ID: 1163607142

View in Genome Browser
Species Human (GRCh38)
Location 19:18281578-18281600
Sequence CCGGGCGCTGCGGCCGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 700
Summary {0: 1, 1: 0, 2: 7, 3: 107, 4: 585}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163607142_1163607148 -6 Left 1163607142 19:18281578-18281600 CCGGCCGCGGCCGCAGCGCCCGG 0: 1
1: 0
2: 7
3: 107
4: 585
Right 1163607148 19:18281595-18281617 GCCCGGCCCTCCACTGGCGGCGG 0: 1
1: 0
2: 1
3: 14
4: 158
1163607142_1163607147 -9 Left 1163607142 19:18281578-18281600 CCGGCCGCGGCCGCAGCGCCCGG 0: 1
1: 0
2: 7
3: 107
4: 585
Right 1163607147 19:18281592-18281614 AGCGCCCGGCCCTCCACTGGCGG 0: 1
1: 0
2: 1
3: 17
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163607142 Original CRISPR CCGGGCGCTGCGGCCGCGGC CGG (reversed) Exonic