ID: 1163604551

View in Genome Browser
Species Human (GRCh38)
Location 19:18266861-18266883
Sequence GACCCTGCACACAGGGCTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 2, 2: 1, 3: 36, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163604543_1163604551 0 Left 1163604543 19:18266838-18266860 CCCCCGGACTCTGGCAGCATGAG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1163604551 19:18266861-18266883 GACCCTGCACACAGGGCTCTGGG 0: 1
1: 2
2: 1
3: 36
4: 227
1163604542_1163604551 4 Left 1163604542 19:18266834-18266856 CCAGCCCCCGGACTCTGGCAGCA 0: 1
1: 0
2: 2
3: 23
4: 307
Right 1163604551 19:18266861-18266883 GACCCTGCACACAGGGCTCTGGG 0: 1
1: 2
2: 1
3: 36
4: 227
1163604546_1163604551 -2 Left 1163604546 19:18266840-18266862 CCCGGACTCTGGCAGCATGAGGA 0: 1
1: 0
2: 0
3: 26
4: 595
Right 1163604551 19:18266861-18266883 GACCCTGCACACAGGGCTCTGGG 0: 1
1: 2
2: 1
3: 36
4: 227
1163604544_1163604551 -1 Left 1163604544 19:18266839-18266861 CCCCGGACTCTGGCAGCATGAGG 0: 1
1: 0
2: 0
3: 12
4: 308
Right 1163604551 19:18266861-18266883 GACCCTGCACACAGGGCTCTGGG 0: 1
1: 2
2: 1
3: 36
4: 227
1163604539_1163604551 25 Left 1163604539 19:18266813-18266835 CCGTCTGGTGTGGCAGGAAGGCC 0: 1
1: 0
2: 1
3: 27
4: 200
Right 1163604551 19:18266861-18266883 GACCCTGCACACAGGGCTCTGGG 0: 1
1: 2
2: 1
3: 36
4: 227
1163604547_1163604551 -3 Left 1163604547 19:18266841-18266863 CCGGACTCTGGCAGCATGAGGAC 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1163604551 19:18266861-18266883 GACCCTGCACACAGGGCTCTGGG 0: 1
1: 2
2: 1
3: 36
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163604551 Original CRISPR GACCCTGCACACAGGGCTCT GGG Exonic
900104220 1:975456-975478 GCACCTGCACCCAGGGCTCCCGG + Exonic
900353731 1:2249664-2249686 GAGCCAGCACAGAGGGCTCACGG + Intronic
900375813 1:2354213-2354235 GACCCTGCCGACCGTGCTCTGGG + Intronic
900791094 1:4681412-4681434 CACCCTGGACGCAGGCCTCTGGG + Intronic
901789996 1:11649002-11649024 GACCCCGCCCACAGCGCTCCTGG - Intronic
903350362 1:22713052-22713074 GGCCCTGGACACAGGGCTGGTGG + Intronic
903802811 1:25982320-25982342 AACCCTGAATACTGGGCTCTAGG + Intronic
903857831 1:26347046-26347068 GACTCTGCCCACAGAGCCCTAGG + Intronic
903981626 1:27192855-27192877 GACCCAGCACAGAGACCTCTTGG + Intergenic
904094759 1:27967904-27967926 GACCAGGCTCACAAGGCTCTTGG - Exonic
904473413 1:30749619-30749641 GACCCAGCACACAGGGCTCTGGG + Intronic
905445705 1:38027369-38027391 CACCCTGCACATAAGGCTCCGGG - Intergenic
905627569 1:39498778-39498800 GCCCATGCACCCGGGGCTCTGGG + Intronic
905668855 1:39778330-39778352 GCCCATGCACCCGGGGCTCTGGG - Intronic
906150111 1:43582718-43582740 GACCCTGTGGACCGGGCTCTGGG - Intronic
907399634 1:54216895-54216917 GACCCTGCCCTCAAGGATCTAGG - Intronic
913241733 1:116835736-116835758 TACCCTGCCCACTGGCCTCTAGG - Intergenic
914334793 1:146704526-146704548 CACCCTGCACTCAGCCCTCTAGG - Intergenic
915304410 1:154969497-154969519 GCCCCTTCACAAAGGGCCCTAGG + Intronic
917843651 1:179002810-179002832 GACCCTGCAGAGAGAGCCCTGGG + Intergenic
918505532 1:185249801-185249823 GACTCTGCTCTCTGGGCTCTTGG + Intronic
923703472 1:236322431-236322453 GGCCCTTCACACTGGGCTCAAGG + Intergenic
1062857856 10:788322-788344 GACCCTCCAGCCAGGGGTCTCGG - Intergenic
1064304542 10:14153466-14153488 GAACCTCCACACAGGGCTCCAGG + Intronic
1066315854 10:34245842-34245864 GGCTCTGCACACATGTCTCTGGG - Intronic
1067691911 10:48507607-48507629 GACCCAGCACACAGAGGTGTGGG - Intronic
1067694017 10:48522689-48522711 GACACCACACACAGGGCTCTCGG + Intronic
1067829438 10:49601815-49601837 GACCCTGCACACAGGTCAGAGGG + Intergenic
1071162127 10:82759591-82759613 GATCCTGCACATAGAGCTCCTGG + Intronic
1071574223 10:86714241-86714263 GATCCTGCAGCCAGGGCTCTTGG + Intronic
1072683247 10:97521661-97521683 GACCCAGAACACAGAGCTCCAGG - Intronic
1073424094 10:103445879-103445901 GACCCTGACCACAGGACCCTCGG - Exonic
1073629603 10:105135182-105135204 GACCCTGCACCCATGGTTTTGGG + Intronic
1076796293 10:132799957-132799979 GCACCTCCAAACAGGGCTCTGGG - Intergenic
1083349003 11:62013783-62013805 GAATCTGCCCACAGGGCCCTGGG + Intergenic
1083620677 11:64047988-64048010 GGCCCAGCACACAGGGCACTGGG - Intronic
1083773384 11:64880524-64880546 TTCCCAGCACACAGGGCTCTGGG - Intronic
1083894230 11:65612125-65612147 CAGCCTGCACTCTGGGCTCTAGG + Intronic
1084169816 11:67395702-67395724 CACCCTGTTCACAGGGTTCTGGG + Exonic
1084465448 11:69320552-69320574 GCATCTGCACACAGGGCACTGGG - Intronic
1084681979 11:70671730-70671752 GTCTCTGCACACAGGGCTGTGGG + Intronic
1085294155 11:75421252-75421274 GACCCTGTAGACAGGGCCCTGGG + Intronic
1085456614 11:76669076-76669098 TACCCTGCAGACAGGACACTGGG - Intronic
1085537287 11:77229854-77229876 GACCCAGAAGACAGAGCTCTGGG - Intronic
1086169138 11:83815760-83815782 CTCCCTGCACACAGGCCTCATGG + Intronic
1088836192 11:113579619-113579641 GAGGCTGCACACAGGGCCCGGGG + Intergenic
1089167554 11:116488714-116488736 GGCACTGGGCACAGGGCTCTTGG + Intergenic
1089454327 11:118617158-118617180 CACCCTGGAAACAGGGTTCTGGG + Intronic
1089492718 11:118893870-118893892 GACCCAGCCCACAGAGCCCTCGG - Exonic
1089603007 11:119626655-119626677 GACCCGGGAGACAGGGATCTGGG + Intronic
1090207501 11:124894001-124894023 GACCATGCTCACTGGGTTCTTGG + Exonic
1091342517 11:134828240-134828262 GAACCTGCTCAAAGGCCTCTGGG + Intergenic
1091392393 12:133564-133586 GACCCAGAGCACAGGGCTCAGGG + Intronic
1091406563 12:213169-213191 GACCCTGCACACGGGGGGATGGG + Intronic
1091782169 12:3220770-3220792 CGCCCAGCACAGAGGGCTCTCGG + Intronic
1095981831 12:47978551-47978573 GACCCTGCTCCCAGGGACCTTGG + Intronic
1096490641 12:52010942-52010964 GAAGCTGCACACAGGGGTCAGGG + Intronic
1097176264 12:57145183-57145205 GTCCGTGCAGCCAGGGCTCTAGG - Intronic
1099968558 12:89476851-89476873 TTCCCAGCACTCAGGGCTCTGGG + Intronic
1100799067 12:98212449-98212471 GACGCTGTGCACAGGGCTCTTGG - Intergenic
1101030735 12:100656323-100656345 GACCCTGCCCTCAGGGAACTCGG - Intergenic
1101950337 12:109169637-109169659 TCCACTGCACAAAGGGCTCTGGG - Intronic
1102820456 12:115904655-115904677 AACCTTGCACACATGGCTGTTGG + Intergenic
1103922333 12:124405448-124405470 GAGCCTGTGCACAGGGCCCTAGG - Intronic
1104272182 12:127292687-127292709 GATCCTGCAAACAGGACACTAGG + Intergenic
1104272667 12:127296021-127296043 GATCCTGCAGACAGGACACTGGG + Intergenic
1104407681 12:128531895-128531917 GACCCTGCTCACAAGGCTCCTGG + Intronic
1104591239 12:130085908-130085930 GACCCTCCACAGAGGCCCCTGGG - Intergenic
1104798133 12:131533882-131533904 GACCCTGGACTCAGGACTGTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1110880952 13:80571652-80571674 GACGCTGCACACACTGGTCTAGG + Intergenic
1112563852 13:100535690-100535712 AACCATGCAAACACGGCTCTTGG + Intronic
1112692768 13:101916183-101916205 GTCCCTGCAGGCTGGGCTCTGGG - Intronic
1113179557 13:107609498-107609520 GACCAGGCTCACAAGGCTCTTGG - Intronic
1113820458 13:113209293-113209315 GACCCTGCCCCCAGGGCTCCGGG - Intronic
1113866844 13:113532099-113532121 TGCTCTGCACACAGTGCTCTAGG + Intronic
1113891060 13:113735858-113735880 GAGCCTGCACAGAGGGACCTGGG - Exonic
1115521094 14:34233709-34233731 GCCCCAGCACACAGGTCACTAGG + Intronic
1115536714 14:34379927-34379949 CACTCTGCTCACAGGGCCCTTGG - Intronic
1117164084 14:53016604-53016626 GACCCTGCAGGCAGAGATCTAGG - Intergenic
1119165930 14:72492715-72492737 GACCCTGCTCTCAGGCCTCCAGG + Intronic
1119703558 14:76770646-76770668 GACCCAGGACACACAGCTCTGGG - Intronic
1119720304 14:76885492-76885514 CACCCAGCCCAGAGGGCTCTGGG - Intergenic
1121155044 14:91675258-91675280 GACCCTGCAGCTGGGGCTCTGGG + Intronic
1121465914 14:94115561-94115583 GTCACTGGGCACAGGGCTCTGGG - Intronic
1121632755 14:95432959-95432981 GACGGTGCACACAGGGCCCTCGG + Intronic
1121868217 14:97382395-97382417 GACCCAGCACACAGGCCACATGG - Intergenic
1122741301 14:103872854-103872876 CCCACTGCACACAGGGCCCTGGG - Intergenic
1122880364 14:104688079-104688101 GGCCCTCCACACCGGGCTCCAGG - Intergenic
1124592346 15:31064405-31064427 GAACCTGCAGGCATGGCTCTGGG + Intronic
1124988049 15:34642315-34642337 GACACTGCTCCCAGCGCTCTGGG - Intergenic
1128114032 15:65094399-65094421 GGCCCTGCACACCGGGCTCCTGG + Intronic
1128632764 15:69282380-69282402 GACCCTGTATCCTGGGCTCTGGG - Intergenic
1129066360 15:72907828-72907850 GGCCCTGCTCACAGAGCTCTGGG + Intergenic
1129118869 15:73382808-73382830 GACCCCCAACACAGGGCACTTGG + Intergenic
1129360972 15:75023855-75023877 AACCCTCCACTCAGGGCTCGGGG - Intronic
1129698174 15:77752481-77752503 CAGCCTCCCCACAGGGCTCTGGG + Intronic
1130062274 15:80578550-80578572 GAAGCTGCAGACAGGGCTCAGGG + Intronic
1131050220 15:89342901-89342923 GACCCTGCTCTCAGGAGTCTAGG + Intergenic
1131553764 15:93379481-93379503 CACCCTGCACCCCTGGCTCTAGG - Intergenic
1132516445 16:368273-368295 GACCCTGAACACCAGGCTCTGGG + Intronic
1132725471 16:1336488-1336510 GAGCCTGCACCCAGGGCTCGGGG + Intronic
1132753802 16:1472053-1472075 GACCATCCGCACAGGGCACTGGG + Intronic
1134531441 16:14987535-14987557 GACCCTGCACTCAGTGCTAAGGG + Intronic
1136930141 16:34411005-34411027 GACCCTCCTCACAGGATTCTAGG - Intergenic
1136974433 16:35000800-35000822 GACCCTCCTCACAGGATTCTAGG + Intergenic
1136994694 16:35181665-35181687 GAGCCAGCTCCCAGGGCTCTGGG + Intergenic
1137469335 16:48740606-48740628 GACCCTGCTTCCCGGGCTCTAGG + Intergenic
1137701552 16:50501491-50501513 CTGCCTGCACACAGGGCTCATGG - Intergenic
1138938419 16:61759483-61759505 GACTCTAGACACATGGCTCTTGG - Intronic
1139574680 16:67833487-67833509 GCCCCTGCCCCCAGGGCTCCAGG - Intronic
1139630623 16:68230011-68230033 GACCCTGCATGCAGGGCTGGGGG - Exonic
1139998831 16:71006710-71006732 CACCCTGCACTCAGCCCTCTAGG + Intronic
1140225269 16:73071654-73071676 GAACCAGCAGGCAGGGCTCTGGG + Intergenic
1140636794 16:76924495-76924517 GGCCCTGCTCCCAGGGCTTTTGG + Intergenic
1141480469 16:84303084-84303106 GGCCCTTAACACTGGGCTCTGGG - Intronic
1141826846 16:86486579-86486601 GACCGAGCACACAGTGCTGTTGG - Intergenic
1141909357 16:87047986-87048008 GGCCCTGCACACAGGCCCCTGGG + Intergenic
1142009171 16:87705048-87705070 CACCCTGCAGTCAGGGGTCTGGG + Intronic
1142217631 16:88837639-88837661 GTCCCTGTACACAGGGATGTTGG + Exonic
1142428293 16:90012208-90012230 GTACCTGCTCTCAGGGCTCTGGG - Intronic
1143021033 17:3917307-3917329 GGCCCTGAACACAGGGGTTTGGG + Intergenic
1143152609 17:4816771-4816793 GACCCTGCTCTCAGCTCTCTGGG - Intronic
1143774084 17:9186404-9186426 GAAGCTGGACCCAGGGCTCTGGG + Intronic
1144795993 17:17891606-17891628 CACCCTGCAGACAGGCCTCGGGG + Intronic
1145246298 17:21272043-21272065 CACCCAGCACACTGGGCTGTGGG - Intergenic
1145361725 17:22217543-22217565 GCCCCTGCACTCAAGCCTCTGGG + Intergenic
1148238113 17:45982947-45982969 GACCCTGCGGAGAGGCCTCTGGG + Intronic
1148872624 17:50667780-50667802 GTCCCTGCCTCCAGGGCTCTGGG + Intronic
1152702898 17:81828276-81828298 GACCCTGCACACATAGCCCCAGG + Intronic
1152755580 17:82085681-82085703 GACCCTGCCCCCAGCGCCCTGGG - Exonic
1157825309 18:50806842-50806864 GACCCATCACCCAGGTCTCTTGG - Exonic
1160323600 18:77919325-77919347 GGCCCTGGGCACAGGGCTCTGGG - Intergenic
1161459243 19:4386747-4386769 GATCCTGCACACTGGGATTTGGG - Intronic
1161668211 19:5589788-5589810 GACCCTCCACCCAGGACTCAGGG - Intronic
1161794189 19:6376934-6376956 AACCCCGCAAACAGGGCTCCTGG - Intronic
1162946322 19:14046156-14046178 TCACCTGCACACAGGGCCCTGGG - Exonic
1163604551 19:18266861-18266883 GACCCTGCACACAGGGCTCTGGG + Exonic
1164840479 19:31389168-31389190 GACCTTGCACACAGGGGCCCCGG - Intergenic
1165092513 19:33394452-33394474 GGCCTTGCACACAGCTCTCTTGG + Intronic
1165849293 19:38840171-38840193 GACCATGAGCACAGGGCTGTCGG + Exonic
1167348222 19:48960064-48960086 AAGCCTGCACACAGGGCTTGTGG + Intronic
1168450880 19:56465789-56465811 GACCCTGCACACAGGCCTCTTGG - Intronic
926608869 2:14925126-14925148 GGCCCAGCACACCAGGCTCTGGG - Intergenic
926776249 2:16425967-16425989 GGCCCTGCTCCCAGGGCCCTGGG + Intergenic
928180447 2:29064955-29064977 GGCCCAGCACACAGAACTCTGGG + Exonic
929760827 2:44805096-44805118 GCCCCTGCCCAGAGAGCTCTGGG + Intergenic
930063587 2:47310806-47310828 CACCCTGCACTCACAGCTCTAGG - Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
932891500 2:75600887-75600909 AGCCATGCACACAGGGTTCTTGG + Intergenic
936066600 2:109337302-109337324 CACCCTGCACCCAGGGCTCCCGG - Intronic
939733493 2:145814558-145814580 TACCCTGCTCTCAGGTCTCTTGG - Intergenic
941323636 2:164086068-164086090 GAGCCTGCACACAGTTCTTTTGG - Intergenic
943379152 2:187121138-187121160 GATCCTTCACACAGAGCTATGGG - Intergenic
944210132 2:197198416-197198438 TAGTCTGCACAAAGGGCTCTGGG + Intronic
948177121 2:235952833-235952855 GACCCTGAACAGAAGGCCCTGGG - Intronic
948515184 2:238499073-238499095 GCCCCTTCCCACTGGGCTCTGGG + Intergenic
948978754 2:241481672-241481694 GACCCTGCACAGAGGTTACTAGG - Intronic
948982893 2:241503864-241503886 GACCCAGCACACAGGTGTCCAGG - Intronic
949066479 2:241993790-241993812 GACCCTGCCTGCTGGGCTCTTGG + Intergenic
1170852611 20:20018141-20018163 GAAACTGCATCCAGGGCTCTGGG - Intronic
1172096494 20:32463155-32463177 GCCCCAGCACACAGGCCTCACGG + Intronic
1172230003 20:33330202-33330224 GACCCAGACCACAGGGCTCTTGG + Intergenic
1174145669 20:48450874-48450896 GACCCTCCACACTGGGAGCTGGG - Intergenic
1174452721 20:50629713-50629735 CACCCTGCTCACGGGGCTGTCGG - Intronic
1175966795 20:62663996-62664018 GTCCCTGCACACGAGGCCCTGGG - Intronic
1176521170 21:7825678-7825700 CACTCAGGACACAGGGCTCTGGG + Exonic
1177250803 21:18587926-18587948 TATCCTGCTCACAGGGATCTAGG + Intergenic
1178655190 21:34455690-34455712 CACTCAGGACACAGGGCTCTGGG + Intergenic
1179354166 21:40642963-40642985 GAGCCTGGACTCAGGGCTCTGGG + Intronic
1179824752 21:43957622-43957644 CCCCCTGCACACAGGGATCTCGG + Intronic
1179891607 21:44338619-44338641 GACCCAGCCCACAGGGCACCCGG + Intronic
1180708062 22:17821761-17821783 GACTCTGCACACAGAGCTTCAGG + Intronic
1180973755 22:19832654-19832676 GGCCCTGCACACAGAGCCCAGGG + Intronic
1181103062 22:20554433-20554455 GGCCCTGCACACAGGGGCCCAGG + Intronic
1181293998 22:21820224-21820246 GACCCTGTAAATAGGGCACTTGG + Intronic
1183397410 22:37579939-37579961 GACCCTGAGCACAGGCCTCCAGG - Exonic
1183951303 22:41354572-41354594 GACCCTGCACTCGAGGCTCCTGG + Intronic
1184516770 22:44966962-44966984 CAACCTGCACACAGGGGACTTGG - Intronic
949712951 3:6892746-6892768 GGCCCAGCACAGAGGGCTGTTGG - Intronic
949876008 3:8626510-8626532 CACCCAGCCCACATGGCTCTAGG + Intronic
950190902 3:10975412-10975434 GAGACTGCACAAAGGGCTCTAGG + Intergenic
950514350 3:13454487-13454509 GACTCTCCACACGGGGATCTGGG - Intergenic
950707033 3:14789229-14789251 GACCCTGCACTGAGGGCTGTCGG + Intergenic
950707712 3:14793266-14793288 GACCCTGGAAACAGTGCACTAGG - Intergenic
952884600 3:38004486-38004508 GCCTCTGTACACAGGGCTGTGGG + Intronic
954800606 3:53184993-53185015 GACCCTGGACACAGGGCAGTGGG + Intronic
955348671 3:58178879-58178901 GAGGCTGCCCACAGGGCCCTGGG - Intergenic
961349976 3:126293640-126293662 GACCCTGCAGAAAGTGCTCATGG + Intergenic
961391949 3:126557591-126557613 GACACTGAACACAGGCCACTGGG + Intronic
961463741 3:127069018-127069040 GACATTGCACGCAGGGCTCCAGG - Intergenic
963253069 3:143119970-143119992 GACCCCGAACACACAGCTCTAGG - Exonic
965926918 3:173992361-173992383 GAAGCTGCACACAGGACTCTAGG + Intronic
968483991 4:849996-850018 CACGCTGCACACAGTGCTGTGGG - Exonic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
969045184 4:4331478-4331500 GGCCAGGCACACAGGGCTCTGGG - Intergenic
969462473 4:7336039-7336061 GCCCCTGCACACAGCGCTTATGG - Intronic
969867562 4:10085593-10085615 GAGCCTGCACACAAGTCTCTTGG - Intronic
971757837 4:30723383-30723405 GACCATCCCCACAGGGCTGTTGG - Exonic
972688021 4:41369724-41369746 GTCCTTGGCCACAGGGCTCTGGG - Intronic
975964812 4:79959595-79959617 GACCCTGCTCACTGAGCTGTGGG + Intronic
977641148 4:99359754-99359776 GGCCCTGCACTCAGAGCACTTGG + Intergenic
982748337 4:159129782-159129804 GACCCTGAAAAGAGGGTTCTTGG + Intronic
982754611 4:159203455-159203477 GAGCATGTACACAGGGCACTGGG + Intronic
985636058 5:1036450-1036472 CCCCCTGCACTCAGGGCTGTGGG - Intronic
986099053 5:4588517-4588539 GACCCTCTACTTAGGGCTCTAGG - Intergenic
992138667 5:73773222-73773244 GCCCCTGCACAGAGGGCCCTTGG - Intronic
995516601 5:112960433-112960455 GCCCCTGCACAGATGGATCTAGG - Intergenic
997199997 5:132004132-132004154 GATCCCGCACATGGGGCTCTGGG - Intronic
998519165 5:142784102-142784124 GACCTTGCACACTGAGCTCTGGG - Intronic
1001573530 5:172746825-172746847 GTCCCAGCACCCAGGGCTGTGGG + Intergenic
1006738951 6:36293888-36293910 TCCCCTGCACACAGAGCCCTGGG + Intronic
1016534925 6:145099305-145099327 GGCCCTACAGATAGGGCTCTAGG + Intergenic
1017196210 6:151703363-151703385 GCCCTTGCAGACAAGGCTCTGGG - Intronic
1017916706 6:158836862-158836884 GATCCTCCACACAGGACTCTGGG - Intergenic
1018834343 6:167471793-167471815 GGCTCTGCCCACAGTGCTCTGGG + Intergenic
1019140775 6:169940906-169940928 GACCCTGCAAACCAGGCTCCAGG + Intergenic
1019433858 7:1011931-1011953 GGCCAGGCACGCAGGGCTCTGGG + Intronic
1019577161 7:1743144-1743166 GACCCTGCAGACGGGGCTGGAGG - Intronic
1020040603 7:4997975-4997997 GACCAGGCTCACAAGGCTCTTGG - Intronic
1020076656 7:5263026-5263048 GGCCCGGCGCACAGGGGTCTGGG - Intergenic
1021658182 7:22892545-22892567 GACCTTGGCCACAGGGCTGTTGG - Intergenic
1022954498 7:35368541-35368563 GACCCTGCGCACAGGCCTCTGGG - Intergenic
1023992922 7:45140439-45140461 GACCCTGCTCATAGGGCTGCTGG - Intergenic
1024426561 7:49232751-49232773 GCCCCTGCTCACAATGCTCTGGG + Intergenic
1025095422 7:56092235-56092257 GACCCTGTCCACAGGGGTCTTGG - Intronic
1026190682 7:68123419-68123441 GACCTTGCACACATCTCTCTAGG - Intergenic
1026242386 7:68587876-68587898 GCCCTTGCACACATAGCTCTAGG + Intergenic
1026456149 7:70574318-70574340 GTCCCTGCAGAGAGAGCTCTGGG + Intronic
1026808845 7:73445195-73445217 GACACTGGACACAGAGGTCTAGG + Intronic
1029694769 7:102205412-102205434 AGCCCTGAACACAAGGCTCTGGG - Intronic
1030490984 7:110234279-110234301 CACCCTGCACCCAGAGATCTTGG + Intergenic
1030977072 7:116139888-116139910 GACCAGGCACTCAGGGCACTTGG + Intronic
1033666333 7:143444154-143444176 GTGCCTGCACACTGGGCTCTCGG - Exonic
1034242442 7:149620865-149620887 GGCCCTGCACACAGGGCGAAGGG + Intergenic
1034550628 7:151818481-151818503 GGCTCTGGACACAGGGTTCTGGG - Intronic
1035038929 7:155913647-155913669 GCCCATGTTCACAGGGCTCTGGG + Intergenic
1035062309 7:156078647-156078669 GACCCTGCCCACAGGTCAGTGGG - Intergenic
1035205821 7:157293180-157293202 AAAAGTGCACACAGGGCTCTGGG + Intergenic
1035565523 8:638254-638276 GACCTTGCTTACAGGGCTTTGGG + Intronic
1035572653 8:683299-683321 GACCCAGCAGACAGGGCTTCAGG + Intronic
1035659113 8:1333529-1333551 AACCCTGCACACAGGACTCACGG - Intergenic
1038024074 8:23573611-23573633 GACCATGCACACAGTGCCTTGGG + Exonic
1038035377 8:23682538-23682560 GTCCCTGCACCCCGAGCTCTGGG + Intronic
1039903904 8:41772605-41772627 TACCCTGCACCCAGACCTCTTGG + Intronic
1046235916 8:111423984-111424006 GAGCCCCCACACAGGGTTCTGGG + Intergenic
1049023037 8:139970795-139970817 GATCCTGGACAAAGGGCACTGGG - Intronic
1049278808 8:141733543-141733565 GGCCCTGCACTCAGGCCTCGAGG - Intergenic
1053279233 9:36806667-36806689 GACCGTGCACCTTGGGCTCTCGG + Intergenic
1053294455 9:36902916-36902938 GAGGCTGCACTTAGGGCTCTGGG - Intronic
1056656304 9:88512189-88512211 GACCCTCCACAAATTGCTCTTGG - Intergenic
1060933850 9:127504887-127504909 GTTCCTGCACACAAGGCGCTTGG + Intergenic
1061188964 9:129070803-129070825 GACCTTCACCACAGGGCTCTAGG - Exonic
1061512107 9:131067757-131067779 AGCCCTGCACCCATGGCTCTGGG - Intronic
1061587347 9:131577570-131577592 CGCTCTGCACACAGGGCCCTTGG - Exonic
1061621183 9:131812337-131812359 GACACAGCACACAGAGCCCTTGG + Intergenic
1061881234 9:133570263-133570285 GACCCTACACACAGGGCCCACGG - Intronic
1062155431 9:135045671-135045693 GTCCCTGCACACATGTCGCTTGG - Intergenic
1062349740 9:136133030-136133052 GACCCTGCGCACTGGGCCTTCGG - Intergenic
1062525263 9:136975708-136975730 GACCCAGGACACGTGGCTCTGGG - Intergenic
1186580540 X:10813091-10813113 GAGCCTTCACTCAGGTCTCTTGG + Intronic
1188560500 X:31462669-31462691 GACCCTGAGAACAGGGGTCTAGG - Intronic
1189808167 X:44755599-44755621 AGCACAGCACACAGGGCTCTGGG - Intergenic
1192207917 X:69108325-69108347 GCCCCTGCACACAGGATCCTGGG + Intergenic
1195235949 X:102898382-102898404 GTCCCTACACACAGGTCTCTTGG - Intergenic
1195236716 X:102906493-102906515 GGCCCTACACCCAGGTCTCTTGG - Intergenic
1195301625 X:103535771-103535793 GGCCCTACACCCAGGTCTCTTGG + Intergenic