ID: 1163609750

View in Genome Browser
Species Human (GRCh38)
Location 19:18294720-18294742
Sequence GATGTGCCCAGAGAAGCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163609735_1163609750 30 Left 1163609735 19:18294667-18294689 CCCCCTGCCCCCTGTGAGGAGGC No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609740_1163609750 23 Left 1163609740 19:18294674-18294696 CCCCCTGTGAGGAGGCGGCTGTG No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609743_1163609750 20 Left 1163609743 19:18294677-18294699 CCTGTGAGGAGGCGGCTGTGACG No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609742_1163609750 21 Left 1163609742 19:18294676-18294698 CCCTGTGAGGAGGCGGCTGTGAC No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609739_1163609750 27 Left 1163609739 19:18294670-18294692 CCTGCCCCCTGTGAGGAGGCGGC No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609737_1163609750 28 Left 1163609737 19:18294669-18294691 CCCTGCCCCCTGTGAGGAGGCGG No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609736_1163609750 29 Left 1163609736 19:18294668-18294690 CCCCTGCCCCCTGTGAGGAGGCG No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data
1163609741_1163609750 22 Left 1163609741 19:18294675-18294697 CCCCTGTGAGGAGGCGGCTGTGA No data
Right 1163609750 19:18294720-18294742 GATGTGCCCAGAGAAGCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163609750 Original CRISPR GATGTGCCCAGAGAAGCATC CGG Intergenic