ID: 1163600742

View in Genome Browser
Species Human (GRCh38)
Location 19:18247815-18247837
Sequence AGGGAGGGTGCAGAGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851
Summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 759}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163600742_1163600749 2 Left 1163600742 19:18247815-18247837 CCCACACTCTCTGCACCCTCCCT 0: 1
1: 0
2: 4
3: 87
4: 759
Right 1163600749 19:18247840-18247862 AACCCCAAGGAACTAAATCAAGG 0: 1
1: 0
2: 1
3: 7
4: 170
1163600742_1163600755 23 Left 1163600742 19:18247815-18247837 CCCACACTCTCTGCACCCTCCCT 0: 1
1: 0
2: 4
3: 87
4: 759
Right 1163600755 19:18247861-18247883 GGTGGCATGGACCACACCACAGG 0: 1
1: 0
2: 0
3: 8
4: 120
1163600742_1163600752 5 Left 1163600742 19:18247815-18247837 CCCACACTCTCTGCACCCTCCCT 0: 1
1: 0
2: 4
3: 87
4: 759
Right 1163600752 19:18247843-18247865 CCCAAGGAACTAAATCAAGGTGG 0: 1
1: 0
2: 1
3: 27
4: 190
1163600742_1163600754 10 Left 1163600742 19:18247815-18247837 CCCACACTCTCTGCACCCTCCCT 0: 1
1: 0
2: 4
3: 87
4: 759
Right 1163600754 19:18247848-18247870 GGAACTAAATCAAGGTGGCATGG 0: 1
1: 0
2: 1
3: 13
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163600742 Original CRISPR AGGGAGGGTGCAGAGAGTGT GGG (reversed) Intronic
900002192 1:20878-20900 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
900021914 1:191402-191424 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
900173902 1:1283744-1283766 AGGGAGGGGGAGGACAGTGTTGG - Intronic
900863106 1:5246582-5246604 AGGGAGGGAGGAGAGAGGGAGGG - Intergenic
900978859 1:6034992-6035014 GGGGAGGGACCAGGGAGTGTGGG + Intronic
901119877 1:6882586-6882608 AGGAGGGGTGAAGAGAATGTAGG + Intronic
901214948 1:7550072-7550094 GGAGAGGGTGCAGGGAGTGGAGG + Intronic
901215169 1:7550912-7550934 GGGGAGGGGGCAGAGAGAGCTGG - Intronic
901338909 1:8477211-8477233 AGGGAGGGTGCGGAGGGTGTAGG + Intronic
901645471 1:10714822-10714844 AGGGAAGGGGCAGAGGGTGGAGG - Intronic
901751447 1:11412460-11412482 GGGGAGGGGGCAGTGAGTGTGGG + Intergenic
901753612 1:11427472-11427494 AGGGAGGGTGCAGGGTGTTGAGG + Intergenic
902107584 1:14050697-14050719 AGGGAGGAGGCTGAGAGTCTGGG - Intergenic
902110533 1:14074570-14074592 TGGGAGGGTGCAGGGAGAGTTGG + Intergenic
902188899 1:14746652-14746674 AGGGAGGGTGGAGAGGGAGATGG + Intronic
902482859 1:16720642-16720664 AGGAAGGGTGGAGAGAGAGGGGG - Intergenic
902756618 1:18553208-18553230 AGGCAGCCTGCAGAGGGTGTGGG - Intergenic
902833107 1:19030189-19030211 AGGGAGGGAGGAGAGAGGGAGGG + Intergenic
902840525 1:19071179-19071201 AGGGAGGCTGGAGAGGGTCTGGG + Intergenic
903069723 1:20721185-20721207 TGGGAAGGTGCAGAGAGGGCAGG - Intronic
903161913 1:21495164-21495186 AGGCATGGTGCAGAGACCGTGGG + Intergenic
903164887 1:21513398-21513420 AGGGAGGATGCAGATGATGTGGG + Intronic
904286123 1:29454185-29454207 AGGGAGGCTGCAAAGGGTGAGGG + Intergenic
904341375 1:29837085-29837107 GGGGAGGGAGCAGGGAGTGCTGG - Intergenic
904543514 1:31250167-31250189 AGGGAGGGAGCTGGGAGTGTGGG - Intergenic
904575046 1:31500004-31500026 AGGGAGGGAGGGGAGAGGGTGGG + Intergenic
904724787 1:32539297-32539319 CTGGAGCGTGCAGCGAGTGTGGG + Intronic
904968245 1:34397546-34397568 AGGCAGGGTGATGAGAGTATGGG + Intergenic
905068325 1:35203570-35203592 GGGGAGGATGCAGAGAGGGAGGG - Intergenic
905309273 1:37038139-37038161 AGGGAGGGGGCTGGGAGTCTTGG - Intergenic
905565904 1:38964575-38964597 AGGGAGCGTGAATAGAGAGTTGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906205748 1:43985443-43985465 AGGGGGGGTGCAGACTGGGTGGG + Intronic
906730870 1:48080049-48080071 AGGGAGGGAACAGAGAGTGCAGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907136466 1:52142867-52142889 ATTGGGGGTGCAGAGAGTGCGGG + Intronic
907320034 1:53596282-53596304 AGGTAAGGTGCAGAGAGAGACGG + Intronic
907730439 1:57060692-57060714 GGGAAGGCTGCAGAGAGAGTGGG + Intronic
908261294 1:62341281-62341303 TGGGAGGTGGCGGAGAGTGTGGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910715275 1:90223515-90223537 AGGGAGGGGAGAGAGAGTGAAGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910800391 1:91139059-91139081 AAGGAGAGTCCAGAGAGTGGTGG + Intergenic
911668979 1:100587100-100587122 AGGGAAGAAGCAGAGACTGTTGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912945460 1:114080715-114080737 AGTGAGGGCCCAGAGAGAGTGGG + Intergenic
913379657 1:118195483-118195505 AGGGAGGGAGAAGAGATTATGGG - Intergenic
914353923 1:146865287-146865309 AGGGGGGGTGGAGAGATGGTGGG + Intergenic
915287351 1:154861516-154861538 GGAGAGGGGGCAGAGTGTGTAGG - Intronic
915292912 1:154898283-154898305 AGGGGAGGAGCAGAGAGAGTGGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915915595 1:159938570-159938592 AGGGAGGGTGCTGAGGGCTTGGG - Intronic
916105604 1:161428440-161428462 AGAAAGGGTGTAGTGAGTGTTGG + Intergenic
916677087 1:167073232-167073254 GGGGAGGGAGCAGTGAATGTTGG - Intronic
916824687 1:168432120-168432142 AGGGAGGCTGCAGAGTGTGAGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917217737 1:172695573-172695595 GTACAGGGTGCAGAGAGTGTAGG + Intergenic
917317838 1:173745237-173745259 ACGGAGGTTGCAGTGAGTGGAGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918472166 1:184885626-184885648 AGGGAGGAGGGAGAGAGTGCAGG - Intronic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919857840 1:201717781-201717803 AAGTAGAGTGCAGAGAGTATAGG - Intronic
920006080 1:202834904-202834926 GGGCAGGGTGCGGAGAATGTGGG - Intergenic
920090400 1:203448709-203448731 AGGGAGGATGCAGGGGGTGGAGG + Intergenic
920118838 1:203640268-203640290 AGGGAGGATGCAGTGAGAGCAGG - Intronic
920205410 1:204287559-204287581 GGGGTGGGTGCAGAGAGTTGCGG - Intronic
920415989 1:205799730-205799752 AGGCAGGGACCAGAGAGGGTGGG - Intronic
920580798 1:207105593-207105615 AGGAAGGGTGGGGAAAGTGTGGG + Intronic
921032910 1:211349717-211349739 AGGGAGAGTGCAGAGTGTAGTGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922191532 1:223323148-223323170 ACGGAGGGTGAAGGGAGTGAGGG + Intronic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922481353 1:225941680-225941702 AGGGGGTGTGCAAGGAGTGTAGG - Intergenic
922547901 1:226472471-226472493 ACGGAGGGTGGAGAGGGTGGGGG - Intergenic
922700710 1:227758480-227758502 AGAGTGGGTGTTGAGAGTGTGGG + Intronic
923702003 1:236309085-236309107 AGAGAGGGTGCAGATTTTGTTGG - Intergenic
1062934789 10:1377698-1377720 AGAGAGGGAGCACAGAGTCTGGG + Intronic
1063175162 10:3544245-3544267 AGGGAGGGTGGAAAGAGAGTGGG - Intergenic
1063449509 10:6142115-6142137 AGGGAGGGTGGGGGGAATGTAGG - Intergenic
1063515182 10:6688304-6688326 ATGGAGGCTGCAGAAAGAGTTGG - Intergenic
1064209769 10:13352202-13352224 AGGGACGGGGGAGAGGGTGTTGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1065945911 10:30605451-30605473 AGGGGAGGGGCAGAGAGTGGAGG - Intergenic
1067147773 10:43706142-43706164 AGGGAGGATGGAGAGAGCGGAGG + Intergenic
1067274274 10:44820280-44820302 AGGGATGGTGGAGAGGGTGATGG - Intergenic
1067568052 10:47352177-47352199 AAGGAGGGAGCAGGGAGAGTGGG + Intronic
1067789688 10:49278367-49278389 AGTGGGGATGGAGAGAGTGTTGG - Intergenic
1067842456 10:49691821-49691843 AGTGAGGGTGCATGGACTGTGGG - Intronic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069403701 10:68075856-68075878 AGGGAGAGTGTAGAAAGTGATGG - Intergenic
1069558514 10:69413544-69413566 AGGGAGGGGGCAGAGACCCTGGG + Intronic
1069831916 10:71286908-71286930 AGGGAGGGAGGAGAGAGCCTGGG + Intronic
1069958578 10:72066701-72066723 AGGAAGGGAGCTGAAAGTGTTGG + Intronic
1070005602 10:72421340-72421362 AGGGAGGGTGCAGAGGGAGGCGG - Intronic
1071248543 10:83791414-83791436 AGGGAGGGAGCAGGGAGACTGGG - Intergenic
1071270811 10:84005676-84005698 AGTGAGGGTGCTGAAAATGTAGG + Intergenic
1071408756 10:85365697-85365719 AGGGAAGGAGCAGTGAGTTTGGG - Intergenic
1073044215 10:100626966-100626988 AGGGCTGGGGCAGAGGGTGTTGG + Intergenic
1074183508 10:111082597-111082619 ATGGAGGTTGCAGAAAGTGGGGG + Intergenic
1074183981 10:111085619-111085641 AGGGAGATTGCAGAGAGAATCGG + Intergenic
1074326468 10:112455559-112455581 AGGGAGGGAGCAGAGAAGGAAGG - Intronic
1074670990 10:115790563-115790585 AGTGAGGGTAGAGAGAGTGAAGG + Intronic
1074825908 10:117215892-117215914 AGGGAGGCTGCAGGGAGCATTGG - Intergenic
1074827160 10:117222925-117222947 AGGGAGGGTGCTGAGAAGGGAGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075518515 10:123129266-123129288 GGGGAGGGTGCACAGATTGCTGG - Intergenic
1075663788 10:124216538-124216560 AGGAAGGGTGCAGAGGCTGCTGG + Intergenic
1075738063 10:124676351-124676373 AGGAAGGGTGCTGAGGGTGCAGG + Intronic
1075914915 10:126158607-126158629 GGGGAGGATGCAGAGAGCATGGG + Intronic
1075951597 10:126482486-126482508 AGGCAAGGTGCAGAGAGAGAAGG - Intronic
1076618976 10:131775017-131775039 AGGGAGGCCCCACAGAGTGTGGG - Intergenic
1076667740 10:132102648-132102670 AGGGAGGGTGAAAGGAGGGTCGG - Intergenic
1077019014 11:409302-409324 GGGGAATCTGCAGAGAGTGTGGG + Intronic
1077272203 11:1686683-1686705 AGGGAGGGAGCAGAGAAGGAAGG - Intergenic
1077272294 11:1686958-1686980 AGGGAGGGAGCAGAGAAGGAAGG - Intergenic
1077479520 11:2807024-2807046 AGGGAGGGTGCTGGGAGTCTCGG + Intronic
1077842471 11:5990657-5990679 AGGGAGGGCACAGAAAGAGTGGG + Intergenic
1077906415 11:6538270-6538292 AGGTAGGGTCCAGAAAGTGATGG - Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079002492 11:16769765-16769787 AGGGAGTGTGAAGGGGGTGTTGG + Intergenic
1079106722 11:17576744-17576766 AGGGAGGGGGAAGTGAGTGAGGG + Intronic
1079587072 11:22139421-22139443 AGGGAGAGAGGAGAGAGGGTGGG - Intergenic
1080042068 11:27769467-27769489 TGGCAGGGTGCAGAAAGGGTGGG + Intergenic
1080239630 11:30111824-30111846 AGGGCAGGTAGAGAGAGTGTTGG - Intergenic
1080557402 11:33430082-33430104 AGGGAGGGAGGAGAGAGGGAGGG - Intergenic
1080871634 11:36241735-36241757 AAGGAGGGTGGAGAGAGAGCAGG - Intergenic
1081021054 11:37948069-37948091 AGGGAGGGAGCAGAGAGGTCAGG - Intergenic
1081660291 11:44884109-44884131 AGGGAGGCTGGAGGCAGTGTGGG - Intronic
1082160940 11:48886828-48886850 AGAGAGGGCGGAGAGAGGGTGGG + Intergenic
1082161426 11:48893578-48893600 AGAGAGGGCGGAGAGAGGGTGGG - Intergenic
1082610049 11:55284528-55284550 AGAGAGGGAGGAGAGAGGGTGGG + Intergenic
1082656637 11:55865954-55865976 AGAGAGGGAGGAGAGAGGGTGGG - Intergenic
1082808249 11:57463370-57463392 AGGGGGTGAGCAGAGAGGGTGGG + Intronic
1082873795 11:57968468-57968490 AGGCTGGGTGCTGAGGGTGTAGG - Intergenic
1083285564 11:61656547-61656569 GGTGAGGGTGCAGGGAGTGAGGG + Intergenic
1083702826 11:64490924-64490946 AGAGAGGGTGCAGTGGGTGCAGG - Intergenic
1083864503 11:65446227-65446249 TGGGAGGGGGCAGAGACTGAGGG - Intergenic
1085038434 11:73313191-73313213 ATGGAGGCTGCAGAGAGAGCAGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085254278 11:75163715-75163737 AGGTAGGGGGCAGAGAGAGATGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1088695437 11:112362266-112362288 AGGAAAGGGGCAGAGAGTGGTGG + Intergenic
1089013488 11:115148474-115148496 GGGGAGGGTGAAGTGTGTGTGGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090712009 11:129395599-129395621 AGGATGGGTGCAGAGAGAGAGGG - Intronic
1091050107 11:132359951-132359973 AGGCAGTGTGCAGAGAAGGTAGG - Intergenic
1091375607 12:22938-22960 CGGGAGTGTGCAGAGACTGGAGG - Intergenic
1091856705 12:3746398-3746420 AGGGAGGGTGGAGGAAGGGTGGG - Intronic
1092151425 12:6251526-6251548 ATGGAGGGTGCAGTCAGTGCTGG + Intergenic
1093195650 12:16126765-16126787 AGGGAGGGGGCAGAGAAAGAAGG + Intergenic
1093201731 12:16195606-16195628 ATGGAAGGTGAAGAGGGTGTGGG + Intronic
1093336665 12:17912892-17912914 AGGTAGGGAGCAGAGAGGCTGGG - Intergenic
1093990408 12:25583722-25583744 GGAGAGGGAGCAGAGAGTGATGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096101128 12:48971062-48971084 AGGGAGGGGGCAGTGTGAGTGGG - Intronic
1096531640 12:52246348-52246370 AGGGAGGTTGCAGAGGGTGGAGG + Intronic
1096956284 12:55529534-55529556 GGGGAGGGTCCACAGAGTGAAGG + Intergenic
1097187055 12:57201706-57201728 CGGGAGGGTGGGGAGAGTGAGGG - Intronic
1098532591 12:71557742-71557764 AGGGAGGGTCCTGAGTGTGCTGG + Intronic
1099426030 12:82523526-82523548 AGGGAGGGTAAAGCCAGTGTGGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099635547 12:85206632-85206654 AGTGAGGTTGGAGAGGGTGTGGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099876953 12:88419425-88419447 AGGGAAGGGGGACAGAGTGTTGG - Intergenic
1100500081 12:95165703-95165725 ATGGAGGTTGCAGTGAGTGGAGG - Intronic
1100569885 12:95837516-95837538 AGGGAGGGAGGAGAGAGGGAGGG + Intergenic
1101032793 12:100676655-100676677 AGGGATGGTGCAGTGAGGGAGGG + Intergenic
1101415052 12:104501588-104501610 AAGGAGGGTGCTCAGAGTGTCGG - Intronic
1102221679 12:111199051-111199073 AGGGTGGGTGCGGAGAGAGAAGG + Intronic
1102361990 12:112296122-112296144 ATGGTAGGTGCAGAGGGTGTAGG + Intronic
1102437452 12:112936444-112936466 AAGGAGGGAGCAGTGAGGGTGGG - Intergenic
1102490160 12:113285793-113285815 AGGGAGGCTGCAGACTGTGGAGG + Intronic
1102791925 12:115653744-115653766 CGTGAGGTTGCAGAGAGTGTTGG + Intergenic
1103247656 12:119471930-119471952 TGGGAGGGTGGAGAGAGAGAAGG - Intronic
1103351173 12:120284768-120284790 AGGGAGGAAGTAGAGAGAGTTGG - Intergenic
1103986851 12:124773045-124773067 TGGGATGGTGCAGAGATTGCAGG + Intergenic
1104157596 12:126148824-126148846 AGGGAGGGCGCAGAGGGAGCTGG - Intergenic
1104182878 12:126399420-126399442 AGGGCTGGTGCACAGAGTGAAGG - Intergenic
1104191074 12:126482433-126482455 AGGGAGGGAGGAGAGAGGGAGGG - Intergenic
1104254446 12:127124898-127124920 AGGGAGGGGGGATAGAGGGTGGG + Intergenic
1104254583 12:127125237-127125259 AGGGAGGGGGGATAGAGGGTGGG + Intergenic
1104997149 12:132665130-132665152 TGGGAGGTTGAAGAGAGTGGGGG - Intronic
1105274081 13:18904723-18904745 AAAGAGGGTGCAGAGAGGGAGGG - Intergenic
1105761120 13:23515426-23515448 AGGGAGAGTGGAGAGAGAGAAGG + Intergenic
1105782077 13:23714490-23714512 AGAGAGGGTGCTGAGAGGGAGGG - Intergenic
1105896230 13:24719046-24719068 GTGGAGGGGGCAGGGAGTGTGGG - Intergenic
1106549435 13:30758662-30758684 AGGAAGGGGTCAGAGAGAGTAGG - Intronic
1107016267 13:35710070-35710092 AGGGTGGGTGCAGGAAGTGAAGG + Intergenic
1107057688 13:36124755-36124777 AGGGAGGTTGGATGGAGTGTTGG - Intronic
1107061373 13:36163052-36163074 AGGTAGGCTGCAGAGAGGGAAGG + Intergenic
1107097271 13:36550122-36550144 CAGGAGGGTGCAGAGGGTGCAGG + Intergenic
1107414752 13:40190191-40190213 AGGGAGTGGGGAGGGAGTGTGGG + Intergenic
1107597058 13:41973823-41973845 GGGGAGGGTACTGAGAGTCTGGG + Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108417096 13:50209004-50209026 AGGGAGCGTGGAGAAATTGTTGG - Intronic
1108685737 13:52817549-52817571 AGGGAGGTTGCAGTGAGTCAAGG - Intergenic
1109166275 13:59039431-59039453 AGTGAGGGTGAAGAGACAGTGGG - Intergenic
1109172060 13:59108557-59108579 ATGGAGTGAGCAGAGAGTGAAGG - Intergenic
1110538601 13:76681888-76681910 AGGGAGTGGGCAGTGGGTGTGGG - Intergenic
1110619502 13:77579069-77579091 AGGTAGGGTGAAGGCAGTGTGGG + Intronic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1112432028 13:99358715-99358737 AGTGAGGGTGGAGACAGTGGCGG + Intronic
1112436478 13:99394426-99394448 AGGGAGGGTCAGGAGAGCGTGGG - Intergenic
1112679838 13:101751031-101751053 GGGGAGGGTGGAGAGAGGGAGGG + Intronic
1112924494 13:104657331-104657353 AGGGAGGGAGGAGAGAGGGAGGG - Intergenic
1113481624 13:110625931-110625953 AGGGAGGGGGCTGTGAGAGTGGG + Intronic
1113585241 13:111460137-111460159 AGAGAGGGAGAAGAGAGAGTGGG + Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1113857870 13:113458652-113458674 AGGGACGGTGCAAAGTGTGGAGG + Intronic
1114045456 14:18871659-18871681 AGGGAGGGTGGAGGGAGGGAAGG + Intergenic
1114118756 14:19647809-19647831 AGGGAGGGTGGAGGGAGGGAAGG - Intergenic
1116085295 14:40229597-40229619 AGGGAGGGAGGAGAGAGGGAGGG - Intergenic
1116251692 14:42492376-42492398 ACGCAGGGTGAAGAGAGAGTAGG - Intergenic
1116522210 14:45863378-45863400 AGGGATGGTGGAGAGATGGTGGG + Intergenic
1116686437 14:48045156-48045178 AGAGAGAGTGCAGATAGTGATGG + Intergenic
1119109328 14:71956999-71957021 AGGAAGGGTGGACAGAGTGGAGG + Intronic
1119845648 14:77827700-77827722 AAGGAGGGTGCAGAGAGGTTTGG + Intronic
1120692601 14:87609462-87609484 AGGTAGGGTGCAGAGAGACCAGG + Intergenic
1121011377 14:90522197-90522219 AGGGAGCGAGCAGAGAATGGAGG - Intergenic
1121332644 14:93058769-93058791 AGGGAGGGTGGAGGGGGTGCGGG + Intronic
1121403456 14:93703153-93703175 TGGGAGTGTGCAGAGAGTCGGGG - Intronic
1122115880 14:99526997-99527019 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1122143036 14:99673831-99673853 AGGGGGGGTGCACAGAGTTGGGG + Intronic
1122199470 14:100113761-100113783 AGGGAGGGTGCTAAGGGAGTTGG + Intronic
1122477481 14:102020958-102020980 AGGCAGAGTGCAGAGTATGTTGG + Intronic
1123030274 14:105448225-105448247 AGGGAGGGTTCAGAGTGTGAGGG + Intronic
1123811183 15:23927869-23927891 ATAGAGGGTGGAGACAGTGTTGG - Intergenic
1123909565 15:24953990-24954012 AGGGAGGGTGATGTGAGTGGAGG - Intronic
1124204549 15:27705905-27705927 AGACAGGCTGCTGAGAGTGTCGG + Intergenic
1124391222 15:29259636-29259658 AGGGAGGGTGAGCAGGGTGTAGG - Intronic
1125685445 15:41560707-41560729 AGGTTGGGTGCAGAGGGTGCTGG + Intronic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126694810 15:51316976-51316998 AGGTAGGGTGCCAAGAGTGCTGG + Intronic
1127699070 15:61479339-61479361 AGAAAGGGTGCAGAGGGTGAGGG + Intergenic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1127997005 15:64158949-64158971 AGTGAGGGTGGAGAGAGTTGTGG - Intronic
1128342188 15:66830367-66830389 GGGGAGGGTGCAGGGTGTATGGG - Intergenic
1128701956 15:69811153-69811175 AGGGAGGGAGAAGAGACTGAAGG - Intergenic
1128811800 15:70578414-70578436 AGTGGGGCAGCAGAGAGTGTGGG - Intergenic
1129280584 15:74481617-74481639 AAGGAGGGTGCAGGGAGAGTTGG + Intergenic
1129942758 15:79512611-79512633 AGGGAGGCTGGAGAGTGAGTGGG + Intergenic
1129942822 15:79512970-79512992 AGGGAGGCTGGAGAGTGAGTGGG + Intergenic
1130010937 15:80152727-80152749 AGGGAGGGAGGAGAGACTGGAGG + Intronic
1131131983 15:89906099-89906121 AGTGGGGGTGCAGAGACTGGAGG - Intronic
1131520512 15:93110722-93110744 AGGGAAGGGCCAGAGAGTGGGGG - Intergenic
1132014051 15:98300360-98300382 CGGGAGTGTGCAGAGATTCTGGG - Intergenic
1132451318 15:101970061-101970083 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
1132591627 16:728647-728669 AGTGAGGGTGCGGAGCGTGGGGG - Intronic
1132696225 16:1203100-1203122 AGCGAGGGTGCCGAGGGTGCCGG + Intronic
1132788817 16:1673506-1673528 AGTGAGGGGACAGAGAGTGCCGG - Intronic
1132886970 16:2186625-2186647 AGCGAGTGTGCTGAGGGTGTGGG - Intronic
1132915511 16:2341457-2341479 GAGGAGGGTCCAGAGAGGGTCGG + Intergenic
1132915561 16:2341574-2341596 GGGGAGGGTCCGGAGAGGGTCGG + Intergenic
1133712585 16:8415656-8415678 AGGGAGGGAGATGAGAATGTGGG - Intergenic
1133767784 16:8849768-8849790 AGGGAGGCAGCAGACAGTGCAGG - Intergenic
1133868497 16:9666233-9666255 TGGAGGGGTGCAAAGAGTGTGGG + Intergenic
1134239389 16:12494249-12494271 AGGGAGGACGCAGAGATGGTGGG - Intronic
1134316903 16:13127161-13127183 AGGGAAGGGGGAGAGAGTGAGGG + Intronic
1135250291 16:20895493-20895515 TGGGAAGGTGCAGGGAGTGGCGG - Intronic
1135461344 16:22646108-22646130 AGGGAGGGAGCAGAGCACGTGGG - Intergenic
1136248671 16:28989677-28989699 ACAGAGGGGGCAGAGGGTGTGGG - Intronic
1137055858 16:35746450-35746472 AGGGAGGGGCCAGAGAGTCAGGG - Intergenic
1137402723 16:48166301-48166323 CTGGGGGGTGCAGAGTGTGTAGG + Intergenic
1137554750 16:49463471-49463493 GGGGAGAGTGCAGAGCATGTGGG + Intergenic
1138558462 16:57786483-57786505 AGGTAGGGAGCAAAGAGTTTGGG + Intronic
1138648587 16:58443557-58443579 AGGGAGTGAGGAGAGGGTGTGGG + Intergenic
1138677872 16:58665192-58665214 AGGGAGGGTGGGGAGAGGATGGG + Exonic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139210046 16:65068057-65068079 AGGGAGGGGGCAGGGAGAGAAGG + Intronic
1139210065 16:65068124-65068146 AGGGAGGGGGCAGGGAGAGAGGG + Intronic
1139469626 16:67171112-67171134 AGGGAGGGTGCAGATTGGATTGG - Intronic
1139649638 16:68355881-68355903 AAGGTGGGTGCAGAGAGGGCTGG + Exonic
1141337729 16:83172947-83172969 AGGTGGGGTGGGGAGAGTGTTGG - Intronic
1141644550 16:85360279-85360301 AAGAAGGGTGCAGAGGTTGTGGG + Intergenic
1141770878 16:86089044-86089066 AGGGAGGGTCCAGAGACCCTGGG - Intergenic
1141927659 16:87179643-87179665 ACGGCAGGTGCACAGAGTGTCGG + Intronic
1142006833 16:87693213-87693235 TGGGAGGTTGCGGAGGGTGTGGG + Intronic
1142280574 16:89145676-89145698 AGGGAGAGTGCAGAGAGCCAAGG + Intronic
1142280920 16:89147164-89147186 AGGGAGGGTCCACAGAGGGAGGG + Intronic
1142359332 16:89619212-89619234 AGGGAGGGAGCAGGGAGGGCAGG - Intronic
1142605942 17:1081101-1081123 AGACATGGTGCAGAGAGTGTGGG - Intronic
1142884699 17:2905390-2905412 AGGCAGGGAGGGGAGAGTGTGGG + Intronic
1142895559 17:2975586-2975608 AGGGAGGGTGAAGAGAGCCCGGG - Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143021335 17:3918353-3918375 AGGGAGGGAGGAGAGAGGGAGGG + Intergenic
1143229912 17:5344368-5344390 ATGGAGGCTGCAGTGAGCGTAGG + Intronic
1143334631 17:6163081-6163103 TGGGAGGGTGCTGAGAGAGTTGG - Intergenic
1144033366 17:11341976-11341998 TGGGGAGGTGCAGAGAGGGTGGG - Intronic
1144327597 17:14196790-14196812 AGGGAGGGCAAAGAGAGTGTGGG - Intronic
1144579598 17:16450877-16450899 AGGGAGGGTGAGGAGGGTCTAGG + Intronic
1144644888 17:16965640-16965662 AGGGAGGATGCAGGGAGAGGTGG + Intronic
1144803553 17:17948823-17948845 AGGCTGGGTGTGGAGAGTGTGGG - Intronic
1145905653 17:28514767-28514789 AGGGAGCGTGAAGAGAGCCTGGG + Intronic
1146038361 17:29427991-29428013 AGGAAGGCTGAAGAGAGTCTAGG + Intronic
1146329836 17:31917809-31917831 AGGGAGGGGGCAGGAAGAGTTGG - Intergenic
1146691915 17:34882601-34882623 AGTGGGGCTGGAGAGAGTGTAGG - Intergenic
1146694483 17:34898213-34898235 GGGGAGGGGGGAGAGAGTGGAGG - Intergenic
1147445657 17:40473829-40473851 AGGCAGGGTTTAGAGGGTGTGGG + Intergenic
1147494930 17:40906599-40906621 ATGGGAGGTGCAGTGAGTGTAGG + Intergenic
1147929262 17:43967332-43967354 AGGGAGAGTGCATAGTGTTTAGG - Intronic
1148124852 17:45231316-45231338 AGGGAGGCTGCAGAGGCTGGGGG + Intronic
1148243378 17:46014353-46014375 CGGGAGGGTGCAGGGGGTGGAGG + Intronic
1148293571 17:46478882-46478904 AGGGATGGTAGAGAGATTGTGGG + Intergenic
1148315757 17:46696584-46696606 AGGGATGGTAGAGAGATTGTGGG + Intronic
1148452632 17:47789992-47790014 AGGGAGGGCGCAGCGAGCCTGGG - Intergenic
1148835198 17:50462362-50462384 AGGGAGGGGGCAGGGTGGGTAGG - Intronic
1148896288 17:50841026-50841048 AGGGAGGGGGCAGGGAGGGGTGG - Exonic
1149159151 17:53668947-53668969 AGGGAGGGGGGAGGGAGAGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149596285 17:57866630-57866652 ATGAAGGGGGCAGAGAGAGTCGG - Intronic
1150301445 17:64050300-64050322 CAGCAGGCTGCAGAGAGTGTGGG - Intronic
1151310763 17:73291243-73291265 AGGAAGGGTCCTGAGAGAGTTGG + Intronic
1151339717 17:73463053-73463075 AGGGAGGGTGGAGACAATGACGG + Intronic
1151370479 17:73643976-73643998 AGGGAGGGGGCTGGGAGAGTGGG - Intronic
1151763957 17:76122549-76122571 AGGGAGGGGGCCGGGGGTGTCGG + Intergenic
1151933110 17:77245215-77245237 AGAGAGGGAGCAGAGGGAGTTGG + Intergenic
1151999443 17:77636370-77636392 AGGGAAGGAGGAGAGAGTGCAGG + Intergenic
1152070285 17:78130872-78130894 AGGGAGAATGCAGAGGGTGAGGG + Intronic
1152089435 17:78238642-78238664 ATGGAGGGTACAGAGTGTGTGGG + Intronic
1152319123 17:79598065-79598087 AGGGATGGTGGAAAGAGGGTGGG - Intergenic
1152452208 17:80388795-80388817 AGGGAGGCCGCAGAAACTGTGGG - Intronic
1152576558 17:81143762-81143784 AGTGTGGGTGGAGAGAGTGGAGG - Intronic
1152589428 17:81204123-81204145 AGGGAGGGTCCAGGCATTGTGGG + Intronic
1153414927 18:4835992-4836014 AGGGAGGGAGCAAAGACTATTGG + Intergenic
1154465787 18:14641972-14641994 AAAGAGGGTGCAGAGAGTGGGGG - Intergenic
1154484834 18:14865341-14865363 AAAGAGGGTGCAGAGAGGGAGGG - Intergenic
1155008147 18:21748363-21748385 AGGGAGGGGGGAGAGAGGGAGGG - Intronic
1155008154 18:21748378-21748400 AGGGAGGGGGGAGAGAGGGAGGG - Intronic
1155334774 18:24752426-24752448 AGGGAGGGATCAGGGCGTGTAGG + Intergenic
1155630578 18:27887640-27887662 AGGGAGGGAGGAGAGAGGGGAGG - Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156468543 18:37363041-37363063 AGAGAGGGAGAAGAGAGAGTGGG - Intronic
1156624022 18:38886841-38886863 AGGGAGTGGGCAGATAGTATAGG + Intergenic
1157743025 18:50110011-50110033 AGGGAGTGGGGAGAGAGGGTAGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159903264 18:74067519-74067541 AGGAAGTGTCCAGAGAGTGATGG + Intergenic
1160246393 18:77163556-77163578 AGGCAGGGTTCAGAGAATGTGGG + Intergenic
1160394582 18:78562577-78562599 AGGGGGTGGGCAGAGAGTGGTGG - Intergenic
1160633945 19:62486-62508 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1160668735 19:345715-345737 AGGGAAGCTGGAGAGAGTGAAGG + Intergenic
1160777020 19:861190-861212 GGTGAGGGTGCAGAGGGTGGGGG - Intronic
1161168277 19:2800251-2800273 ACGGAGGTTGCAGTGAGTGGAGG - Intronic
1161205701 19:3040194-3040216 AGGGAGGGTGGAGATAGAGACGG - Intronic
1161264557 19:3358469-3358491 GGGGAGGTTGCAGGGGGTGTGGG - Intergenic
1161427158 19:4210029-4210051 AGGGAGGGGAGAGAGAGTGAAGG - Intronic
1161594491 19:5144224-5144246 TGGGAGGGTGCGGAGGGTGTGGG - Intronic
1161791346 19:6361989-6362011 AGGAGGGGCGCAGGGAGTGTCGG - Intronic
1162969172 19:14169823-14169845 AGGGAGGGAGGAGAGAGGGCAGG + Intronic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1163635732 19:18436504-18436526 GGGGAGGATGGAGAGGGTGTAGG + Intronic
1163716074 19:18873014-18873036 AGCGAGTGTGCAGAGAGAGAAGG + Intronic
1163822271 19:19502733-19502755 AGCCTGGGTGCAGAGAGTGAGGG - Intronic
1164530016 19:29041514-29041536 AGGGAGGAGGCAGAGTTTGTGGG + Intergenic
1164581661 19:29438796-29438818 AGGGAGGGGGAAGAGAGAGGAGG + Intergenic
1164825816 19:31284262-31284284 TGGGAGGCTGCAGAGAGAATGGG - Intronic
1165086161 19:33349041-33349063 ACTGTGGGTGCAGAGAGTTTAGG - Intergenic
1165409722 19:35652008-35652030 AGGCAGGGAGATGAGAGTGTGGG - Intronic
1166287164 19:41838329-41838351 AGGGTGGGTGCAGAAAGAGCTGG - Intronic
1166933857 19:46319290-46319312 AGGGAGGGTTTATTGAGTGTGGG + Intronic
1167189489 19:47974584-47974606 AAGGAGGGAGGAGAGAGGGTCGG - Intronic
1167456627 19:49599632-49599654 CTGGAGGCTGCAGAGAGTGAGGG + Exonic
1167607246 19:50487970-50487992 GAGGAGGGAGGAGAGAGTGTAGG + Exonic
1167990541 19:53357249-53357271 AAGGAGGTTGCAGTGAGTGGAGG + Intergenic
1168099551 19:54133956-54133978 AGGGAAGGTGGAGAGAGGGAGGG - Intergenic
1168099567 19:54133999-54134021 AGGGAAGGTGGAGAGAGGGAGGG - Intergenic
1168099623 19:54134148-54134170 AGGGAAGGTGGAGAGAGGGAGGG - Intergenic
1168099672 19:54134285-54134307 AGGGAAGGTGGAGAGAGGGAGGG - Intergenic
1168099680 19:54134312-54134334 AGGGAAGGTGGAGAGAGGGAGGG - Intergenic
1168115079 19:54217854-54217876 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168120772 19:54251546-54251568 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168124350 19:54275443-54275465 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168177637 19:54636095-54636117 AGAGAAAGGGCAGAGAGTGTGGG + Intronic
1168181912 19:54667235-54667257 AGGTAAAGGGCAGAGAGTGTGGG + Intronic
1168199388 19:54803994-54804016 AGGGAGGCAGCACAGAGGGTGGG + Intronic
1168663059 19:58182905-58182927 AGGGAGGGCGGGGAGAATGTAGG - Intergenic
924994126 2:341321-341343 TGGGAGAGGGGAGAGAGTGTGGG - Intergenic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925135452 2:1523072-1523094 GGGGAGGTTGCACACAGTGTCGG - Intronic
925135585 2:1523558-1523580 GGGGAGGTTGCACAGAGTGGTGG - Intronic
925136147 2:1525831-1525853 TGGGAGGTTGCACAGAGTGGGGG - Intronic
925136375 2:1526751-1526773 GGGGAGGTTGCACAGAGTGGTGG - Intronic
925136476 2:1527149-1527171 GGGGAGGTTGCACAGAGTGGGGG - Intronic
925136629 2:1527768-1527790 TGGGAGGTTGCACAGAGTGGGGG - Intronic
925136953 2:1529135-1529157 AGGGAGGTTGCACACAGTGGGGG - Intronic
925137185 2:1530033-1530055 GGGGAGGTTGCAGAGAGTGGGGG - Intronic
925137193 2:1530062-1530084 GAGGAGGTTGCACAGAGTGTGGG - Intronic
925137288 2:1530487-1530509 GGGGAGGTTGCACAGAGTGAGGG - Intronic
925137320 2:1530601-1530623 GGGGAGGTTGCACAGAGTGTGGG - Intronic
925137326 2:1530628-1530650 GGGGAGGTTGCAGAGAGTCGGGG - Intronic
925137480 2:1531194-1531216 GGGGTGGTTGCAGACAGTGTGGG - Intronic
925137574 2:1531569-1531591 GGGGCGGTTGCACAGAGTGTGGG - Intronic
925137582 2:1531598-1531620 GGGGAGGTTGCACAGAGTGGGGG - Intronic
925137607 2:1531714-1531736 GGGGAGGTTGCAGAGAGTGGGGG - Intronic
925137615 2:1531743-1531765 GGGGAGGTTACAGAGAGTGGGGG - Intronic
925137623 2:1531772-1531794 GGGGAGGTTGCAGAGAGTGGGGG - Intronic
925137631 2:1531801-1531823 GGGGAGGTTGCAGAGAGTGGGGG - Intronic
925137639 2:1531830-1531852 GGGGAGGTTGCAGAGAGTGGGGG - Intronic
925138077 2:1533587-1533609 GGGGAGGTTGCACAGAGTGGGGG - Intronic
925138166 2:1533960-1533982 GGGGAGGTTGCACAGAGTGGTGG - Intronic
925138196 2:1534075-1534097 GGGGAGGTTGCACAGAGTGGTGG - Intronic
925138202 2:1534104-1534126 GGGGAGGTTGCACAGAGTGGGGG - Intronic
925138423 2:1535065-1535087 GGGGAAGGTGCACAGAGTGGGGG - Intronic
925138435 2:1535122-1535144 GGGGAGGTTGCACAGAGTGGGGG - Intronic
925138520 2:1535441-1535463 GGGGAGGTTGCACAGAGTGGGGG - Intronic
925138575 2:1535663-1535685 GGGGAGGTTGCACAGAGTGGGGG - Intronic
925138598 2:1535747-1535769 CGGGAGGTTGCACAGAGTGGGGG - Intronic
925138765 2:1536357-1536379 GGGGAGGTTGCACAGAGTGGGGG - Intronic
925138857 2:1536731-1536753 GGGGAGGTTGCACAGAGTGGTGG - Intronic
925138895 2:1536875-1536897 GGGGAGGTTGCACAGAGTGGTGG - Intronic
925290312 2:2743691-2743713 GGGGAGGGAGCGGAGAGAGTGGG - Intergenic
925296310 2:2779847-2779869 TGGGAGGGTGCAGTGTGTGAAGG - Intergenic
925296589 2:2781159-2781181 TGGGAGTGTGCAGAGTGTGAAGG - Intergenic
925363227 2:3294305-3294327 AGGGTGTGTGCAGAGAGGATCGG - Intronic
925363271 2:3294509-3294531 AGGGTGTGTGCAGAGAGGATCGG - Intronic
925371220 2:3347048-3347070 AGGGCGGGAGCAAAGAGTGAGGG - Intronic
925408790 2:3626923-3626945 AGGGAGGGTGTGGAGGGTGGTGG - Intronic
925429868 2:3782088-3782110 AGGGAGGTGGCACAGAGTTTCGG - Intronic
925699059 2:6614370-6614392 ACGGAGAGTGCTGTGAGTGTGGG - Intergenic
925873069 2:8287427-8287449 GGGGTGGGTGCAGAGAGTCCTGG + Intergenic
925905630 2:8538255-8538277 AGGGAGAGAGGAGAGAGGGTGGG - Intergenic
926245872 2:11122078-11122100 AGGGAGGGTGGAGAGAGCCCAGG - Intergenic
926283796 2:11471593-11471615 GGTGATGGTGCAGAGAATGTAGG + Intergenic
926772043 2:16386798-16386820 AGGGAGGCTTCAGAGGATGTGGG + Intergenic
927969420 2:27295663-27295685 AGGAAGGGTGCAGTGAGGGATGG + Intronic
928022616 2:27716014-27716036 AGGGAGGGAGCAGAGAGGGGTGG - Intergenic
928239641 2:29575421-29575443 AGGGAGGTTGCAGTGGGGGTAGG - Intronic
929258457 2:39839105-39839127 AGGGAGGAAGCAGAGAGGGCTGG - Intergenic
929593268 2:43160455-43160477 AGGAAGGGTGTAGACAGGGTTGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931753049 2:65347575-65347597 AGGAAGGGCGGAGAGAGTGCTGG - Intronic
931789007 2:65646843-65646865 GGGGAGGGTGTAGAGAGTTCAGG - Intergenic
931790454 2:65659603-65659625 AGGGAGGCTGCAGAGGGGGTGGG - Intergenic
932330095 2:70893933-70893955 ATGGAGGAAGGAGAGAGTGTTGG + Intergenic
932366003 2:71153972-71153994 AGGGAGGGGGCAGAGCGTACGGG + Intergenic
932564274 2:72895795-72895817 AGGGAGGGGGGAGAGAGAGAGGG - Intergenic
933301342 2:80544679-80544701 TAGGAGGCTCCAGAGAGTGTAGG + Intronic
934603172 2:95673948-95673970 GGGGAGGGTGCAGCAAGGGTGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
934990016 2:98914350-98914372 GGGGAGGGTGGAGGGAGTGAGGG - Intronic
935089590 2:99882091-99882113 AGAGAGGGTGGGGAGAGTGAGGG - Intronic
935181243 2:100692938-100692960 AGGGAGCTTGCAGGGAGAGTGGG - Intergenic
935191298 2:100780705-100780727 GGGGAGGCTGCAGAGAGAGGTGG - Intergenic
935918735 2:107986655-107986677 AGGGAGGGTGCGGGGTGGGTCGG - Exonic
936567533 2:113592542-113592564 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
936946304 2:117934054-117934076 GGGGAGAGTGAAGAGAGTGAAGG + Intronic
937235798 2:120431228-120431250 AGGGACGGTGGTGGGAGTGTTGG + Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
938418049 2:131120739-131120761 AGGGAGGGGGTACAGAGTGCGGG + Intronic
939862686 2:147438712-147438734 AAGGAGGAGGCACAGAGTGTAGG - Intergenic
940893261 2:159055800-159055822 AGGGATGGTCCAGAGAATGCAGG - Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
942461469 2:176171476-176171498 AGGGAGGGCGCTGAGCGAGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943760170 2:191599556-191599578 AAGGAGAGGGCAGAGAGTTTGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944550159 2:200838331-200838353 AGAGAGGGCGCAGAGTTTGTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944688790 2:202140864-202140886 AGGGAGGGGGCAGCCAGTGGGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946315614 2:218909398-218909420 AGGGAGGTTGCCGAGAGGCTGGG - Intergenic
946818635 2:223607889-223607911 AAGGAGGGGTGAGAGAGTGTAGG - Intergenic
947103279 2:226644437-226644459 AGGGAGGCTGCAGAGATGGGAGG - Intergenic
947587100 2:231363097-231363119 AGGGAGTGTGCAAGGAGTGCAGG + Intronic
948689854 2:239695123-239695145 AAGGAGGTTCCAGAGAGTTTTGG + Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168803859 20:661826-661848 AGGGAGGCTGCAGGGATGGTGGG - Exonic
1169273363 20:4217213-4217235 AGGGAGGCTGCAAAAAGTGCAGG + Intergenic
1169967274 20:11232068-11232090 AAGGAGGGTGCAGGGACTTTGGG + Intergenic
1170027488 20:11905857-11905879 TGGGAGGTTGCAGAGAGATTTGG + Intronic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170889045 20:20364081-20364103 AGGGAGGGAGGAGAGCGGGTAGG - Intergenic
1171101298 20:22385822-22385844 AGGGAGGGAGAAAAGAGGGTTGG - Intergenic
1171141391 20:22746849-22746871 GGGGAGAGTGGAGAGAGTGATGG + Intergenic
1171908808 20:30922138-30922160 AGGAAGGGTCCGGAGAGGGTGGG + Intergenic
1172442707 20:34977424-34977446 AGGCTGGGTGCAGAGACTGACGG - Intronic
1172981778 20:38948560-38948582 AGGAAGGTTGAAGAGAGGGTGGG + Intronic
1173360831 20:42343064-42343086 AGGCATGGTGCACAGGGTGTGGG - Intronic
1173443174 20:43095856-43095878 AGGGAGGGTGGAAAGAGAGAAGG - Intronic
1173443203 20:43095976-43095998 AGGGAGGGTGGAAAGAGAGAAGG - Intronic
1173586449 20:44186740-44186762 AGCGTGGGTGCAGAGGGCGTGGG + Exonic
1173793233 20:45841395-45841417 TGGGAGGCTGCAGAGGGTGCTGG + Exonic
1174049288 20:47756711-47756733 AAGGAGGTTGCAGTGAGTGGAGG - Intronic
1174189902 20:48732979-48733001 AGTGTGGGTGCAGACAGTCTGGG - Intronic
1174424816 20:50424371-50424393 AGGGAGGCAGCAGGGAGAGTTGG - Intergenic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1174594705 20:51674714-51674736 GGGTAGGGTGCTGAGAGTTTAGG - Intronic
1175227765 20:57454836-57454858 AGGGAGGGTGAACAGAGAATAGG + Intergenic
1175392533 20:58636190-58636212 AGGGAGGGAGCACAGAGAGAGGG + Intergenic
1175600856 20:60271605-60271627 ATGGAGGGTCCAGAGAGGGAAGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1175717141 20:61262773-61262795 AGGGAGGGAGGAGAGAGGGAAGG - Intronic
1175785973 20:61712044-61712066 AGGGAGGCTGGAGAGAGGCTTGG + Intronic
1176060321 20:63169659-63169681 AGGGAGGGTGCAGGGAGAGGAGG - Intergenic
1176080061 20:63267954-63267976 GTGGAGGGTGCAGAGGGCGTGGG + Intronic
1176723587 21:10412695-10412717 AAAGAGGGTGCAGAGAGGGAGGG - Intergenic
1176796493 21:13374134-13374156 AAAGAGGGTGCAGAGAGGGAGGG + Intergenic
1176808803 21:13516622-13516644 AAAGAGGGTGCAGAGAGTGGGGG + Intergenic
1177105068 21:16945487-16945509 AGGAAGAGTGCAGAGACCGTGGG + Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1179033579 21:37741265-37741287 AGAGAGAGTCCAGAGGGTGTGGG - Intronic
1179063387 21:38001205-38001227 AGGGATAGTGGAGAGAGTATTGG - Intronic
1179418046 21:41214143-41214165 AGGGAGGGTGCAGAGAGATCTGG + Intronic
1179601001 21:42477047-42477069 GTGGAGGGGGCAGAGGGTGTGGG - Intronic
1179601019 21:42477088-42477110 GTGGAGGGGGCAGAGGGTGTGGG - Intronic
1179601035 21:42477129-42477151 GTGGAGGGGGCAGAGGGTGTGGG - Intronic
1179601083 21:42477243-42477265 GTGGAGGGGGCAGAGGGTGTGGG - Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180012222 21:45058650-45058672 AGGGATGGTGTGGAGAGTGAGGG + Intergenic
1180319529 22:11307701-11307723 AGTCAGGGTGCAGAGAGGGGTGG + Intergenic
1180463987 22:15594276-15594298 AGGGAGGGTGGAGGGAGGGAAGG + Intergenic
1180656996 22:17430337-17430359 AGGGAGGGTGCAGAAAGGTAGGG - Intronic
1181998565 22:26902561-26902583 AGGGAGGGAGCAGGGAGGGAGGG - Intergenic
1182756120 22:32681113-32681135 AGTGAGGGAGGAGAGAGTATGGG + Intronic
1182875981 22:33691259-33691281 AGGGAGGGAGGAGAGAGGGAGGG + Intronic
1182912777 22:34001146-34001168 TGGGAGGATGCAGAATGTGTTGG + Intergenic
1183496428 22:38147385-38147407 AGGCAGTGCCCAGAGAGTGTTGG + Intronic
1183703162 22:39461246-39461268 GGAAAGGATGCAGAGAGTGTTGG + Intronic
1184247029 22:43240947-43240969 TGGCAGGGTGCAGAGGGTGGGGG + Intronic
1184484373 22:44767199-44767221 AGGGAGGGAGCAGAGAAGGAAGG - Intronic
1184573371 22:45341522-45341544 AGGGAGTTTGCAGAGAGTGAGGG + Exonic
1184692797 22:46124851-46124873 AGGGAGGACCCAGACAGTGTGGG + Intergenic
1185017710 22:48354590-48354612 AGGGAAGGTCCACAGAGTGAGGG + Intergenic
950303626 3:11901820-11901842 AGGGTGGGTGCAGAAGGTGATGG + Intergenic
950624097 3:14231624-14231646 AGGGAGGGTGGAGAGTTGGTTGG - Intergenic
950714612 3:14838885-14838907 AAGGAGGGGGCAGAGGGGGTAGG - Intronic
950849768 3:16051344-16051366 GGGGAGGGTGCTGAGAGGGGTGG + Intergenic
950958351 3:17079193-17079215 AGAGAGGATGCAGAGAGCGAGGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952786450 3:37160179-37160201 AGGGAGGGAGTAGGAAGTGTGGG + Intronic
953119327 3:40024437-40024459 AGGGCAGGTGCAGAGAGAGATGG + Intronic
953821333 3:46209878-46209900 AGGAAGGGTGCATCGAGGGTGGG + Intronic
954106363 3:48411796-48411818 GGCGAGGGTGGAGAGTGTGTGGG - Intronic
954680769 3:52344756-52344778 AGGGGAGGTGCAGGGAGTGTTGG - Intronic
955453019 3:59090669-59090691 ATGGAGGGTGTAATGAGTGTTGG - Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955698260 3:61657995-61658017 AGGGTGGGTGCCCAGTGTGTAGG - Intronic
955807979 3:62756864-62756886 AGGGAGGGGCCAGAGAGTCCAGG + Intronic
955901851 3:63764376-63764398 AGGGAGGGAGGAGAGAGAGAGGG + Intergenic
956685227 3:71820590-71820612 GGGGAGGGAGCAGGGAGTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958929248 3:100191339-100191361 AGAGAGGGTGAAGAGAGTGAGGG - Intronic
959306834 3:104677980-104678002 AGGGAGAGTGAAGAGATAGTGGG + Intergenic
959661951 3:108878936-108878958 AGGGTGGGTGCAGAATTTGTAGG + Intergenic
959757613 3:109917568-109917590 TGGTAGGGTGCAGAGAGAGGAGG + Intergenic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
960050176 3:113232101-113232123 AGGGAAGGAGCAGAGGGGGTGGG - Intronic
960265978 3:115621582-115621604 AGGGAGGAGGCAGAGAATGTGGG - Intergenic
960891455 3:122452625-122452647 AGGGAGGGAGGAGAGAGGGAGGG + Intronic
961158543 3:124701662-124701684 AAGGAGGATGCAGAGAGAGAAGG - Intronic
961319159 3:126061029-126061051 GGGGAGGGTCCACAGAGTGTGGG + Intronic
961546036 3:127634021-127634043 AAGGTGGGTGCAGAGAGGGGAGG + Intronic
961648342 3:128404666-128404688 TGGGATGGGGCACAGAGTGTGGG - Intronic
961995611 3:131238688-131238710 AGAGAGGGAACAGAGAGTGAGGG + Intronic
962444521 3:135452800-135452822 AAGGAAGGAGCAGAGAGTGCTGG - Intergenic
962577537 3:136768794-136768816 AGCAATGGTGCAGAGAGGGTGGG - Intergenic
962908401 3:139825760-139825782 ATGGAGGGTGAAGAGAGAGGGGG + Intergenic
963829372 3:149990555-149990577 ATAGAGGGTGGGGAGAGTGTGGG - Intronic
964902443 3:161675927-161675949 AGGATGGGGGCAGAGAGTGGTGG - Intergenic
965173080 3:165293876-165293898 AGGGAGGGAGGAGAGAGGGAGGG + Intergenic
965544350 3:169900110-169900132 TGGGAGGCTGCTGAGGGTGTGGG + Intergenic
965630897 3:170731441-170731463 AGGAGGGGAGCAGAGAGGGTAGG + Intronic
966872530 3:184300134-184300156 AGGCAGGGTGCAGGGAGTTGAGG + Intronic
966949461 3:184803295-184803317 GTGGAGGGTACAGAGAGTGGGGG - Intergenic
967356505 3:188577902-188577924 AGGGAGGGAGGAGAGAGAGAGGG - Intronic
967920101 3:194608139-194608161 AGGGAGGAGGCAGGGTGTGTGGG - Intronic
968622713 4:1610942-1610964 AGGGTGGGTGCTCAGAGTGTGGG - Intergenic
968762679 4:2450709-2450731 AGGGAGGGTGCAGGGCCTGTGGG - Intronic
969060652 4:4431714-4431736 AGGGAGGGTGCACAGAAGGTGGG - Intronic
969922883 4:10557387-10557409 AGGGAGGTTGGAGAGAGAGATGG + Intronic
970057300 4:11989280-11989302 ACGGATGGTGCAGTCAGTGTTGG - Intergenic
970320795 4:14873591-14873613 AGGGAGGATGCAGCCAGTGAAGG + Intergenic
970510203 4:16774219-16774241 AGGGATGGTTGAGAAAGTGTGGG - Intronic
971135976 4:23869000-23869022 ATGGAGGGTGCAGAGATGGCAGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973848851 4:54941160-54941182 GGGTGGGGTGCAGAGAGTGAAGG - Intergenic
975446813 4:74474986-74475008 AGGGTGGGTATAGAAAGTGTGGG + Intergenic
976221050 4:82757120-82757142 AGCGAGGATGGAGAGAGGGTGGG - Intronic
976501826 4:85799255-85799277 AGGGCAGGTGCAGAGAATCTGGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978233110 4:106424457-106424479 AGGGACGGTTCAGAGAGGTTAGG + Intergenic
978735999 4:112085232-112085254 AGGGAGGGTTCAGTCAGTGATGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980646581 4:135651331-135651353 ACAGAGGGTGCAGTGATTGTGGG + Intergenic
980737728 4:136912983-136913005 AGGAAGTGTGCAAAGAATGTAGG - Intergenic
981632086 4:146831492-146831514 TGGCAGGCTGCTGAGAGTGTTGG + Intronic
981990051 4:150907321-150907343 AGGGAGGGGGCAGAGAGGGGAGG + Intronic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982168257 4:152636134-152636156 TGGGAGGGTGTTGTGAGTGTGGG + Intronic
982357769 4:154489413-154489435 AGGCAGGTGGCAGAGAGTGGGGG + Intronic
983066531 4:163216317-163216339 AGGGAGGGAGGAGAGAGGGAAGG + Intergenic
983516599 4:168663516-168663538 AGAGGGGGTGCAGAGTGTGTGGG + Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984548894 4:181137803-181137825 GGGGAGGGAGCAGAGAGGTTGGG + Intergenic
984938890 4:184914316-184914338 AGGTAGGATCCAGTGAGTGTAGG + Intergenic
985085455 4:186308345-186308367 AGGGAGGGTTCAGAGAAAGAGGG + Intergenic
985805156 5:2038475-2038497 AGGGAGGGTGCAGAGGGGTTCGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986444284 5:7807826-7807848 AGGGCTGGTGTAGAGACTGTAGG - Intronic
986516026 5:8564764-8564786 AGAGAGCTTGAAGAGAGTGTTGG - Intergenic
986536073 5:8788783-8788805 AGGGAGGGAGGAGAGAGAGAGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986729448 5:10624497-10624519 AGGGTGGGTGCACACAGTGGCGG - Intronic
986759854 5:10870039-10870061 TGGGTGGGTGCAGAGGGTGGGGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
989405835 5:41059726-41059748 AGGGAATGTGCTAAGAGTGTAGG - Intronic
990681634 5:58251146-58251168 AGGAAGGGGACAGAGAATGTGGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
990995803 5:61731296-61731318 AGAGAGGGTGGAGAGAGATTAGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991658144 5:68923733-68923755 AGGGACGGTCCAGAGGGAGTGGG - Intergenic
992169350 5:74086752-74086774 AGGGAGGATGAAGAGAGGGGAGG - Intergenic
992174264 5:74134099-74134121 AGGATGGCTGCAGAGATTGTAGG - Intergenic
992204213 5:74414449-74414471 AGGGAGGGGGCAGAGGAAGTAGG + Intergenic
992425974 5:76657818-76657840 AGGGAGGGTGCTCAGAATCTAGG - Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993234667 5:85289220-85289242 AGGGAGGGAGCAAAGAGAGAAGG + Intergenic
993256985 5:85604471-85604493 AGGGAGGGAGCAGTGACGGTGGG + Intergenic
993416378 5:87638500-87638522 AGGGAGGGTGAAGTGGGTGGGGG + Intergenic
993613633 5:90084299-90084321 GGGGAGGGGCCAGAGAGTGAAGG + Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995894698 5:116998343-116998365 AGGGAAGTTGCAGTGAGTGGAGG - Intergenic
996668078 5:126083964-126083986 GGGGAGGGTCCACAGAGTGAAGG + Intergenic
997610255 5:135210806-135210828 AGGGAGAGAGAAGAGTGTGTCGG - Intronic
998649980 5:144107601-144107623 AAGAAGGATGCAGAGAGTGGGGG + Intergenic
999202431 5:149825781-149825803 AGGAAGGGAGCAAAGAGTGCAGG + Intronic
999328159 5:150656379-150656401 GGGGAGAGAGCAGAGAGGGTGGG - Intronic
999367942 5:151035079-151035101 AGGGAGGGAGAAAAGACTGTCGG + Intronic
999368061 5:151035717-151035739 AGGGAGGGTGAAGAGAGGGAGGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999610205 5:153361274-153361296 AGAGTGAGTTCAGAGAGTGTTGG - Intergenic
1000146301 5:158456474-158456496 AAGGAGGGAGCAGAGAGATTGGG + Intergenic
1000373730 5:160560581-160560603 AGGTTGTGTGAAGAGAGTGTGGG - Intergenic
1001228150 5:169963373-169963395 GGGGAGGGAGCAGAGAGGGATGG - Intronic
1001419213 5:171574054-171574076 AGGGAGGCAGCAGACAGTGACGG - Intergenic
1001808154 5:174606747-174606769 AGGGAGAGTGGAGAGAGAGGAGG - Intergenic
1001837732 5:174845913-174845935 GAGGAAGGTGCAGAGAGTGCTGG - Intergenic
1001981035 5:176037175-176037197 AAAGAGGGTGCAGAGAGGGAGGG + Intergenic
1002085878 5:176775021-176775043 AGGGAGGTTGGCGTGAGTGTGGG - Intergenic
1002236425 5:177806891-177806913 AAAGAGGGTGCAGAGAGGGAGGG - Intergenic
1002303591 5:178271051-178271073 AGGGTGGGTCCAGAGAGTGGGGG + Intronic
1002476435 5:179469066-179469088 AGGGGTGGGGCAGAGAGTGGGGG - Intergenic
1002935042 6:1664323-1664345 TGAGAGGGTCCAGAGAGTGAAGG - Intronic
1003507356 6:6751000-6751022 AGGGAGCGTGGAGAGAAGGTGGG - Intergenic
1003541892 6:7025441-7025463 AGGGTGGGTGCAGAGGCTGGTGG - Intergenic
1003776203 6:9368418-9368440 TGGGGGGGTGCAGAGAGGGGAGG - Intergenic
1004607285 6:17206440-17206462 AGGGAGGGTGCAGGGGGAGGGGG + Intergenic
1004632212 6:17432951-17432973 AGGGAGGGGGGAGAGAGGGAGGG - Intronic
1005004913 6:21278317-21278339 AGGGAGGCAGGAGAGAGGGTGGG + Intergenic
1005426253 6:25705867-25705889 AGGGAGGCTGGAGGGAATGTGGG - Intergenic
1005882159 6:30070084-30070106 AGGGAGGGAGCAAAGAGATTGGG + Exonic
1006367345 6:33623157-33623179 AGGGAAGGAGGAGAGGGTGTGGG + Intronic
1006756450 6:36419903-36419925 TGGGAGGGAGAAGATAGTGTGGG + Intronic
1006918681 6:37613506-37613528 AGGGAGGTAGAAGAGAGTCTGGG - Intergenic
1007251690 6:40499636-40499658 AGAGTGGCAGCAGAGAGTGTGGG + Intronic
1007768749 6:44177020-44177042 AGGGGGTGTGCAGGGAGTGAAGG + Intronic
1007787167 6:44287317-44287339 ATGGAGGGTGCAGTGTGGGTGGG + Intronic
1008293222 6:49744378-49744400 AAGGAAGGTGCAGAGAGAGAAGG + Exonic
1008848623 6:55997266-55997288 AGGCTGGGTGCAGAGACTGGTGG - Intergenic
1008906258 6:56680724-56680746 AGGGAGAGTGAGGAGAGTGGAGG - Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011218677 6:85032056-85032078 GAGGAGGGGGCAGGGAGTGTTGG - Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012491658 6:99788969-99788991 ACGGAGGCTGGAGAGAGTGGTGG - Intergenic
1014035948 6:116766465-116766487 AGGGAGTGTGGAGAGTTTGTGGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015903338 6:138090276-138090298 AGGATGGGTGCAGAGAGGCTGGG - Exonic
1015928966 6:138337481-138337503 GGGAAGGGAGCAGGGAGTGTGGG + Exonic
1016314633 6:142772157-142772179 GGGGATGGTGCAGAAAGTGGGGG - Exonic
1016558788 6:145370711-145370733 TGGGAGGCAGCAGAGGGTGTTGG - Intergenic
1017541193 6:155404764-155404786 GTGCAGGGTGCAGAGAGGGTTGG + Intronic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1017674072 6:156795737-156795759 AGGAAGGGCGCAGAGGGTCTCGG - Intronic
1017786707 6:157762691-157762713 AGGGAGGATGCAGTGGGGGTTGG + Intronic
1018225326 6:161622539-161622561 AAGAAGGCTGCATAGAGTGTGGG - Intronic
1018639000 6:165889879-165889901 AGGGAGGGAGGAGTGAGTGAGGG - Intronic
1019676469 7:2315988-2316010 ATGCAGGATGCAGTGAGTGTGGG - Intronic
1020088136 7:5322679-5322701 AGGGAGGGAGCAGAGGGTTGGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021899266 7:25267104-25267126 AGAGAGGATGCAGAGATTGCAGG + Intergenic
1021939513 7:25665802-25665824 AGGGAGGGTGTAGAATGTGAAGG + Intergenic
1022504629 7:30902607-30902629 GTGGAGGGTGCAGGAAGTGTTGG + Intergenic
1022986368 7:35658322-35658344 AGGAAGGGTGCTGGGAGTGGTGG + Intronic
1023035823 7:36130700-36130722 AGGGAGGGTACAGGAAGTGAGGG + Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023931230 7:44707845-44707867 AGGGAGGGGGCAGTGAGGGCAGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025206173 7:56994446-56994468 AGGGAGGGAGCAGAGAGTTGGGG + Intergenic
1025665767 7:63582493-63582515 AGGGAGGGAGCAGAGAGTTGGGG - Intergenic
1025913412 7:65846416-65846438 AGGGAGGGTGGGGGGAGTGAGGG - Intergenic
1026101815 7:67390144-67390166 AGGGGAGGGGCAGAGAGTGATGG - Intergenic
1026494217 7:70888481-70888503 AGGGAGGGAGGAGAGAGGGAGGG + Intergenic
1027235854 7:76297444-76297466 AGGGAGTGAGCAGAGTGTGTGGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029065438 7:97843592-97843614 AGAGAGGGAGCAAAGAGTGGGGG + Intergenic
1029584835 7:101463721-101463743 AGGGAGGGGGGAGAGAGGGAGGG - Intronic
1029983805 7:104903111-104903133 GGGAAGGGAGCAGTGAGTGTTGG - Intronic
1030475384 7:110026154-110026176 AGGGAGGGATCATAGAGAGTGGG + Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031484470 7:122310818-122310840 AGGGAGGCTCCAAAGAGTTTCGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1032517772 7:132519602-132519624 AGAGAGGCTACAGGGAGTGTAGG - Intronic
1032532871 7:132636503-132636525 TGGGATGGAGCCGAGAGTGTGGG - Intronic
1032583275 7:133123456-133123478 GGGGAGGATGCAGGGAGAGTAGG - Intergenic
1033036678 7:137882114-137882136 AGGGAGGATGGAGACAGTGGGGG + Intronic
1033039467 7:137905069-137905091 AGGGAGGGGGCAAAGAGGGAAGG - Intronic
1033459586 7:141533248-141533270 AGGGAGGAGGCAGAAAGTGAGGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034677606 7:152902945-152902967 AGGGATGGTGCTGGGAGTGGAGG + Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035049281 7:155989355-155989377 ACAGAGTGGGCAGAGAGTGTGGG - Intergenic
1035177618 7:157063180-157063202 AGGGATGGGGCAGAGAGGGAGGG + Intergenic
1035360639 7:158311091-158311113 AGGGAGGGCGCAAATAGAGTGGG + Intronic
1035387805 7:158485623-158485645 AGGAGGGGTGCAGAGAGGGGTGG - Intronic
1035474884 7:159136231-159136253 AGTGAGGGGGCTGAGCGTGTTGG + Intronic
1035817934 8:2561463-2561485 AGGGAGGGTGCAGAGGCTCAGGG - Intergenic
1037827918 8:22170264-22170286 GGAGTGGGGGCAGAGAGTGTGGG + Intronic
1037977616 8:23224687-23224709 CGGGAGGGGGCAGAGAGAGAGGG - Intronic
1038357551 8:26843469-26843491 AGGGTTGGAGTAGAGAGTGTAGG + Intronic
1038428055 8:27477928-27477950 AGAGATGCTGCAGTGAGTGTGGG - Intronic
1038441454 8:27573478-27573500 AGAGAGGGCGGAGAGAGGGTGGG - Intergenic
1038553861 8:28493010-28493032 AGTGAGGGGGCAGATAGCGTGGG - Intergenic
1038692562 8:29776147-29776169 AGAGAGGGTGATGAGGGTGTTGG + Intergenic
1039392085 8:37189463-37189485 AGAGAGAATGGAGAGAGTGTGGG + Intergenic
1039657827 8:39429218-39429240 ATGGAGGCAGCAGAGAGTATAGG + Intergenic
1039781345 8:40789081-40789103 AGGGAGGGAGGAGAGAGGGAAGG + Intronic
1040071753 8:43194422-43194444 ATGGAGTGTGCAGAGTGTGTGGG + Intronic
1040533253 8:48283080-48283102 GGGGTGGGTGGAGAGAGTGGAGG + Intergenic
1040703331 8:50094118-50094140 TGGGAGTGTGCAGGGAGGGTAGG + Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043226919 8:77745201-77745223 AGGGAGGGTACAGAAATTGGAGG + Intergenic
1043476782 8:80613088-80613110 AGGGAGGGTAAATAGCGTGTTGG - Intergenic
1043575247 8:81649153-81649175 AGGGAGGAAGCAGAGAGAGCAGG + Intergenic
1044434945 8:92150909-92150931 AGAGGGGCTGCAGACAGTGTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044639448 8:94363153-94363175 AGGCAGGGTGCAGTGATTTTTGG + Intergenic
1046687534 8:117244097-117244119 AGGAGGTGTGCAGAGAGTGTTGG + Intergenic
1046691889 8:117295106-117295128 AGTGAGGGCTCAGTGAGTGTTGG + Intergenic
1047406026 8:124586513-124586535 GGGGAGGGAGGAGAGACTGTAGG - Intronic
1048290962 8:133181481-133181503 TGGGAAGGTGCAGAGAGCGGTGG + Intergenic
1049017225 8:139929446-139929468 AGGGAGGGGGCCGAGCGTGGTGG + Intronic
1049148957 8:141022038-141022060 CGAGAGGCTGCAGGGAGTGTGGG + Intergenic
1049205566 8:141361933-141361955 GGGGAGGGGGCAGAGGGTGAAGG + Intronic
1049251324 8:141590746-141590768 TGGGGAGGTGGAGAGAGTGTGGG - Intergenic
1049298176 8:141854922-141854944 AGGGAAGGAGCAGGGAGTGGAGG + Intergenic
1049370245 8:142260975-142260997 AGGGAGGGAGGAGAGAGGGAGGG + Intronic
1049370298 8:142261155-142261177 AGGGAGGGAGGAGAGAGGGAAGG + Intronic
1049388529 8:142356345-142356367 AGGCAGCGTGCAGAGAGGGGAGG - Intronic
1049487758 8:142875361-142875383 AGGAAGGGTGCAGAGAGCACAGG - Intronic
1049492530 8:142912934-142912956 AGGAAGGGTGCAGAGAGCACAGG - Intronic
1049592844 8:143470386-143470408 AGGGAGGGTGATGAGGGTCTTGG + Intronic
1049717987 8:144102615-144102637 AGGGTTGGTGCAGATAGGGTTGG - Intronic
1049885000 9:20991-21013 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1050231660 9:3532305-3532327 AGGGAGGGGGCAGAGAGAGAGGG - Intergenic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051553039 9:18351525-18351547 AAGGAGGGTCGAGAGAGTGTTGG + Intergenic
1052917491 9:33934705-33934727 AGTGAGGGAGAAGAGAGTATGGG + Intronic
1053056044 9:34993630-34993652 AGGGAGGGGGCAGAGAGAGGCGG - Intronic
1053415221 9:37943165-37943187 AGGCAGGCTGCAGAGAGAATGGG - Intronic
1053572275 9:39321310-39321332 AGGCAGGGTGCCGAGAGTAGTGG - Intergenic
1053885739 9:42644197-42644219 AAAGAGGGTGCAGAGAGGGAGGG - Intergenic
1054093835 9:60880021-60880043 AGGCAGGGTGCCGAGAGTAGTGG - Intergenic
1054124870 9:61297701-61297723 AGGCAGGGTGCCGAGAGTAGTGG + Intergenic
1054224757 9:62451646-62451668 AAAGAGGGTGCAGAGAGGGAGGG - Intergenic
1054375414 9:64445684-64445706 TGGGAGGGTGGGGAGAGTTTCGG + Intergenic
1054771853 9:69090645-69090667 AGGGCGGGGGCAGGGAGTGGGGG - Intronic
1055154216 9:73040567-73040589 ATGGAGGTTGCAGTGAGTGGAGG + Intronic
1056780852 9:89549301-89549323 AGAGATGGTGCTGAGAGGGTAGG - Intergenic
1056790080 9:89619662-89619684 AGGGAAGGTGCAGTGAATGCTGG + Intergenic
1056910563 9:90696472-90696494 AGGGATGGTGCAGAGCCTGAGGG - Intergenic
1057510888 9:95678697-95678719 AGGCTGGGTGCAGGGAGAGTGGG + Intergenic
1057726300 9:97571011-97571033 AGGGAGGGCGCAGAAGGGGTAGG - Intronic
1057895508 9:98905528-98905550 AGGGAGGGTGCAGCGAAGGAGGG - Intergenic
1057988077 9:99737916-99737938 AGAGAGGGTGCACTGGGTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058436425 9:104968196-104968218 TGGGAGGGTGGAGAGAGCGGTGG - Intergenic
1058977782 9:110140781-110140803 AGGGAGGGTAAGGAGGGTGTTGG - Intronic
1059422786 9:114202824-114202846 AGGGATGGTGAAGAGAGGGTGGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059641141 9:116218251-116218273 AGGGAAGGTGCAGGGTGTGAGGG - Intronic
1060281988 9:122221168-122221190 AGGGAAGGAGCAGAGAGAATAGG - Intronic
1060665239 9:125428665-125428687 GGGGAGGCTGCAGATAGTGATGG + Intergenic
1060690351 9:125652498-125652520 AGGGAAGCTGCAGAGAGCATGGG - Intronic
1060768047 9:126309639-126309661 AGGGAGGGTGCTGGGAGCCTTGG - Intergenic
1061086822 9:128404541-128404563 AGGGAGATGGAAGAGAGTGTTGG - Intergenic
1061127533 9:128686312-128686334 AGGGAGGTGGCAGGGAGGGTTGG + Intronic
1061277713 9:129579014-129579036 AGGGAGGATGGAGAGAGTAGAGG - Intergenic
1061653427 9:132069245-132069267 AGGGAGGCTGCAGAGGCTGCTGG - Intronic
1062144025 9:134978990-134979012 AGGGAGGGAGGAGAGAGGGAGGG + Intergenic
1062396862 9:136356072-136356094 AGGGAGGGGGCAGGGCGTGGGGG + Intronic
1062581909 9:137232489-137232511 AGAGAGGGGGCAGAGAATGAGGG + Intronic
1062709946 9:137969784-137969806 ATGGGGGGTTCAGAGTGTGTGGG + Intronic
1203449981 Un_GL000219v1:103272-103294 ATGGAAGGTGAAGAGAGAGTAGG + Intergenic
1187031533 X:15493260-15493282 AGGGCAGGTTAAGAGAGTGTGGG + Exonic
1187571895 X:20512674-20512696 AGGGAGGGTGGAGACAGTCTGGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1190440129 X:50468992-50469014 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1190916275 X:54813321-54813343 AGAGAGGGAGCAGAGAGTTCAGG - Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194135367 X:90134127-90134149 AATGAGGGAGGAGAGAGTGTGGG - Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194276950 X:91896933-91896955 TAGGAAGGTGCAAAGAGTGTTGG - Intronic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195067477 X:101250612-101250634 AGGGAGGTTGCAGGAAGGGTGGG + Intronic
1195205341 X:102593955-102593977 GAGGAGTGTGCAGAGAGTATGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196740753 X:119023928-119023950 AGAGAGGATGCAGTAAGTGTTGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197581248 X:128287458-128287480 GGGGAGGGGGAAGATAGTGTTGG - Intergenic
1197851188 X:130862150-130862172 AGGGAGGGAGCAGATCTTGTAGG - Intronic
1197907152 X:131437751-131437773 GGGGAGGGTGTTGAGAGAGTGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199441661 X:147875607-147875629 AGTGAGGTTGGAGAGAGTCTGGG - Intergenic
1199653878 X:149975470-149975492 AGGGAGGAGCCAAAGAGTGTTGG + Intergenic
1199828800 X:151528268-151528290 AGAGAGGGTGAAGGGAGAGTAGG + Intergenic
1200481147 Y:3704224-3704246 AATGAGGGAGAAGAGAGTGTGGG - Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1200594297 Y:5119032-5119054 TAGGAAGGTGCAAAGAGTGTTGG - Intronic
1201719833 Y:17084428-17084450 AGGGAAGGAACAGAAAGTGTGGG - Intergenic