTGGGGGG + Intergenic
1180552679 22:16553225-16553247 CTTTGAGGGTGGAGGGTGGGAGG - Intergenic
1180639978 22:17290666-17290688 CAGTGAGGGTGGAGGGTGTCGGG - Intergenic
1181033613 22:20159643-20159665 TGGTGTGGGTGGTGGGTGGGAGG - Intergenic
1181462803 22:23095313-23095335 CTGAGTGGCTGGAGGGTTGGAGG - Exonic
1181514736 22:23404079-23404101 CAGAGTGGCTGGGGGGTGTCTGG - Intergenic
1181536975 22:23551392-23551414 AAGTGTGGATGGAGGATGGCTGG - Intergenic
1181639647 22:24189868-24189890 CTGGGTGGCAGGAGGTTGGGAGG + Intergenic
1181870600 22:25895728-25895750 CAGTGTGGCAGGTGGTTGAGAGG - Intronic
1182061244 22:27399342-27399364 TAGTGTGGCTGGCGGGTGGGGGG + Intergenic
1182250426 22:28995709-28995731 AAGTGTGGCTGGGGGCTGGTAGG + Intronic
1182267533 22:29129715-29129737 TAGTGGGGGTGGAGGGTGAGGGG + Intronic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183001617 22:34864339-34864361 AGGTGTGTATGGAGGGTGGGCGG - Intergenic
1183268924 22:36848875-36848897 CCCTGTGGCGGGGGGGTGGGGGG - Intergenic
1183302176 22:37063807-37063829 CAGGGTGGGTGGAGGGTCTGGGG - Intergenic
1183327643 22:37203153-37203175 CATTGGGGCTGTAGGGTGAGGGG - Intergenic
1183507883 22:38219646-38219668 CTGTTTGCGTGGAGGGTGGGGGG - Exonic
1183870532 22:40738436-40738458 AATTGTGGGTGGAGGGTGGGAGG + Intergenic
1183971319 22:41479651-41479673 CAGTGAGGCTGGTGGGGGAGAGG + Intronic
1184110005 22:42389012-42389034 CTGGGTGGGTGGAGGGTTGGGGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184225825 22:43128367-43128389 CCGGGTGGCTGTGGGGTGGGAGG + Intronic
1184541084 22:45125522-45125544 TGGTGTGGCGGGAGGGTGAGGGG - Intergenic
1184678198 22:46054568-46054590 CAGCAGGGGTGGAGGGTGGGAGG + Intronic
1184717546 22:46290533-46290555 CAGCGTGGCTGGAGGGTGTTAGG + Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1185014047 22:48333246-48333268 GAGTGAGGCTGGAGGGAGGCGGG - Intergenic
1185118042 22:48949180-48949202 GAGTGAGGCTGGAGGAGGGGGGG - Intergenic
1185134285 22:49060308-49060330 CAGGAGGGCTGGAGGGTGGAAGG - Intergenic
1185276298 22:49951467-49951489 CCCTGTGGCAGGAGGTTGGGCGG + Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185379304 22:50500363-50500385 CACTTTGGCAGGATGGTGGGGGG + Intergenic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950205304 3:11075720-11075742 CGGGGAGGCTGGAGGGTGAGAGG - Intergenic
950331328 3:12158449-12158471 CAGTATGGCCGGAGTGAGGGAGG + Intronic
950583668 3:13878916-13878938 CGCTCTGGCTGGAAGGTGGGAGG - Intronic
952093583 3:29921486-29921508 CTGTTTGGCAGGGGGGTGGGGGG + Intronic
952405865 3:33004724-33004746 GAGTGTGGCAGTAGGGAGGGAGG - Intronic
952777707 3:37061935-37061957 CAGTGTGGTTGAAGGGTTGTTGG - Intronic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
953069125 3:39502411-39502433 CAGGGAGACTGGAAGGTGGGTGG + Intronic
953493913 3:43370538-43370560 AAACCTGGCTGGAGGGTGGGTGG + Intronic
953742233 3:45547770-45547792 CAGTGTGGGTGGGGGGTGAGGGG - Exonic
954230983 3:49217474-49217496 CAGGCTGGTTGGGGGGTGGGGGG + Intronic
954317955 3:49811520-49811542 CAGGGTGGATGGAGGGTGGCTGG - Intronic
954394565 3:50286662-50286684 CAGTGTGCCTGCTGGGTGGATGG - Exonic
954456528 3:50602669-50602691 CAGAGTGGTTGGAGAGTGGCTGG - Intergenic
954681270 3:52347313-52347335 CAGTGTGGCTGGAGTCAGGGAGG + Intronic
955060477 3:55488323-55488345 CAGAAGGGCTGGGGGGTGGGAGG - Intronic
955502880 3:59602414-59602436 TATCGGGGCTGGAGGGTGGGAGG - Intergenic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
956476813 3:69631026-69631048 AATGGGGGCTGGAGGGTGGGAGG - Intergenic
957073142 3:75581087-75581109 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
958957359 3:100477837-100477859 CGGGGCGGCTGGCGGGTGGGGGG + Intergenic
959519637 3:107310635-107310657 ACGTGAGGGTGGAGGGTGGGAGG - Intergenic
960302368 3:116019148-116019170 CATTGTGGGTGGGGGGGGGGGGG + Intronic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
960785733 3:121371609-121371631 CAGTATGTCTGGGGCGTGGGGGG + Intronic
961146939 3:124601934-124601956 GAGTATGGCTTGAGTGTGGGAGG + Intronic
961329001 3:126128018-126128040 CAGTGGGGCATGAGGGTGGAGGG + Intronic
961381783 3:126500240-126500262 CAGTGGGGCTGGAAGTTGGTGGG - Intronic
961554794 3:127690456-127690478 CAGGGCTGCTGGAGGGAGGGTGG + Exonic
961657977 3:128453732-128453754 CAGTGTGGTTGGCGGGCAGGTGG + Intergenic
961663179 3:128481114-128481136 CGGAGTGGCTGAAGGGCGGGAGG + Exonic
961815963 3:129550525-129550547 CAGAGTGGCTGGAGGGTTAACGG - Intronic
961873454 3:130003892-130003914 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
962082639 3:132156674-132156696 CAATGTGCCTGTGGGGTGGGGGG - Intronic
962270654 3:133975653-133975675 CAGTATGGCTGGATGGAGGGAGG - Intronic
962310482 3:134323428-134323450 CACTGAGACTGGAGGCTGGGAGG + Intergenic
962860974 3:139401181-139401203 ACGTGAGGATGGAGGGTGGGAGG - Intergenic
963081670 3:141400926-141400948 CCCTGTGACTGGAAGGTGGGAGG - Intronic
963500217 3:146116214-146116236 CTGTGTGTTTTGAGGGTGGGTGG - Intronic
963674405 3:148290953-148290975 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
963825158 3:149945352-149945374 CAGCAAGGCTGGGGGGTGGGGGG + Intronic
963863525 3:150335049-150335071 GGGAGTGGCTGGAGAGTGGGAGG + Intergenic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966355517 3:179074465-179074487 GTGTGTGGCTGGTGGGTGGGTGG - Intergenic
966529403 3:180958385-180958407 CAGTGTGGAGGAAGGTTGGGAGG - Intronic
966670581 3:182521696-182521718 CAGTTTGGCAGGAGAATGGGGGG + Intergenic
966881713 3:184354487-184354509 CCCTGTGGCTGGGGCGTGGGTGG + Intronic
966941489 3:184750674-184750696 CAGGCTGCATGGAGGGTGGGTGG + Intergenic
967010679 3:185430446-185430468 ACGTGAGGGTGGAGGGTGGGGGG - Intronic
967333600 3:188317974-188317996 CTGTGTATCTGGAGTGTGGGAGG + Intronic
967569879 3:191016149-191016171 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968019234 3:195369416-195369438 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
968078449 3:195830020-195830042 CAGAGGAGCTGGAGGGCGGGCGG - Intergenic
1202741282 3_GL000221v1_random:58775-58797 CAGTGTTGCTGGAGGCTCAGTGG - Intergenic
968468128 4:763306-763328 CAGTGGGGCTGCAGGGGGTGGGG + Intronic
968581889 4:1399104-1399126 TACTTTGGCTGGAGGCTGGGAGG + Intergenic
968598936 4:1500188-1500210 CAGGGTGGCAGGAGGATGGCAGG - Intergenic
968615072 4:1574023-1574045 CAGTGTGGCTGCTGGGAAGGAGG - Intergenic
968661409 4:1800240-1800262 CAGGGTGGCTGGCAGGAGGGTGG + Intronic
968690706 4:1988423-1988445 CAGTGTGGCTGAAGGGTCAGGGG + Intronic
968901173 4:3432648-3432670 GTTTGTGGCAGGAGGGTGGGTGG + Intronic
968943666 4:3652460-3652482 CCCAGTGGCTGGAGGGAGGGAGG + Intergenic
968977563 4:3829954-3829976 AGGTGTGGCTGGAGGTGGGGTGG + Intergenic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969479708 4:7441420-7441442 GAGGGTGGCTGGAGGCTGAGTGG + Intronic
969575787 4:8034996-8035018 CAGTGCGGGTGGGTGGTGGGTGG + Intronic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
970125079 4:12800010-12800032 CTATGAGGTTGGAGGGTGGGAGG + Intergenic
970170099 4:13280828-13280850 AGGTGGTGCTGGAGGGTGGGAGG - Intergenic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
970272385 4:14360776-14360798 CAGTGTGCCGGGAGGGGGGGCGG + Intergenic
970657607 4:18248861-18248883 CAGGTTGGCTGGAGGCTGGTTGG + Intergenic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
971829499 4:31672400-31672422 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
972075963 4:35087587-35087609 CAGTTTGGCTGGAGGCTTGCTGG - Intergenic
972254783 4:37341892-37341914 CAGTGTGGCTAATGGGTGAGAGG + Intronic
973367339 4:49218449-49218471 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
973389421 4:49542817-49542839 TACTGTGGGTGGAGGGTGGGGGG - Intergenic
974115241 4:57571135-57571157 CAGCCTGGCTGGCGGGGGGGGGG - Intergenic
974774582 4:66463054-66463076 CAGCGAGGCTGGGGGGAGGGGGG - Intergenic
974900845 4:67996038-67996060 AATTGAGGGTGGAGGGTGGGAGG - Intergenic
975400325 4:73929960-73929982 CAAGGAGGGTGGAGGGTGGGAGG + Intergenic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976528242 4:86118381-86118403 CAGTGTGGCTGGAGAATTGTTGG - Intronic
977603060 4:98955002-98955024 CAGGCTGGCTTTAGGGTGGGTGG + Intergenic
977908351 4:102501857-102501879 GAGTGGGGCTGGAGGGGGTGCGG - Intronic
977978705 4:103297393-103297415 CACACTGGATGGAGGGTGGGAGG - Intergenic
978207353 4:106093672-106093694 ACTTGAGGCTGGAGGGTGGGAGG + Intronic
978457070 4:108906216-108906238 CAGTGTGGCTGGAGTATGTGAGG - Intronic
979215509 4:118159142-118159164 CAGAGGGGCAGAAGGGTGGGTGG + Intronic
980578852 4:134721889-134721911 TACTGCGGGTGGAGGGTGGGAGG + Intergenic
981079027 4:140619940-140619962 CCTTGAGGGTGGAGGGTGGGTGG - Intergenic
981142949 4:141291699-141291721 CAGTGAGCCAGGTGGGTGGGCGG + Intergenic
981178417 4:141709918-141709940 TAGTGTGGGGGGAGGGTGGGAGG - Intronic
981387979 4:144153611-144153633 CAGTGAGGCTGGGGGTGGGGGGG - Intergenic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
982018006 4:151174881-151174903 CAGTGGAGCTGAAGGGTAGGTGG + Exonic
982207345 4:153006477-153006499 AAATGAGGCTGGAAGGTGGGTGG + Intergenic
982452601 4:155570788-155570810 CACTGTGGCTGGAGGTGGGGAGG + Intergenic
982547244 4:156749277-156749299 CAGTGGGCATGGAGAGTGGGGGG + Intergenic
983019928 4:162663075-162663097 AAATTTGGCTGCAGGGTGGGTGG + Intergenic
984140795 4:176002053-176002075 CAGTGGGTCGGGAGGGTGGGGGG - Intronic
985491948 5:185515-185537 GAGTGTGGCTAGAGCCTGGGCGG - Exonic
985555770 5:557266-557288 GAGTGTGGCTGGAGGATCCGAGG - Intergenic
985611377 5:891534-891556 CTGCGTGGCTGGAGGAGGGGAGG - Intronic
985847329 5:2360091-2360113 CAGAGTGGCTGGAAGTCGGGGGG - Intergenic
986182791 5:5409165-5409187 AAGTGGGGCTGGAAAGTGGGTGG + Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
986950698 5:13080897-13080919 CAGTGCTGGTGGAGGTTGGGAGG - Intergenic
987400955 5:17476153-17476175 ACCTGTGGGTGGAGGGTGGGAGG + Intergenic
987939285 5:24511979-24512001 ACTTGAGGCTGGAGGGTGGGAGG + Intronic
988043793 5:25921513-25921535 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
988564629 5:32311762-32311784 GAGTGTGTCTGAAGGGTTGGCGG - Intronic
989330436 5:40251952-40251974 GCTTGAGGCTGGAGGGTGGGAGG - Intergenic
989579184 5:43016312-43016334 CAGTGTGGTTGGAGGCGGGGTGG - Intergenic
989667530 5:43873831-43873853 CAGAATGGGTGGAGGCTGGGAGG + Intergenic
990178867 5:53138063-53138085 GAGAGTGGCTGGAGGCTGGTGGG + Intergenic
990200995 5:53374157-53374179 CAGAAAGGCCGGAGGGTGGGAGG + Intergenic
990446855 5:55901328-55901350 CAGTGTGGCCCCAGGATGGGAGG + Intronic
990487506 5:56273727-56273749 GAGTGTGACTGGAGGTTGGGAGG - Intergenic
990521843 5:56588606-56588628 CAGAGTGGCTTGGGGGTCGGGGG + Intronic
991584780 5:68190810-68190832 GTGTGTGGGTGGAGGGTTGGGGG - Intronic
991649691 5:68839159-68839181 CAGTGGGGCAGGGAGGTGGGGGG - Intergenic
992593322 5:78318692-78318714 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
992857991 5:80883601-80883623 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
992921373 5:81525328-81525350 CCTTGAGGATGGAGGGTGGGAGG - Intronic
992978662 5:82142661-82142683 CAGTGTGGAGGGTGCGTGGGAGG + Intronic
993075610 5:83226356-83226378 CTCTGGGGCTGGAGGGAGGGTGG + Intronic
993116185 5:83722332-83722354 TAGTGGGGCAGGAGGATGGGCGG + Intergenic
993578924 5:89635649-89635671 CAAGGTGGCTGCAAGGTGGGGGG - Intergenic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996545063 5:124669315-124669337 CACTCTGGCTGAAAGGTGGGGGG + Intronic
996739905 5:126789173-126789195 CACTGTGTCTGGCGGGAGGGAGG + Intronic
996811214 5:127517866-127517888 CGGTGTCCCTGGAAGGTGGGCGG + Intronic
997162062 5:131619314-131619336 CGGCGGGGCTGGAGGGCGGGGGG + Intronic
997358702 5:133280769-133280791 CAGCGTGGCTGGAATGTGGAGGG - Intronic
998128355 5:139638817-139638839 CAGTGAGGCAGGAGGCTGGCTGG - Intergenic
998163718 5:139828423-139828445 CATTGGGGCTGGATGGTGGAGGG + Intronic
998369868 5:141654030-141654052 CAGTGGGGCTGGGGGATTGGGGG + Exonic
998387785 5:141767915-141767937 CCGGGTGGCTCGAGGGTGGACGG + Intergenic
999858560 5:155620975-155620997 CAGTCTGGCAGCAGGGAGGGAGG + Intergenic
1000845405 5:166273875-166273897 ATGTGTGGTTAGAGGGTGGGGGG + Intergenic
1001019842 5:168173576-168173598 GAGTGTGGCTGGTGTGGGGGAGG - Intronic
1001315402 5:170638023-170638045 GGGTGTGTCTGGGGGGTGGGGGG + Intronic
1001411335 5:171514600-171514622 AAGAGTGGCCGGAGGGTAGGAGG + Intergenic
1001572122 5:172736825-172736847 CACTGGGGGTGGGGGGTGGGGGG - Intergenic
1002202689 5:177539123-177539145 CAGGCTGGCTGGAGGCGGGGGGG + Exonic
1002320495 5:178372660-178372682 GAGGGTGGCTTGAGGCTGGGAGG - Intronic
1002346004 5:178547778-178547800 CAGTGTGTGTGGGGGGTGTGTGG - Intronic
1002521066 5:179793527-179793549 CAGTGTGGCTGGGGGGGCGCTGG + Intronic
1002607289 5:180390753-180390775 CAGGATGGATGGAGGTTGGGAGG - Intergenic
1002644476 5:180646408-180646430 CGGTGAGGCTGGAGTCTGGGAGG - Intronic
1002774955 6:320704-320726 CAGTGGGGAGGGAGGGTGAGGGG + Intronic
1002800261 6:515534-515556 CAGTGTGGCTCCAGGGTGCTAGG + Intronic
1002872526 6:1179669-1179691 CAGTGTGGCTGGAGCAGGGGAGG - Intergenic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1003421659 6:5963784-5963806 CAGGGTAGCTGGAGTCTGGGTGG - Intergenic
1003494750 6:6654096-6654118 CAGTGGGGCTGCAGGGAGTGGGG - Intronic
1003739066 6:8914018-8914040 TATTGAGGGTGGAGGGTGGGAGG + Intergenic
1003990173 6:11478747-11478769 TACTGAGGGTGGAGGGTGGGAGG + Intergenic
1004227745 6:13802452-13802474 CAGTGTGGTAGGAGGCAGGGAGG + Intronic
1004500529 6:16206039-16206061 GAGGATTGCTGGAGGGTGGGAGG - Intergenic
1004589348 6:17033547-17033569 AAAAGTGGCTGGAGCGTGGGCGG - Intergenic
1004692542 6:18004772-18004794 CAGTGAGGCTGGAGGGAGCCAGG - Intergenic
1004879612 6:19994898-19994920 CTGTGTGGTTGCAGGGTGGGAGG - Intergenic
1005122323 6:22403296-22403318 CAGTGTCCTTGGAGGGTGGAAGG - Intergenic
1005172243 6:23001443-23001465 TATTGAGGGTGGAGGGTGGGAGG + Intergenic
1005618466 6:27597970-27597992 CAGTTTGTCTGGGGGGAGGGGGG - Intergenic
1005812666 6:29529143-29529165 CAGGGGTGCTGGAGGGTGTGTGG - Intergenic
1006073609 6:31515316-31515338 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1006272549 6:32975138-32975160 CAGAGTGGGTGGGAGGTGGGTGG + Intronic
1006379916 6:33691480-33691502 CACTGTGGCTGGACAGTGGAGGG + Intronic
1006397952 6:33799251-33799273 CAGCGTGGGTTGAGGGAGGGCGG - Intronic
1006509348 6:34513517-34513539 CAGTGTGGGTGGTGGGTGGCAGG - Intronic
1006620278 6:35359159-35359181 CAGCGTGGCTGGACAGAGGGAGG + Intronic
1006803108 6:36771820-36771842 CACTGGGGCTGGGGGGCGGGGGG + Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007363446 6:41374115-41374137 CCGTGTGGCTGGGGGAGGGGTGG + Intergenic
1007400538 6:41600113-41600135 CAGGGTGGATGGAGGAGGGGTGG - Exonic
1007772244 6:44201301-44201323 CAGTGTGGGTGGGGAATGGGCGG - Intergenic
1007936146 6:45733784-45733806 ACTTGTGGGTGGAGGGTGGGAGG - Intergenic
1008268647 6:49463271-49463293 TAGATTGGCTGGAGGGAGGGCGG - Intergenic
1008628199 6:53338089-53338111 AAGGGTGGATGGTGGGTGGGTGG + Intronic
1008987091 6:57557613-57557635 CCTTGAGGGTGGAGGGTGGGAGG + Intronic
1009175049 6:60450180-60450202 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1009247397 6:61256194-61256216 ACCTGAGGCTGGAGGGTGGGAGG - Intergenic
1009656478 6:66552568-66552590 CCATGAGGGTGGAGGGTGGGAGG + Intergenic
1009804704 6:68588541-68588563 AGTTGTGGGTGGAGGGTGGGAGG - Intergenic
1010833342 6:80557008-80557030 CAATGTGGCAAGAGGGTGGTGGG - Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1012485652 6:99719878-99719900 ACTTGTGGGTGGAGGGTGGGAGG - Intergenic
1012546083 6:100420951-100420973 CTGTGTCTCTGCAGGGTGGGAGG + Exonic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013993467 6:116279909-116279931 TAGTGAGACTGTAGGGTGGGCGG - Intronic
1014372034 6:120621885-120621907 CAATGTGGCTGGATGGGGTGAGG + Intergenic
1016385526 6:143527346-143527368 GAGTATGGCTGGAGGCTTGGAGG - Intergenic
1016915912 6:149244342-149244364 CGGTGGCGGTGGAGGGTGGGTGG + Intronic
1016990801 6:149926309-149926331 CAGTGAGGGTGGAGGGGGTGGGG - Intergenic
1016992203 6:149938163-149938185 CTGTGAGGCTGGAGGGGGTGGGG + Intergenic
1016994759 6:149954103-149954125 CTGTGAGGCTGGAGGGGGTGGGG + Intergenic
1017003847 6:150015333-150015355 CTGTGAGGCTGGAGGGGGTGGGG - Intergenic
1017007533 6:150038450-150038472 CAGTGAGGGTGGAGGGGGTGGGG - Intergenic
1017684654 6:156899612-156899634 AAGTTTGGCTGCAGGGTGTGGGG - Intronic
1017721769 6:157248083-157248105 CAGTGTGTCTGGGGGTGGGGTGG + Intergenic
1017993999 6:159515362-159515384 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1018591688 6:165432412-165432434 CAGCGTGGCTGGAGCGAGTGAGG + Intronic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018840612 6:167514123-167514145 CAGTGTGACTGGGGGGTGGGGGG + Intergenic
1019183212 6:170205543-170205565 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1019323597 7:426469-426491 GAGTGTTGGTGGAGGGTGGAGGG - Intergenic
1019698396 7:2460521-2460543 CTGAATGGCTGGCGGGTGGGAGG + Intergenic
1019873131 7:3785184-3785206 TATCGAGGCTGGAGGGTGGGGGG + Intronic
1020010628 7:4804004-4804026 CAGTGGGGCTGGAGGGTTCCTGG - Intronic
1020070814 7:5225868-5225890 CAGTGTTGCTGGAGGCGGAGAGG - Exonic
1020111583 7:5450948-5450970 CACCCAGGCTGGAGGGTGGGGGG + Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1021303110 7:18996831-18996853 GTGTGTGGCTGGGAGGTGGGGGG - Intronic
1021389589 7:20075155-20075177 CAGTGTGGGTGGTGGGGAGGGGG + Intergenic
1022044805 7:26614127-26614149 CAGAGTGGCTGGGGGGTTGAAGG + Intergenic
1022098155 7:27153652-27153674 GAGTATGGCTGGAGGGCAGGGGG - Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023312492 7:38902340-38902362 CAGTGTGGCTGGAGGGTCACAGG - Intronic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1023682261 7:42699430-42699452 CAGCGGGGTTGGGGGGTGGGCGG + Intergenic
1023888178 7:44375417-44375439 CAGTGTGTCTGGTGGCCGGGAGG - Intergenic
1024282054 7:47726494-47726516 CATTCTGGCTGGAGGGTGCAGGG + Intronic
1024300335 7:47882668-47882690 CCTAGTGGTTGGAGGGTGGGAGG + Intronic
1024351218 7:48366898-48366920 CAGTGTGTCGGCAAGGTGGGAGG - Intronic
1024712258 7:52029426-52029448 GGGTGTGGATGGATGGTGGGGGG - Intergenic
1024939351 7:54746067-54746089 CAGTGAGACTGGAGGACGGGAGG - Intergenic
1025061123 7:55809256-55809278 CCTTGAGGGTGGAGGGTGGGAGG + Intronic
1025251231 7:57352843-57352865 CACAGTGGCGGGAGAGTGGGTGG + Intergenic
1026275056 7:68869340-68869362 TGTTGTGGCTGGAGGGTGGGAGG - Intergenic
1026461854 7:70621301-70621323 CACTGTGGGGGCAGGGTGGGGGG + Intronic
1026470728 7:70692926-70692948 GAGTGTGGCTGGAGGAAGAGAGG - Intronic
1026533856 7:71223702-71223724 CATGGAGGGTGGAGGGTGGGAGG - Intronic
1026735174 7:72944762-72944784 CAGTGTGGCTGCAGGAGTGGTGG + Intronic
1026785515 7:73299691-73299713 CAGTGTGGCTGCAGGAGTGGTGG + Intergenic
1026808180 7:73441000-73441022 CAGTGTCGGTGGGGGGTGGGAGG - Exonic
1026931041 7:74223127-74223149 CCGGGTGGCTGGAGAGAGGGAGG - Intronic
1026984379 7:74545844-74545866 CAGGGCGGCTGGAGGGGGGCCGG - Intronic
1027108557 7:75420245-75420267 CAGTGTGGCTGCAGGAGTGGTGG - Intronic
1027246809 7:76373239-76373261 GAGTGAGGCTGGAGGGTTAGGGG + Intergenic
1027655894 7:80930436-80930458 GAGTGTGGGGGGAGGGTGGTGGG - Intergenic
1028395513 7:90364832-90364854 CAGTGAGGCTGGCGGGGGAGGGG - Intronic
1028492787 7:91432362-91432384 CAGTGTGGGTGGAGGGGTCGAGG + Intergenic
1029980625 7:104875342-104875364 GAGGGTGGCTGGAGGGTGTGAGG - Intronic
1030199746 7:106890794-106890816 CAGTGTGGCATGAGGCTGGAGGG - Intronic
1030916881 7:115326009-115326031 CAGTGTGGTTGGCGGTAGGGTGG + Intergenic
1031840953 7:126738687-126738709 CAGTGTGGGGGGTGAGTGGGGGG + Intronic
1032117332 7:129127807-129127829 GGGTGAGGCAGGAGGGTGGGTGG - Intergenic
1032183067 7:129698324-129698346 CATTTTGGCAGGGGGGTGGGGGG + Intronic
1032703067 7:134398936-134398958 CTTGGTGGCTGGGGGGTGGGGGG - Intergenic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033753698 7:144379896-144379918 CAGGCTGGCTGGAGGGCGTGAGG + Exonic
1034240327 7:149605843-149605865 CAGAGTAGCTGGAGGGCTGGCGG - Intergenic
1034471696 7:151258098-151258120 CAGAGTGGATGTAGGGTGTGAGG - Intronic
1034527029 7:151671516-151671538 CATTCTGGCAGCAGGGTGGGTGG - Intronic
1034896183 7:154877879-154877901 CAGTGTGGAAGGAGGATGGGTGG + Intronic
1035284774 7:157799195-157799217 GGGTGAGGCTGGAGCGTGGGTGG + Intronic
1035294099 7:157858110-157858132 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294118 7:157858177-157858199 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294128 7:157858212-157858234 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294182 7:157858413-157858435 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294232 7:157858583-157858605 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294284 7:157858755-157858777 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294345 7:157858959-157858981 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294364 7:157859026-157859048 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294374 7:157859061-157859083 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294428 7:157859262-157859284 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294478 7:157859432-157859454 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294510 7:157859537-157859559 GAGTGTGGGTGGTGGCTGGGGGG - Intronic
1035294522 7:157859572-157859594 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294532 7:157859607-157859629 GAGTGTGGGTGGTGGCTGGGGGG - Intronic
1035294553 7:157859674-157859696 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035294583 7:157859774-157859796 GAGTGTGGGTGGTGGCTGGGGGG - Intronic
1035294619 7:157859910-157859932 GAGTGTGGGTGGTGGCTGGGAGG - Intronic
1035468858 7:159097090-159097112 CAGGGTTGCAGGAGGGTTGGCGG + Intronic
1035537323 8:402224-402246 ACTTGAGGCTGGAGGGTGGGAGG + Intergenic
1036242306 8:7091197-7091219 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036259543 8:7228959-7228981 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036307080 8:7610565-7610587 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036311587 8:7687529-7687551 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036357926 8:8058552-8058574 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036507195 8:9366549-9366571 CAGAGTGTCTGGAGGGTGAGAGG - Intergenic
1036669960 8:10776832-10776854 CAGTGTGGGGGAAGGGTTGGCGG - Intronic
1036737281 8:11330256-11330278 CAGGGCGGCTGGCCGGTGGGGGG - Intergenic
1036830433 8:12015933-12015955 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036891965 8:12602258-12602280 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036893021 8:12608394-12608416 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1037061498 8:14516294-14516316 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1037734602 8:21556175-21556197 CTGAGTGGCAGGAGGGTGTGTGG - Intergenic
1038543111 8:28405251-28405273 CAGAGTGAATGGAGGGTTGGAGG + Intronic
1038814373 8:30886365-30886387 CAGTGTTGGTGGAGGATGAGTGG - Intronic
1038949047 8:32393727-32393749 TATTGAGGGTGGAGGGTGGGAGG + Intronic
1039385051 8:37128278-37128300 CATTGTGGCTGGAGAGTGAGTGG + Intergenic
1040103117 8:43522300-43522322 CAGTGTTGGTTGAGGGTGGGGGG + Intergenic
1040571252 8:48613253-48613275 CATTGTTGCTGGAGGGAGAGGGG + Intergenic
1040671956 8:49702746-49702768 AATTGTGGGTGAAGGGTGGGAGG + Intergenic
1041220107 8:55642244-55642266 TCTTGAGGCTGGAGGGTGGGAGG - Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041976375 8:63803606-63803628 CACTTTGTCTGGACGGTGGGAGG - Intergenic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043147530 8:76676823-76676845 GAGTGTAGCTGGAGGAGGGGAGG + Intergenic
1043212475 8:77540358-77540380 CGGTGTGGCAGGAGGGCTGGAGG + Intergenic
1043349537 8:79343575-79343597 CATTATGGCTGGGGGGGGGGGGG - Intergenic
1044237096 8:89843545-89843567 CTTTGAGGTTGGAGGGTGGGAGG - Intergenic
1045489602 8:102658061-102658083 GAGTGTGGGTGGAGGTTGGGTGG - Intergenic
1045511211 8:102813263-102813285 CAGGGTGGATGGTGGGTGGCAGG + Intergenic
1046417191 8:113933107-113933129 CAGTGTGGTTAGAGGGTGTGTGG - Intergenic
1047367236 8:124222693-124222715 AAGTATGGCTGGGGGGAGGGCGG + Intergenic
1047398421 8:124525105-124525127 AAGTGTGGAAGGATGGTGGGTGG - Intronic
1047555340 8:125923308-125923330 CAGTGAGGATGGAGACTGGGGGG + Intergenic
1047685545 8:127301759-127301781 CAATGTTGGTGGCGGGTGGGGGG + Intergenic
1048107861 8:131430967-131430989 CAGTGAGGTTGGAGGGTGGGAGG - Intergenic
1048214282 8:132480956-132480978 GCGTGTGGCTGGCGGGCGGGAGG - Intergenic
1048512416 8:135074861-135074883 CAGTGTGCTTGGAAGGTGGGAGG + Intergenic
1048853199 8:138663857-138663879 CAGTGTGGCTTCAAGGTGGGAGG - Intronic
1048860302 8:138719894-138719916 CCCTGTGGGTGGAGGGCGGGAGG + Intronic
1048896143 8:138994028-138994050 CAATGTGGCAGGAGGGGGAGAGG - Intergenic
1049386492 8:142345427-142345449 CAGTCGGGCTTGAGGGTGAGGGG + Intronic
1049406966 8:142455896-142455918 CTCTGTGACAGGAGGGTGGGTGG + Intronic
1049476740 8:142800387-142800409 CAGTGGGGCTGGAGACAGGGGGG - Intergenic
1049573009 8:143378364-143378386 CAGGGCTGCAGGAGGGTGGGTGG - Intronic
1049614805 8:143571465-143571487 CTCTGTGGCAGGAGTGTGGGGGG + Intronic
1049994857 9:1025219-1025241 AAGTGTGTCTGTTGGGTGGGAGG + Intergenic
1050028113 9:1356787-1356809 CACTGTGACTGGAGGGCTGGGGG - Intergenic
1050258929 9:3820863-3820885 CAGGCTAGCTGGAGGGTTGGAGG - Intergenic
1050340810 9:4636841-4636863 CATTGTGGCTGGAGCGTGGCTGG - Intronic
1050483869 9:6114191-6114213 AACTGTGACTGGGGGGTGGGGGG - Intergenic
1050663872 9:7913263-7913285 CATTGTGGGTGGGTGGTGGGAGG + Intergenic
1050927195 9:11279255-11279277 GAGGGTGGCTGGAGTCTGGGAGG - Intergenic
1051088596 9:13380450-13380472 CTGGGAGGCTGGAGGCTGGGGGG + Intergenic
1051617808 9:19023143-19023165 CGGTGGGGCGGGGGGGTGGGGGG - Intronic
1051691982 9:19724516-19724538 GAGTGTGGGTAGAGGTTGGGAGG + Intronic
1052831741 9:33221404-33221426 CAGTGTGCCTGGAGGGTTCAGGG - Intronic
1052985718 9:34485921-34485943 CAGTGGGGCTGGGGGTGGGGAGG - Intronic
1053664146 9:40305738-40305760 TAGAGTGGTGGGAGGGTGGGTGG + Intronic
1053665113 9:40311943-40311965 TAGAGTGGTGGGAGGGTGGGTGG + Intronic
1053914694 9:42936993-42937015 TAGGGTGGTGGGAGGGTGGGTGG + Intergenic
1053916007 9:42946081-42946103 TAGGGTGGTAGGAGGGTGGGGGG + Intergenic
1054353329 9:64039769-64039791 TACTGTGGGTGGAGGGTCGGGGG - Intergenic
1054376274 9:64451973-64451995 TAGAGTGGTGGGAGGGTGGGTGG + Intergenic
1054479125 9:65594160-65594182 GGGTGTGAATGGAGGGTGGGTGG + Intergenic
1054519503 9:66064341-66064363 TAGAGTGGTGGGAGGGTGGGTGG - Intergenic
1054520469 9:66070547-66070569 TAGAGTGGTGGGAGGGTGGGTGG - Intergenic
1054824459 9:69558727-69558749 CTGTGAGGGTGGAGGATGGGAGG - Intronic
1055009119 9:71544186-71544208 CAGGATGGCTTGAGCGTGGGAGG + Intergenic
1055369890 9:75586220-75586242 CCCTGAGGGTGGAGGGTGGGAGG + Intergenic
1055539784 9:77291299-77291321 AAGTGGGGCTGGGGGGTTGGAGG - Intronic
1055874965 9:80931464-80931486 ACTTGAGGCTGGAGGGTGGGAGG + Intergenic
1056299850 9:85229549-85229571 CAGGTTGGCTGGAGGCTGGCTGG + Intergenic
1056585881 9:87926833-87926855 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1056611003 9:88126110-88126132 TAGGGTGGTGGGAGGGTGGGGGG + Intergenic
1056728943 9:89147398-89147420 CAGTTTGGCAGGAGGATGGGTGG - Intronic
1056737697 9:89223930-89223952 CACTGTGGAGGGAGGGAGGGAGG - Intergenic
1056757511 9:89391196-89391218 TAGTGTGCCTGGATGATGGGTGG - Intronic
1057675698 9:97134536-97134558 TAGGGTGGTGGGAGGGTGGGGGG - Intergenic
1057867387 9:98692351-98692373 CAGAGTGGCTGGATGTTGGGTGG - Intronic
1058424509 9:104864738-104864760 CAGGGTGGCAGAAGTGTGGGAGG + Intronic
1058625019 9:106925853-106925875 CAGTGTTGCTGGAAGAGGGGTGG - Exonic
1058769561 9:108216962-108216984 CTCAGTGGCTGGAGGGCGGGAGG + Intergenic
1059083973 9:111280258-111280280 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1059366455 9:113790138-113790160 AAGTGAGGCTGGAGGAGGGGAGG - Intergenic
1059419385 9:114181532-114181554 CAGTGTGCCTAGAGGCTGGTGGG + Intronic
1059581600 9:115555521-115555543 CATGGTGGCAGGAGGGTGGAGGG + Intergenic
1059689124 9:116667823-116667845 CTATGTGGCAGGTGGGTGGGTGG - Intronic
1059708757 9:116848095-116848117 CAGTGTGTCTGGTGTATGGGGGG - Intronic
1059983273 9:119796584-119796606 CAGTTTGGCTGGATTGTAGGGGG + Intergenic
1060401802 9:123353928-123353950 CAGTGCTGCTGGTGGGTGGGGGG + Intergenic
1060402777 9:123357935-123357957 CAGAGTGGATGGAGGCTGTGGGG + Intronic
1060967976 9:127722223-127722245 AGGTGTGGGTGGAGGGAGGGAGG - Intronic
1060995320 9:127872452-127872474 CAGGGTGGCTGAAGGATGGAGGG + Intronic
1061396467 9:130346463-130346485 CGGTGGGGCTGGAGGCAGGGGGG + Intronic
1061423023 9:130482317-130482339 CAGTGTGGCGGGGGGTGGGGTGG + Intronic
1061679965 9:132238127-132238149 CTTTCTTGCTGGAGGGTGGGTGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061910493 9:133719776-133719798 CAGTGTGATTGGAGGCTTGGAGG - Intronic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062046167 9:134425530-134425552 CTGCGTGGCGGCAGGGTGGGGGG + Intronic
1062060937 9:134494666-134494688 CGGGGTGGATGGGGGGTGGGTGG + Intergenic
1062105272 9:134751656-134751678 CCGTGGGGCGGGTGGGTGGGTGG + Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062196362 9:135276398-135276420 CTGTGTGGCAGGAGGTTGGAGGG - Intergenic
1062263996 9:135678469-135678491 GGCTGTGGCTGGGGGGTGGGTGG + Intergenic
1062299160 9:135854916-135854938 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1062327334 9:136018490-136018512 CAGGGTGACTCCAGGGTGGGTGG - Intronic
1062435317 9:136544452-136544474 CAGTGAGCCTCCAGGGTGGGGGG - Intronic
1062517896 9:136945287-136945309 CAGGGTGGCAGGACTGTGGGAGG - Exonic
1062634664 9:137484553-137484575 AAGGATGGCTGGAGGCTGGGAGG + Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1203696024 Un_GL000214v1:97562-97584 TACTGTGGGTGGAGGGTTGGTGG + Intergenic
1203741662 Un_GL000218v1:8878-8900 TACTGTGGGTGGAGGGTGGGGGG - Intergenic
1203482755 Un_GL000224v1:21681-21703 CGGTGTTGCTGGAGGGTCAGTGG + Intergenic
1203701848 Un_KI270742v1:3467-3489 TACTGTGGGTGGAGGGTGGGGGG - Intergenic
1203553837 Un_KI270743v1:189523-189545 TACTGTGGCTGGATGGTGGGGGG - Intergenic
1203640249 Un_KI270751v1:6501-6523 TACTGTGGGTGGAGGGTTGGTGG - Intergenic
1185599286 X:1327857-1327879 CACGGTGGGTGGAGGGTGGGGGG + Intergenic
1185775185 X:2797383-2797405 GATGGTGGGTGGAGGGTGGGAGG + Intronic
1185979807 X:4765383-4765405 CAGTGTGGTTCGAGGGGAGGAGG + Intergenic
1186316993 X:8381933-8381955 CAGTCTCGCTGAAGGCTGGGAGG + Intergenic
1186530777 X:10293095-10293117 CAGTGTGGGAAGAGGGTGAGAGG + Intergenic
1186605118 X:11081487-11081509 CAGTATGTCTGGAGGGTGGCAGG + Intergenic
1186730713 X:12406514-12406536 CAGAGTGGTTGGAGGGAGAGAGG - Intronic
1187391568 X:18889676-18889698 CAGCCTGGTTGGGGGGTGGGAGG - Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187521988 X:20022062-20022084 CAGTATGGGTGAAGAGTGGGGGG + Intronic
1187803338 X:23089982-23090004 GACTGTGGCTGGAGTGTGGTTGG - Intergenic
1189381409 X:40505164-40505186 GAGTGTGGCTGCAGGCAGGGGGG + Intergenic
1190063854 X:47227098-47227120 CGGTGAGGCTGGTGGGTGGGTGG + Exonic
1190103475 X:47541338-47541360 CCCTTTGGCTGGAGTGTGGGAGG - Intergenic
1190143490 X:47868926-47868948 CATAGTGGCGGGGGGGTGGGGGG + Intronic
1191641636 X:63433598-63433620 GAGTGGGGCTGGGGGGCGGGTGG + Intergenic
1192182534 X:68925293-68925315 CAGGGTGGGTGGGGGGAGGGGGG - Intergenic
1192605772 X:72515578-72515600 CAGTGTGTGTGGGGGGGGGGTGG + Intronic
1192947435 X:75981661-75981683 CAGTGGGGCAGGGGAGTGGGAGG - Intergenic
1194887914 X:99340865-99340887 GAGGGTGGCTGGAGGGGAGGTGG - Intergenic
1195065152 X:101233401-101233423 CAGGGTGGCTGGGGGATGGCAGG - Intronic
1195264181 X:103164135-103164157 CACAGGGGCTGGAGGGTGGGAGG + Intergenic
1195925561 X:110021336-110021358 CTGTGTGGCTGGTGGGGGTGAGG + Intronic
1196389578 X:115193033-115193055 GATTGTGGGTGGAGAGTGGGAGG + Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196871368 X:120116120-120116142 GGGTGTGGGTGGAGGGTGGGGGG + Intergenic
1196871417 X:120116249-120116271 AGGTGTGGGTGGAGGGTGCGTGG + Intergenic
1197018371 X:121655285-121655307 CAGTGAGGGTGGTGGGTGGTGGG + Intergenic
1197747200 X:129939631-129939653 CAGTGGGGCGGCAGGGTGGAGGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198225209 X:134638931-134638953 AACTGAGGGTGGAGGGTGGGAGG - Intronic
1198233496 X:134715447-134715469 CAGTGTGTTAGGGGGGTGGGGGG - Intronic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198787451 X:140304233-140304255 CACTGTGTCTGGTGGGTGGGTGG - Intergenic
1198839074 X:140836831-140836853 CATTGTGGGTGGAGTGCGGGTGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199707736 X:150445310-150445332 CAATGAGGGTGGTGGGTGGGAGG + Intronic
1199716173 X:150508661-150508683 CAGTGGGGCTGGTGGGAGTGGGG - Intronic
1199740325 X:150729606-150729628 CAGGGTGGCAGGGTGGTGGGTGG - Intronic
1200060051 X:153480152-153480174 CAGTGTGTCCCAAGGGTGGGGGG - Intronic
1200119890 X:153785197-153785219 CCATGTGGCTGCAGGGAGGGTGG + Intronic
1200174001 X:154099062-154099084 CAGTGTTGCTGGAGAGTGGTAGG + Intergenic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200954374 Y:8929610-8929632 CAGCGGGGGTGGAGTGTGGGAGG - Intergenic
1200958165 Y:8971937-8971959 CAGCGGGGGTGGAGTGTGGGAGG - Intergenic
1201146732 Y:11068863-11068885 CAGTGTACCTGGATGGTGAGGGG - Intergenic
1201155188 Y:11126332-11126354 TACTGTGGGTGGAGGGTGGGGGG - Intergenic
1201164884 Y:11200276-11200298 CGGTGTTGCTGGAGGGTCAGTGG - Intergenic