ID: 1163609752

View in Genome Browser
Species Human (GRCh38)
Location 19:18294725-18294747
Sequence GCCCAGAGAAGCATCCGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163609742_1163609752 26 Left 1163609742 19:18294676-18294698 CCCTGTGAGGAGGCGGCTGTGAC No data
Right 1163609752 19:18294725-18294747 GCCCAGAGAAGCATCCGGCAGGG No data
1163609741_1163609752 27 Left 1163609741 19:18294675-18294697 CCCCTGTGAGGAGGCGGCTGTGA No data
Right 1163609752 19:18294725-18294747 GCCCAGAGAAGCATCCGGCAGGG No data
1163609740_1163609752 28 Left 1163609740 19:18294674-18294696 CCCCCTGTGAGGAGGCGGCTGTG No data
Right 1163609752 19:18294725-18294747 GCCCAGAGAAGCATCCGGCAGGG No data
1163609743_1163609752 25 Left 1163609743 19:18294677-18294699 CCTGTGAGGAGGCGGCTGTGACG No data
Right 1163609752 19:18294725-18294747 GCCCAGAGAAGCATCCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163609752 Original CRISPR GCCCAGAGAAGCATCCGGCA GGG Intergenic