ID: 1163607150

View in Genome Browser
Species Human (GRCh38)
Location 19:18281597-18281619
Sequence AGCCGCCGCCAGTGGAGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163607150_1163607157 16 Left 1163607150 19:18281597-18281619 CCGGCCCTCCACTGGCGGCGGCT 0: 1
1: 0
2: 2
3: 11
4: 143
Right 1163607157 19:18281636-18281658 TGTGCGCCCTCTTATAGCCTCGG 0: 1
1: 0
2: 1
3: 4
4: 57
1163607150_1163607158 21 Left 1163607150 19:18281597-18281619 CCGGCCCTCCACTGGCGGCGGCT 0: 1
1: 0
2: 2
3: 11
4: 143
Right 1163607158 19:18281641-18281663 GCCCTCTTATAGCCTCGGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163607150 Original CRISPR AGCCGCCGCCAGTGGAGGGC CGG (reversed) Exonic
900101270 1:963095-963117 TCCCGCCGCCTGGGGAGGGCAGG - Exonic
901081075 1:6584580-6584602 AGCTGCTGCCAGTGGAATGCTGG + Intronic
901913164 1:12477473-12477495 AGAGGACGCCACTGGAGGGCTGG - Intronic
904251866 1:29230848-29230870 AGCCCCCGCCACTGCCGGGCGGG + Exonic
904900920 1:33856389-33856411 AGCAGGAGCCAGTGGAGGCCAGG - Intronic
907355983 1:53874209-53874231 AGCTACCCCCAGTGGAAGGCTGG + Intronic
911601266 1:99850270-99850292 AGCCGCAGCCCAAGGAGGGCCGG - Intronic
911623958 1:100099514-100099536 AGCCACCACCAGTGGATGCCGGG + Intronic
911637020 1:100247333-100247355 AGACACCTCCAGTTGAGGGCAGG + Intronic
913561365 1:120023733-120023755 AGGGGCCGCCAGTGAATGGCAGG - Intronic
913636762 1:120769869-120769891 AGGGGCCGCCAGTGAATGGCAGG + Intergenic
914790796 1:150876267-150876289 AGCGGCAGCCAGTGCGGGGCTGG - Intronic
914937667 1:151994333-151994355 GGCCTGCGCCAGTGGAGGGGCGG + Exonic
921263709 1:213405351-213405373 AGCCGCTGCCATTGGAGAGAAGG + Intergenic
922422971 1:225471762-225471784 AGGCGGCGGCAGTGCAGGGCGGG - Intergenic
922502982 1:226110421-226110443 AGCCGCCTCGAGTGCGGGGCGGG + Intergenic
922504323 1:226117893-226117915 AGCCAAGGCCAGAGGAGGGCAGG + Intergenic
923163410 1:231337382-231337404 CGCCGCCGCCTCTGGAGGGGAGG - Exonic
923535916 1:234851739-234851761 AGCCACCGTCACTGCAGGGCAGG + Intergenic
924146233 1:241077697-241077719 AGCAGCCACCAGTGGAGGAGAGG - Intronic
1064218053 10:13417064-13417086 AGCTGCCTACAGTGGAGGGCTGG - Intergenic
1067084427 10:43230333-43230355 AGCCGCAGCGAGGGGTGGGCTGG + Intronic
1068101982 10:52566713-52566735 AGTTGCAGCCAGTGGAGTGCTGG - Intergenic
1075738874 10:124681278-124681300 AGACGGCTCCAGTGAAGGGCCGG + Intronic
1076646137 10:131956098-131956120 AGCCGCCTCCGCTGGAGGCCCGG + Exonic
1077404797 11:2378070-2378092 AGCCGCCGCCCCTGGATGGTGGG + Intronic
1081613823 11:44578992-44579014 AGCCGCTGCCAGCTGAGGTCAGG + Intronic
1089652587 11:119924034-119924056 AGTCTCAGCCAGTGGAGGGCAGG + Intergenic
1089737665 11:120561224-120561246 AGCGGCAGCCAGGGGAGGGTGGG + Intronic
1090976077 11:131682094-131682116 AGCCACTGCCCGTGGAGGGCGGG - Intronic
1091233085 11:134000957-134000979 AGGCGCTGCCAGAAGAGGGCTGG - Intergenic
1092067063 12:5599446-5599468 ACCTGCCCCCAGTGGAAGGCAGG + Intronic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1096154917 12:49336497-49336519 AGCCGCCGCAAGAGGGTGGCGGG - Exonic
1096554663 12:52395937-52395959 AGCAGCCGCCACCAGAGGGCTGG + Intronic
1102101619 12:110282159-110282181 AGCCGGCCCCGGTGGAGGGAGGG + Intronic
1105787361 13:23762691-23762713 AGCCGCCTCCTGTGCTGGGCAGG + Intronic
1107022800 13:35768334-35768356 AGCAGCAGCCTGTGGATGGCAGG + Intergenic
1112556968 13:100477960-100477982 AGCGGCCGTCAGCGCAGGGCTGG - Intronic
1113590327 13:111494375-111494397 GGGTGCCGCCAGTGGATGGCAGG + Intergenic
1122162310 14:99793353-99793375 AGCAGCCGCCACAGCAGGGCCGG + Exonic
1122272197 14:100573299-100573321 AGGGGCCGCCAGAGGAGGGGCGG + Intronic
1122889110 14:104724451-104724473 AGCCGCTGCCAGGTGCGGGCTGG + Intronic
1124576540 15:30913963-30913985 AGACGCCGCTTGTGGAGGTCAGG + Exonic
1131225816 15:90623725-90623747 ACACGACGCCAGTGGAAGGCTGG - Intronic
1131664034 15:94550644-94550666 AGCTGTGGCCAATGGAGGGCTGG + Intergenic
1132144124 15:99416799-99416821 AGCAACTGCCAGGGGAGGGCTGG - Intergenic
1132558563 16:583384-583406 AGCAGCCCCAGGTGGAGGGCTGG + Exonic
1132942792 16:2516495-2516517 AGCAGAGGCCACTGGAGGGCAGG - Intronic
1136283623 16:29228864-29228886 AGCCTCCTCCGGTGGGGGGCTGG + Intergenic
1136428879 16:30185859-30185881 AGCAGGCTCCAGGGGAGGGCAGG - Intronic
1136930073 16:34410593-34410615 AGCTGCCTGCAGTAGAGGGCTGG + Intergenic
1136974501 16:35001212-35001234 AGCTGCCTGCAGTAGAGGGCTGG - Intergenic
1138265318 16:55656107-55656129 AGGCGCCGCCGGTCGGGGGCCGG + Intronic
1138572614 16:57885195-57885217 AGCAGCCCCCAGAGGAGGCCAGG + Intronic
1139583452 16:67886291-67886313 AACCACCGCCAGAGCAGGGCTGG - Exonic
1142088656 16:88198375-88198397 AGCCTCCTCCGGTGGGGGGCTGG + Intergenic
1142192936 16:88726182-88726204 GGCCCCGGCCCGTGGAGGGCAGG - Intronic
1142286833 16:89174938-89174960 AGACGTGGCCAGTGGAGGGAGGG - Intronic
1142699231 17:1649381-1649403 AGCCCCGGCCAGGGCAGGGCGGG - Intronic
1142764167 17:2056443-2056465 AGCGGCCGCCGGTGGAGGGGAGG - Intronic
1143618420 17:8067337-8067359 AGCGGGCGCCAGTGGAGGGAGGG + Intergenic
1144265924 17:13569511-13569533 AGCAGTCTCCGGTGGAGGGCTGG - Intronic
1145069068 17:19787852-19787874 AGCTGCTGCCAGGGGAGGGGCGG - Intronic
1147907719 17:43833441-43833463 ACCCTCCGCGAGTGGAGGGGTGG + Intergenic
1149635876 17:58168818-58168840 GGCCGCCCACAGTGGAGGGCAGG + Intergenic
1154001298 18:10484347-10484369 ATCCACAGCCAGTGGAGCGCTGG + Intronic
1159971976 18:74666281-74666303 GGCAGCAGCCAGTGGAGGGGAGG + Intronic
1160189797 18:76706553-76706575 AGGAGCCCCCACTGGAGGGCGGG - Intergenic
1160611925 18:80095622-80095644 ACCGGACGCCAGCGGAGGGCAGG + Exonic
1161084691 19:2329278-2329300 ATCCGACCCCAGTGCAGGGCTGG - Intronic
1161217581 19:3102166-3102188 ATCCGCTTCCAGTGGAGGGGTGG + Intronic
1161280817 19:3444599-3444621 AGCGGCAGCCAGGGCAGGGCAGG - Intronic
1161438746 19:4279138-4279160 AGCCGCTGCCCGCGGAGGGAAGG - Exonic
1161500243 19:4610442-4610464 TGACACCGCCAGAGGAGGGCAGG + Intergenic
1161801284 19:6417929-6417951 CTCCCCCGCCAGTGGAGGGAGGG - Intronic
1162398313 19:10430681-10430703 AGCCGCCCCCAGGGCGGGGCGGG - Intronic
1163607150 19:18281597-18281619 AGCCGCCGCCAGTGGAGGGCCGG - Exonic
1164678278 19:30117598-30117620 TGCTGCTGCGAGTGGAGGGCCGG + Intergenic
1167636443 19:50658674-50658696 TGCAGTCGCCAGTGGAGGGTCGG + Intronic
1168094705 19:54107961-54107983 AGCCGGCGCCAGTGCAGGTAAGG - Intronic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
924987058 2:281614-281636 AGCAGCAGCCAGCGGAGGGGAGG + Intronic
925990359 2:9249763-9249785 TGCCACCCCCAGAGGAGGGCAGG + Intronic
929119793 2:38475222-38475244 AGAGGCCACCAGAGGAGGGCAGG + Intergenic
929188791 2:39120994-39121016 CGCCGCCGCCGGTGTAGCGCTGG + Exonic
930335969 2:50046276-50046298 AGCAAGCGGCAGTGGAGGGCAGG - Intronic
932073592 2:68643888-68643910 GGCCGCAGCCAGTGCAGCGCGGG - Intronic
934649623 2:96083514-96083536 AGCTGTCCCCAGTGGAGGGGTGG - Intergenic
940192004 2:151050997-151051019 AGCAGCAGCCAATGGTGGGCAGG - Intergenic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1170150359 20:13221286-13221308 AGCGGCCGCCAGAGAAGCGCGGG - Intergenic
1172098031 20:32470126-32470148 AGCCAGCGCCAGGGGAGAGCAGG - Intronic
1172197578 20:33102549-33102571 AGCCTGCTCCACTGGAGGGCTGG + Intronic
1172758891 20:37308189-37308211 AGCTGTGGCCAGTGGAGGGGAGG + Intronic
1174317495 20:49713849-49713871 AGCCGCCGGCCGTCGCGGGCCGG + Exonic
1176587723 21:8605058-8605080 AGCCAGGGCCAGTGCAGGGCAGG + Intergenic
1180064337 21:45405132-45405154 AGCCGCCGCCGCTGGGAGGCCGG - Intronic
1180270553 22:10582057-10582079 AGCCAGGGCCAGTGCAGGGCAGG + Intergenic
1181052913 22:20246166-20246188 AGCCACAGTCAGGGGAGGGCTGG + Intronic
1181430853 22:22880883-22880905 GGCCCCCGCCTGTGGTGGGCAGG + Intronic
1183050688 22:35258006-35258028 GGCCGCGGCCACGGGAGGGCTGG + Intronic
1184748995 22:46473459-46473481 AGACGCAGCCAGTGCCGGGCAGG + Intronic
1185233962 22:49700287-49700309 AGCAGGCCCGAGTGGAGGGCTGG - Intergenic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
954669475 3:52281047-52281069 AGCCGGCTCCAGTGGATGGGTGG + Intronic
961551916 3:127674264-127674286 AGCCTCCCCCAGGTGAGGGCAGG - Intronic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968845984 4:3041794-3041816 AGCCGCAGCCAGCGCCGGGCCGG - Intergenic
968935773 4:3609613-3609635 AGCAGCCCCCAGGGTAGGGCTGG - Intergenic
969484469 4:7464425-7464447 AGCCGCAGCCTGTGGAGGGCTGG + Intronic
982360290 4:154512221-154512243 AGCAGCCGTCCCTGGAGGGCTGG + Intergenic
985145210 4:186889240-186889262 AGCCACAGGCAGCGGAGGGCAGG - Intergenic
990308584 5:54517718-54517740 AGCCGCCGCCGGTCGGGGGCGGG - Intergenic
998539852 5:142970469-142970491 AGCCGCCAGAAGTGGATGGCTGG - Intronic
1002260805 5:177992837-177992859 AGGCGCCTCCTGTGGAGGGCTGG + Exonic
1006391447 6:33761346-33761368 AGCCTCCCCCAGGGGAGGCCAGG + Intergenic
1008159234 6:48057151-48057173 AACCGCCGCCAGAAGAGGGAGGG - Intronic
1011643037 6:89433112-89433134 AGCCGCCGGCAGGGGTGGGGCGG + Intergenic
1013073285 6:106748607-106748629 AGCCGCCACCAGGGGAGGGCAGG - Intergenic
1015999676 6:139029574-139029596 CGCCGGCACCAGTGCAGGGCTGG - Intronic
1018170291 6:161139004-161139026 AGGCGCCCCCAGAGGAAGGCAGG + Intronic
1019265521 7:115365-115387 AGCTGTGGCCAGTGGAGGGGGGG - Intergenic
1019474748 7:1238718-1238740 GGCCGCCCCCAGTGGAAGCCAGG + Intergenic
1019883113 7:3880771-3880793 AGCCGCAGCCTCTGGAGGCCCGG - Intronic
1020022815 7:4879151-4879173 ACCCGCGGCCTGTGGTGGGCGGG - Intronic
1021998149 7:26200835-26200857 ATCCGCCGCCAATGGCGGGAAGG + Intronic
1023684387 7:42719644-42719666 AGCCAGCGCCAGGGGAAGGCAGG - Intergenic
1024013784 7:45293277-45293299 AGCTGGCCCCAGTGGAGGGTGGG + Intergenic
1029907137 7:104103406-104103428 AGCCGGCACCAGGGGAAGGCCGG + Intergenic
1032356909 7:131219746-131219768 AGACACAGCCAGTGGAGGGAGGG - Intronic
1032669990 7:134073947-134073969 AGACTCTGCCTGTGGAGGGCAGG - Intergenic
1032794115 7:135263799-135263821 ATCCGGTGCCAGTGGAGGGTGGG + Intergenic
1033374059 7:140740446-140740468 AGCCTCCGCCAGAGGAGAGAAGG + Intronic
1034879520 7:154752719-154752741 AGCGGCCGCCACTGTAGGTCAGG - Intronic
1035638339 8:1163642-1163664 GGCGGCCGCCTGGGGAGGGCCGG + Intergenic
1040850786 8:51898903-51898925 CGCCGCCGCCAGTGGGGGCTCGG - Intronic
1044569442 8:93700700-93700722 GGCCGCCCACACTGGAGGGCTGG + Intronic
1044690042 8:94868483-94868505 AGCCTCAGTAAGTGGAGGGCAGG - Intronic
1049257454 8:141621492-141621514 AGCCGCTGCCCGTGGAGAGCTGG + Intergenic
1054454412 9:65422265-65422287 AGCAGCCCCCAGGGTAGGGCTGG + Intergenic
1056932800 9:90892784-90892806 AGAGGCCCCCACTGGAGGGCTGG - Intronic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1057906491 9:98987412-98987434 AGCCGCAGCCTGGGGAGGGCTGG + Intronic
1060526526 9:124324112-124324134 AGCCGCCAGCAGGGGAGGCCTGG + Intronic
1061059795 9:128244698-128244720 CACCGCCGCCACTGGAGAGCTGG - Intronic
1062322929 9:135999137-135999159 AGCTGCCCACAGTGGAGGGGTGG - Intergenic
1062363356 9:136197773-136197795 AGGGGCCGCAGGTGGAGGGCAGG - Intronic
1062624916 9:137438354-137438376 AGCCTCTGCCTCTGGAGGGCGGG - Intronic
1062674439 9:137732166-137732188 CGCCGACACCAGCGGAGGGCAGG + Intronic
1189010765 X:37043699-37043721 AGCGGCGGCTGGTGGAGGGCGGG + Intergenic
1190320534 X:49177004-49177026 AGCCGCCGCAGCTGGAGTGCCGG - Exonic
1195697356 X:107676866-107676888 TGCGGCCGCCAGACGAGGGCGGG - Intergenic
1197495567 X:127174570-127174592 GGCCCCCACCAGCGGAGGGCAGG - Intergenic
1198910452 X:141607390-141607412 AGCCACCCCAAGTGGAGGGAAGG + Intronic
1199948207 X:152683870-152683892 AGCCAGGGCCAGTGGAGGGTGGG + Intergenic
1199961472 X:152784584-152784606 AGCCAGGGCCAGTGGAGGGTGGG - Intergenic