ID: 1163609641

View in Genome Browser
Species Human (GRCh38)
Location 19:18294262-18294284
Sequence GAGCAGTCACAGGCTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163609641_1163609649 26 Left 1163609641 19:18294262-18294284 CCAGGTGGAGCCTGTGACTGCTC No data
Right 1163609649 19:18294311-18294333 TGCATGCTCCAGAAGCAGCAGGG No data
1163609641_1163609651 30 Left 1163609641 19:18294262-18294284 CCAGGTGGAGCCTGTGACTGCTC No data
Right 1163609651 19:18294315-18294337 TGCTCCAGAAGCAGCAGGGGAGG No data
1163609641_1163609648 25 Left 1163609641 19:18294262-18294284 CCAGGTGGAGCCTGTGACTGCTC No data
Right 1163609648 19:18294310-18294332 ATGCATGCTCCAGAAGCAGCAGG No data
1163609641_1163609650 27 Left 1163609641 19:18294262-18294284 CCAGGTGGAGCCTGTGACTGCTC No data
Right 1163609650 19:18294312-18294334 GCATGCTCCAGAAGCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163609641 Original CRISPR GAGCAGTCACAGGCTCCACC TGG (reversed) Intergenic
No off target data available for this crispr