ID: 1163612037

View in Genome Browser
Species Human (GRCh38)
Location 19:18306650-18306672
Sequence ACGTCTCCACAGAGGGGAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 177}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163612030_1163612037 -10 Left 1163612030 19:18306637-18306659 CCCCTTGGCATTAACGTCTCCAC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612022_1163612037 17 Left 1163612022 19:18306610-18306632 CCTGCCTGGGACTTCCCTCCCCA 0: 1
1: 0
2: 5
3: 47
4: 546
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612028_1163612037 -2 Left 1163612028 19:18306629-18306651 CCCACACACCCCTTGGCATTAAC 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612023_1163612037 13 Left 1163612023 19:18306614-18306636 CCTGGGACTTCCCTCCCCACACA 0: 1
1: 0
2: 2
3: 40
4: 378
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612020_1163612037 19 Left 1163612020 19:18306608-18306630 CCCCTGCCTGGGACTTCCCTCCC 0: 1
1: 1
2: 8
3: 91
4: 786
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612027_1163612037 -1 Left 1163612027 19:18306628-18306650 CCCCACACACCCCTTGGCATTAA 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612021_1163612037 18 Left 1163612021 19:18306609-18306631 CCCTGCCTGGGACTTCCCTCCCC 0: 1
1: 1
2: 3
3: 81
4: 723
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612026_1163612037 2 Left 1163612026 19:18306625-18306647 CCTCCCCACACACCCCTTGGCAT 0: 1
1: 0
2: 6
3: 44
4: 409
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612019_1163612037 29 Left 1163612019 19:18306598-18306620 CCATGCGTGGCCCCTGCCTGGGA 0: 1
1: 0
2: 5
3: 32
4: 376
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612025_1163612037 3 Left 1163612025 19:18306624-18306646 CCCTCCCCACACACCCCTTGGCA 0: 1
1: 0
2: 3
3: 62
4: 547
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1163612029_1163612037 -3 Left 1163612029 19:18306630-18306652 CCACACACCCCTTGGCATTAACG 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163612037 Original CRISPR ACGTCTCCACAGAGGGGAGA GGG Exonic
900761777 1:4477363-4477385 AGACCCCCACAGAGGGGAGAAGG - Intergenic
900931857 1:5742928-5742950 ACATCTCTCAAGAGGGGAGAGGG - Intergenic
901473559 1:9473886-9473908 AGGCATTCACAGAGGGGAGACGG - Intergenic
902474640 1:16675528-16675550 ACGTTTCCAGGGAGGGGAGGGGG - Intergenic
902484221 1:16732216-16732238 ACGTTTCCAGGGAGGGGAGGGGG + Intergenic
902691518 1:18112755-18112777 TCATCTGCACAGATGGGAGAGGG + Intronic
904826510 1:33276799-33276821 TCGTGTCCACTGGGGGGAGAAGG - Intronic
909264530 1:73539530-73539552 CCAACTCCAGAGAGGGGAGAGGG + Intergenic
912619496 1:111140506-111140528 CAGTCTCCACAGAGGGGCAAGGG - Intronic
912619504 1:111140531-111140553 ATGTCTCCACAGAGGGGCAAGGG - Intronic
918912549 1:190592313-190592335 AAGTCTCCACAGAGGTAAGGAGG - Intergenic
922568237 1:226616081-226616103 GCTTCTGCACAGAGGGGAGAGGG + Intergenic
922773174 1:228200567-228200589 ACCTCCCCACAGAAGGGATAGGG + Intergenic
923784741 1:237055876-237055898 AGGTCCACACAGAGGGAAGATGG + Intronic
1063643090 10:7851228-7851250 AAGACTTCAAAGAGGGGAGAGGG + Intronic
1066703771 10:38156723-38156745 AGGCCTCCACGGAGGAGAGAAGG + Intergenic
1067183015 10:44004882-44004904 ACGTCTCCACAGTCAGGGGAGGG + Intergenic
1070605883 10:77898361-77898383 ACCTCTCCACAGAGGGGAGCTGG + Intronic
1070746410 10:78936447-78936469 GCTTCTGCAGAGAGGGGAGAAGG + Intergenic
1071298971 10:84242396-84242418 ATGTCTCCACATAAGGGACAAGG + Intergenic
1074339505 10:112613480-112613502 AGCTCTACAGAGAGGGGAGAAGG - Intronic
1076314218 10:129529316-129529338 ACTTTTCCACAGATGGGAGTGGG + Intronic
1076782199 10:132730497-132730519 ACCTCTCCACAGAGCTGAGTGGG - Intronic
1077675601 11:4191137-4191159 AAGTGCCCACAGAGGGGAGAGGG - Intergenic
1078472606 11:11603743-11603765 AGGTCTCCCAAGAGGGGAAAAGG + Intronic
1078885856 11:15499201-15499223 ATGTTTCCTCAGAGGGGACAAGG - Intergenic
1079860248 11:25660958-25660980 ACGGTTCCACATAGTGGAGAAGG + Intergenic
1081098436 11:38969909-38969931 AGGTCCCCACTGAGGGCAGAGGG + Intergenic
1083731617 11:64655403-64655425 GCGGCTGCACAGAGGGGACAGGG + Intronic
1084064203 11:66693999-66694021 AAGTCTCCCTATAGGGGAGATGG + Intronic
1084215665 11:67645649-67645671 ACAGCTCCCCAGAGGGGAGTGGG - Intronic
1084693306 11:70739330-70739352 ACCTCCCCACAGAAGGGAGGAGG + Intronic
1085654940 11:78305454-78305476 AGAGCTCCACAGAGGGGAGGTGG + Intronic
1086553465 11:88081612-88081634 ACAGCGACACAGAGGGGAGAAGG - Intergenic
1087661509 11:100994141-100994163 AGGTATCCACCGAGGGGAGAGGG + Intergenic
1090908336 11:131096659-131096681 ACATCTCTTCTGAGGGGAGAAGG + Intergenic
1091582324 12:1797303-1797325 ACGGCTCCACAGCCGGGAGGAGG - Intronic
1091594263 12:1865123-1865145 ACCTGGCCACGGAGGGGAGAAGG + Intronic
1091696199 12:2629965-2629987 ACATCTCCAGAGTGGGGAGTTGG + Intronic
1098557729 12:71838479-71838501 CCGTCTTCACACAGTGGAGAGGG - Intergenic
1104386645 12:128356758-128356780 AGGTCTCCAGAGCGGGCAGAAGG - Intronic
1104616727 12:130276651-130276673 ACACCTCCCCAGAGGGGAGGAGG + Intergenic
1107133251 13:36919344-36919366 AGCTCTCCGCAGAGGGGAGGGGG - Intronic
1107830558 13:44371298-44371320 AGACCTCCACAGAGAGGAGAGGG - Intergenic
1109577193 13:64274925-64274947 AGGTCTCCACAGTGGAGAGGGGG - Intergenic
1111356266 13:87107487-87107509 ATATGACCACAGAGGGGAGAAGG - Intergenic
1113383974 13:109830409-109830431 GCCTCTCAAAAGAGGGGAGAAGG + Intergenic
1122126320 14:99580456-99580478 ACGTCCCCAGTGAGGGGAGGGGG + Intronic
1128094683 15:64944726-64944748 TCGTTTCTACAGATGGGAGAAGG + Exonic
1128280949 15:66393845-66393867 ACATTTCAACAGAGGGGTGAAGG - Intronic
1129888020 15:79052238-79052260 GTGTCTCCAGAGAGGGGAGTAGG - Intronic
1131110393 15:89761150-89761172 ACGTGTCCAGAGAGGGCAAACGG - Intronic
1131232140 15:90667067-90667089 AGCTCTGCACAGCGGGGAGAGGG - Intergenic
1131999588 15:98165245-98165267 ACGCCTTCACCCAGGGGAGAGGG - Intergenic
1132940144 16:2502312-2502334 TGGTCACCACGGAGGGGAGAAGG + Exonic
1134803205 16:17104414-17104436 ACCATTCCACAGAGGGGGGATGG - Exonic
1137753829 16:50886113-50886135 AAGTCTCCCCACAGGGGAAAGGG + Intergenic
1138774605 16:59706401-59706423 ATGTCTCCAGAGAGGGGATCAGG - Intergenic
1138864438 16:60799152-60799174 ACGTTTCCTCAGATGGCAGAAGG - Intergenic
1139684629 16:68593401-68593423 TTGTCTCCAGAGAGGGCAGAAGG + Intergenic
1139876261 16:70148540-70148562 ACATCCCCATAGAGGTGAGAGGG + Exonic
1140035660 16:71369461-71369483 AGGGCTCCACAGAGGGATGACGG + Intronic
1140359527 16:74332558-74332580 ACATCCCCATAGAGGTGAGAGGG - Intergenic
1140675777 16:77327858-77327880 ACGTCAGCACACTGGGGAGAAGG + Intronic
1141445430 16:84055001-84055023 ACGTCTCTATCCAGGGGAGAAGG + Intronic
1141784218 16:86187721-86187743 TGGGCTCCACAGATGGGAGAAGG + Intergenic
1142553317 17:753875-753897 CCAGCACCACAGAGGGGAGAGGG + Intronic
1142893445 17:2959797-2959819 ATTTCTTCACTGAGGGGAGAAGG + Intronic
1143181965 17:4988934-4988956 AAGTCTCCACAGACTGAAGAAGG - Exonic
1144711314 17:17403462-17403484 AGGTCTGGACAGAGGGGAGGAGG + Intergenic
1145989280 17:29069134-29069156 ACGTCTTCACAGAGTTGTGATGG + Intergenic
1147320619 17:39643654-39643676 GAGACTCCACAGAGGGTAGAAGG - Intronic
1148680998 17:49473399-49473421 ACGTGCCCACACAGGGGAGTTGG + Intronic
1148700005 17:49581567-49581589 ACATCTCCACTCAGGAGAGACGG - Intronic
1148868635 17:50642574-50642596 ACCTCCCCACAGCGGGGAGAAGG - Intronic
1150123532 17:62622113-62622135 TGTTCTCCACAGAAGGGAGAAGG + Intergenic
1151074536 17:71255927-71255949 ACAACTCCACAAATGGGAGAAGG + Intergenic
1152022814 17:77789906-77789928 ACATCTCCAAGGAAGGGAGATGG - Intergenic
1152908253 17:82982128-82982150 CCATCACCACAGAGGTGAGAAGG - Intronic
1152908265 17:82982176-82982198 CCATCACCACAGAGGTGAGAAGG - Intronic
1155399510 18:25422563-25422585 AGGTCTCAACAGGAGGGAGAGGG - Intergenic
1155417848 18:25619814-25619836 ACGACACCACACAGGGAAGAGGG + Intergenic
1156553599 18:38043438-38043460 ATGTCTGCTCAAAGGGGAGAGGG + Intergenic
1157775647 18:50393898-50393920 CCACCTCCAGAGAGGGGAGAGGG + Exonic
1160140483 18:76317391-76317413 ATGTCTCCACAGAGAGTAGGTGG - Intergenic
1160803452 19:980706-980728 ACGTCCCCAGGGAGGGGAGGAGG + Intergenic
1161026481 19:2039585-2039607 ACCTATGTACAGAGGGGAGATGG + Exonic
1163608315 19:18287893-18287915 ACGACCCCACAGCGGGGAGGTGG + Intergenic
1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG + Exonic
1163771744 19:19195288-19195310 GCGTCTCGAGAGTGGGGAGAGGG - Intronic
1165421177 19:35722704-35722726 ACCTCGCCACAGAGGGTAGGTGG + Exonic
1167934751 19:52897111-52897133 AGCACTCCACAGAGGGGAGTGGG - Intronic
1202707960 1_KI270713v1_random:37611-37633 ACGTTTCCAGGGAGGGGAGGGGG - Intergenic
925162780 2:1697721-1697743 ACGTCTCCCCAGGGGGCTGAGGG + Intronic
925702104 2:6648898-6648920 ACAGCTTCACCGAGGGGAGAGGG + Intergenic
931201933 2:60106039-60106061 AGGACTCCACAGAGAGCAGAGGG - Intergenic
931254069 2:60555017-60555039 ACGTCTGCAGAAAGGCGAGAGGG - Intergenic
933811651 2:86036449-86036471 ATGACTCCACAGCTGGGAGAAGG + Intronic
934056370 2:88254459-88254481 AAGCCTCCACAGTGGGCAGAGGG + Intergenic
934857897 2:97740099-97740121 TCATCTCCACACAGGGGAGCTGG - Intergenic
938744867 2:134267915-134267937 ATGTCTCCACAGAGGGGCAGTGG + Intronic
942695755 2:178642736-178642758 TCTTCTCCACTGAGGGAAGAAGG + Intronic
942883938 2:180899425-180899447 AGCACTCAACAGAGGGGAGAAGG - Intergenic
945946801 2:216002680-216002702 AGGTCTCAATAGAGGGAAGAAGG - Intronic
948274049 2:236694808-236694830 ATGTCCCCACAGAGGGCTGAGGG - Intergenic
1169017707 20:2305195-2305217 CCACGTCCACAGAGGGGAGAGGG - Intronic
1169698476 20:8418896-8418918 CTGCCTACACAGAGGGGAGAGGG + Intronic
1170316424 20:15046006-15046028 AGGACGCCACAGAGAGGAGAAGG - Intronic
1173717585 20:45222880-45222902 ACGTCTCAACAGTGGAGAAAAGG + Exonic
1178995521 21:37395675-37395697 AGGTTTCCAAAGATGGGAGAGGG - Intronic
1180801139 22:18632490-18632512 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1180852369 22:19028049-19028071 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1181089526 22:20463175-20463197 AGGTATCCACAGAGTGGAGGTGG - Intronic
1181220581 22:21362771-21362793 AGGGCTCCACAGAGGGTGGAAGG - Intergenic
1181570121 22:23763882-23763904 AAGTCACCACACATGGGAGATGG + Intronic
1181968502 22:26672944-26672966 TCGGCTCCAGAGAGGGGAGACGG - Intergenic
1184422810 22:44391651-44391673 AAATCCCCACAGAGGGCAGAGGG - Intergenic
1184937688 22:47736946-47736968 GCCTCACCAGAGAGGGGAGAAGG + Intergenic
1185032267 22:48450335-48450357 AGGACTCCACAGGGTGGAGAGGG + Intergenic
1185149718 22:49157196-49157218 CCGTCTCCACAGCTGGAAGAAGG - Intergenic
1185162372 22:49237750-49237772 ACCTCTCCATAGAGGGCAGGAGG - Intergenic
953463638 3:43101418-43101440 ACTACTCCACAGCGGGGATAGGG + Intronic
956376281 3:68616716-68616738 AACTCTACACAAAGGGGAGATGG + Intergenic
957062942 3:75496886-75496908 GAGTCTCCATAGAGGGGAGAGGG + Intergenic
958880565 3:99664645-99664667 AGGTCTCCACACAGGGAAGTGGG - Intronic
962955782 3:140265398-140265420 ACCTCTCAGCAGAGGAGAGAAGG + Intronic
963799160 3:149659118-149659140 GCCTCTCCACTGAGGGGAAAGGG + Intronic
965768676 3:172158012-172158034 ATGTGTCCACACAGGGTAGAAGG - Intronic
967592298 3:191292886-191292908 TCGTCTCAATAGAGGGGAAAAGG - Intronic
968312060 3:197692113-197692135 TCGCCTCCAGGGAGGGGAGAGGG + Intronic
968636757 4:1684749-1684771 ACGGCTACACAGCGGGCAGACGG - Intergenic
971498413 4:27292414-27292436 ATGTCTCCTCTGAGGGAAGATGG + Intergenic
973726808 4:53785227-53785249 GCGACTCCACAGAGGAGAGAAGG - Intronic
974844862 4:67340060-67340082 ATGTCCCCACAGATGGAAGAAGG + Intergenic
976409329 4:84695087-84695109 ACTTCTCCACAGTGTGGAGAAGG - Intronic
978232133 4:106412446-106412468 CCTTCTCCAGAGAGGGGAGAGGG - Intergenic
978472739 4:109088282-109088304 ATGTCTCCACAGTGAGGAGCAGG + Intronic
978807472 4:112815649-112815671 ACACCTCCATAGAGGGGAGGGGG + Intergenic
988786716 5:34571868-34571890 ACGTAGACACACAGGGGAGAAGG - Intergenic
996290277 5:121844534-121844556 ACATATACACAGAGGAGAGAAGG - Intergenic
998167378 5:139851949-139851971 ACATCACCCCAGAGTGGAGAAGG - Intronic
999229433 5:150052896-150052918 CCCTCTCCACAGAGGGGATGTGG + Intronic
999776742 5:154817991-154818013 ACTTTTCCACAGGGGGGTGAAGG + Intergenic
1001688529 5:173614789-173614811 ACGTATCCCCTGAGGGGGGAGGG - Intronic
1002133672 5:177095883-177095905 ACCCTTCCCCAGAGGGGAGAGGG + Intronic
1006010706 6:31040695-31040717 ACTTCCTCACAGAGGGGAGGAGG + Intergenic
1006030330 6:31172866-31172888 AAGTCTACACAGACAGGAGATGG - Intronic
1008059814 6:46985215-46985237 ACTTCTCCACAGGTGGGAGAAGG - Intergenic
1008071484 6:47103188-47103210 AGGTCTCCACAGAGAGAAGCGGG + Intergenic
1010456733 6:76064525-76064547 AGGTCTCCCCAGTGAGGAGAGGG - Intronic
1010487460 6:76432619-76432641 ACATCTCAACAGAGGAGACAAGG - Intergenic
1016509659 6:144827329-144827351 AGGACTGCAAAGAGGGGAGAGGG - Exonic
1016556414 6:145343231-145343253 ACATCCCAACAGAGAGGAGAGGG + Intergenic
1016559395 6:145378444-145378466 ACTTCCTCACAGAGGGCAGATGG + Intergenic
1017427020 6:154332665-154332687 AAGTCTGCACAGATGGGACAGGG - Intronic
1017453786 6:154579125-154579147 ACGTCACCACATAGGAGAGTAGG + Intergenic
1018857493 6:167685073-167685095 AAGTCACCACAGAGAGGAGGAGG - Intergenic
1019450958 7:1097705-1097727 AGGTCACCACACAGTGGAGACGG + Intronic
1019460466 7:1155887-1155909 ACACCTCCACAGGGAGGAGATGG + Intronic
1022647104 7:32241821-32241843 CTGTATCCACAGAGAGGAGATGG + Intronic
1023888120 7:44375163-44375185 GGGTCCCCTCAGAGGGGAGAGGG - Intergenic
1024912642 7:54463587-54463609 AGGAATCCACAGAGGGCAGAAGG + Intergenic
1029375442 7:100174460-100174482 ATGGGTCCACAGAGGGGAGGAGG + Intronic
1029503074 7:100945844-100945866 ACGCCTGCCCAGAAGGGAGAGGG - Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035587782 8:788984-789006 ACTTCCCCACAGAAGAGAGACGG - Intergenic
1036504748 8:9345097-9345119 AGGTCTCCCCAGTGGGCAGAAGG + Intergenic
1038421088 8:27434411-27434433 ACTTCTCCACAGGGGGCAGGAGG + Intronic
1042320361 8:67469032-67469054 AAGTCTTCATAGAGGAGAGAAGG - Intronic
1043149646 8:76698824-76698846 ATGTCACGACAAAGGGGAGAAGG - Intronic
1045438313 8:102186202-102186224 ACCTCTCACCAGAGGGGAGTGGG + Intergenic
1046319757 8:112557519-112557541 ACATCTCCGTGGAGGGGAGAAGG + Intronic
1049397494 8:142408092-142408114 ATGTGTCCACAGAGGGGAGTGGG - Intergenic
1049639921 8:143710917-143710939 ACGCCTCGACAGAGGAGAGCAGG - Intronic
1051677248 9:19570953-19570975 AGGTCTCCACAAAGGGGAACAGG - Intronic
1054804169 9:69381978-69382000 ACGTGTCCAGAGAGAGGAGAGGG - Intronic
1055394631 9:75861032-75861054 ACATGTCCACAGAGAGAAGAGGG - Intergenic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1060374300 9:123105007-123105029 ACGTCTCAACAGGTGGGTGAGGG - Intergenic
1060739664 9:126090026-126090048 AAGTCACCACAGAGGTGCGATGG + Intergenic
1061079710 9:128362511-128362533 AGTTCTCCACAGTGGGAAGAAGG + Intergenic
1061096086 9:128457275-128457297 ACGTCCTCTCTGAGGGGAGAAGG - Exonic
1061527189 9:131175752-131175774 CTCTCTCCACAAAGGGGAGAGGG - Intronic
1061947183 9:133914866-133914888 ACAGCTCCACAAAGTGGAGAGGG + Intronic
1062207231 9:135343901-135343923 CCGGCTCCACAGAGGGGAGGGGG + Intronic
1062422264 9:136488495-136488517 ACGGCTGCTCAGAGGGGAGAAGG - Intergenic
1062563547 9:137152547-137152569 AGGTCCCCACAGAGAGGGGAGGG + Intronic
1189516496 X:41718026-41718048 AACCCTCCAGAGAGGGGAGAGGG + Intronic
1189998927 X:46665924-46665946 ACATGACCACAGAGTGGAGAAGG + Intronic
1190163299 X:48049844-48049866 TCCTCCCCACAGAAGGGAGATGG + Intronic
1196187508 X:112760400-112760422 AAGTCCCCACAGTGGGCAGAAGG - Intergenic
1198842741 X:140876468-140876490 TCATCTCCAGGGAGGGGAGAGGG + Intergenic
1200100457 X:153687395-153687417 GTGTCTCCACAGTGGGCAGAGGG - Intronic
1201312651 Y:12610886-12610908 AGGTCTCCACAGTGGAGAGGGGG + Intergenic