ID: 1163607073

View in Genome Browser
Species Human (GRCh38)
Location 19:18281382-18281404
Sequence CCCGGGCCGCTTGTTCCCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163607073_1163607083 19 Left 1163607073 19:18281382-18281404 CCCCGGGGAACAAGCGGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1163607083 19:18281424-18281446 TGCCACTGGCGCCGCCGCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 255
1163607073_1163607080 5 Left 1163607073 19:18281382-18281404 CCCCGGGGAACAAGCGGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1163607080 19:18281410-18281432 GAAGCTGCCGCCGCTGCCACTGG 0: 1
1: 0
2: 1
3: 23
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163607073 Original CRISPR CCCGGGCCGCTTGTTCCCCG GGG (reversed) Exonic