ID: 1163609740

View in Genome Browser
Species Human (GRCh38)
Location 19:18294674-18294696
Sequence CACAGCCGCCTCCTCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163609740_1163609748 0 Left 1163609740 19:18294674-18294696 CCCCCTGTGAGGAGGCGGCTGTG No data
Right 1163609748 19:18294697-18294719 ACGGTGGTGGCTGCAGTGACGGG No data
1163609740_1163609752 28 Left 1163609740 19:18294674-18294696 CCCCCTGTGAGGAGGCGGCTGTG No data
Right 1163609752 19:18294725-18294747 GCCCAGAGAAGCATCCGGCAGGG No data
1163609740_1163609749 1 Left 1163609740 19:18294674-18294696 CCCCCTGTGAGGAGGCGGCTGTG No data
Right 1163609749 19:18294698-18294720 CGGTGGTGGCTGCAGTGACGGGG No data
1163609740_1163609747 -1 Left 1163609740 19:18294674-18294696 CCCCCTGTGAGGAGGCGGCTGTG No data
Right 1163609747 19:18294696-18294718 GACGGTGGTGGCTGCAGTGACGG No data
1163609740_1163609750 23 Left 1163609740 19:18294674-18294696 CCCCCTGTGAGGAGGCGGCTGTG No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609740_1163609751 27 Left 1163609740 19:18294674-18294696 CCCCCTGTGAGGAGGCGGCTGTG No data
Right 1163609751 19:18294724-18294746 TGCCCAGAGAAGCATCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163609740 Original CRISPR CACAGCCGCCTCCTCACAGG GGG (reversed) Intergenic