ID: 1163609735

View in Genome Browser
Species Human (GRCh38)
Location 19:18294667-18294689
Sequence GCCTCCTCACAGGGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163609735_1163609748 7 Left 1163609735 19:18294667-18294689 CCCCCTGCCCCCTGTGAGGAGGC No data
Right 1163609748 19:18294697-18294719 ACGGTGGTGGCTGCAGTGACGGG No data
1163609735_1163609749 8 Left 1163609735 19:18294667-18294689 CCCCCTGCCCCCTGTGAGGAGGC No data
Right 1163609749 19:18294698-18294720 CGGTGGTGGCTGCAGTGACGGGG No data
1163609735_1163609750 30 Left 1163609735 19:18294667-18294689 CCCCCTGCCCCCTGTGAGGAGGC No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609735_1163609746 -6 Left 1163609735 19:18294667-18294689 CCCCCTGCCCCCTGTGAGGAGGC No data
Right 1163609746 19:18294684-18294706 GGAGGCGGCTGTGACGGTGGTGG No data
1163609735_1163609745 -9 Left 1163609735 19:18294667-18294689 CCCCCTGCCCCCTGTGAGGAGGC No data
Right 1163609745 19:18294681-18294703 TGAGGAGGCGGCTGTGACGGTGG No data
1163609735_1163609747 6 Left 1163609735 19:18294667-18294689 CCCCCTGCCCCCTGTGAGGAGGC No data
Right 1163609747 19:18294696-18294718 GACGGTGGTGGCTGCAGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163609735 Original CRISPR GCCTCCTCACAGGGGGCAGG GGG (reversed) Intergenic