ID: 1163607289

View in Genome Browser
Species Human (GRCh38)
Location 19:18282023-18282045
Sequence CCCCTCCAGTCCCCGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163607289_1163607297 -6 Left 1163607289 19:18282023-18282045 CCGGCCTCCGGGGACTGGAGGGG No data
Right 1163607297 19:18282040-18282062 GAGGGGGATGGGGTCCCGCATGG No data
1163607289_1163607300 10 Left 1163607289 19:18282023-18282045 CCGGCCTCCGGGGACTGGAGGGG No data
Right 1163607300 19:18282056-18282078 CGCATGGCTAAATAACTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163607289 Original CRISPR CCCCTCCAGTCCCCGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr