ID: 1163609742

View in Genome Browser
Species Human (GRCh38)
Location 19:18294676-18294698
Sequence GTCACAGCCGCCTCCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163609742_1163609751 25 Left 1163609742 19:18294676-18294698 CCCTGTGAGGAGGCGGCTGTGAC No data
Right 1163609751 19:18294724-18294746 TGCCCAGAGAAGCATCCGGCAGG No data
1163609742_1163609750 21 Left 1163609742 19:18294676-18294698 CCCTGTGAGGAGGCGGCTGTGAC No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609742_1163609752 26 Left 1163609742 19:18294676-18294698 CCCTGTGAGGAGGCGGCTGTGAC No data
Right 1163609752 19:18294725-18294747 GCCCAGAGAAGCATCCGGCAGGG No data
1163609742_1163609747 -3 Left 1163609742 19:18294676-18294698 CCCTGTGAGGAGGCGGCTGTGAC No data
Right 1163609747 19:18294696-18294718 GACGGTGGTGGCTGCAGTGACGG No data
1163609742_1163609748 -2 Left 1163609742 19:18294676-18294698 CCCTGTGAGGAGGCGGCTGTGAC No data
Right 1163609748 19:18294697-18294719 ACGGTGGTGGCTGCAGTGACGGG No data
1163609742_1163609749 -1 Left 1163609742 19:18294676-18294698 CCCTGTGAGGAGGCGGCTGTGAC No data
Right 1163609749 19:18294698-18294720 CGGTGGTGGCTGCAGTGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163609742 Original CRISPR GTCACAGCCGCCTCCTCACA GGG (reversed) Intergenic