ID: 1163612815

View in Genome Browser
Species Human (GRCh38)
Location 19:18309909-18309931
Sequence CCTCCCGCGCTCCCAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163612815 Original CRISPR CCTCCCGCGCTCCCAGGGCT GGG (reversed) Intronic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900203284 1:1420663-1420685 CCTGCCGCCCACCCAGCGCTGGG + Intronic
900349966 1:2229745-2229767 CCTCCCCAGCTCCCAGGCCTGGG - Intronic
900512853 1:3068586-3068608 CCTCCAGCGATCGCAGGGCGGGG + Intergenic
900795248 1:4703889-4703911 CTCCCCGAGCTCCCTGGGCTAGG + Intronic
900911076 1:5597396-5597418 CTTCCAGGGCTCCCCGGGCTGGG - Intergenic
901321401 1:8342431-8342453 CCTCCCACTCTCCCAGGCCTAGG + Intronic
901373259 1:8818045-8818067 CCCCCCGCGCCCCCCGGGCTGGG + Intergenic
903026117 1:20430847-20430869 CCTCTCAGGCCCCCAGGGCTAGG - Intergenic
903788305 1:25875573-25875595 CCGCCCGCCCTCCCCCGGCTTGG - Intergenic
903788462 1:25876200-25876222 CTTCAGGTGCTCCCAGGGCTGGG - Intergenic
904401036 1:30256915-30256937 CCTCCCCTGTGCCCAGGGCTTGG + Intergenic
904598311 1:31660454-31660476 GCCCCCGTGCTCCCACGGCTGGG + Intronic
905208057 1:36354223-36354245 CCTCCAGGAATCCCAGGGCTCGG - Intronic
906033030 1:42735326-42735348 CTTCCAGTGCGCCCAGGGCTGGG - Intronic
906129646 1:43448409-43448431 CCTCCAGCTCTGCCAGGGCCAGG - Exonic
907241583 1:53084108-53084130 CTTCCCCAGCTCCCAGGGCCCGG + Intronic
907288511 1:53397421-53397443 CCTCCCCCACTCCCAGGCATTGG + Intergenic
908605501 1:65793101-65793123 CCTTCCGCGCTCCCGGGGGTGGG - Intronic
909863194 1:80634121-80634143 CCTCCCTCTCTGCCGGGGCTGGG + Intergenic
912804466 1:112744264-112744286 CCTCTCTCGCTCCCAGGGCCTGG + Intergenic
913550761 1:119915373-119915395 CCTCCAGCACCCCCAGGGGTAGG + Exonic
914689162 1:150010448-150010470 CCTCGCGGGCTCCCGGGGCAAGG + Exonic
915345544 1:155195176-155195198 CCTCCCGCCCGCCCGGGGCCCGG - Intergenic
915565919 1:156712613-156712635 CCTCCCCAGCTCCCAGGGCAGGG + Intergenic
917512142 1:175677485-175677507 CATCACTCCCTCCCAGGGCTGGG + Intronic
917749067 1:178038012-178038034 CCTTCCGCTCTCCCGGGGCTGGG - Intergenic
919443851 1:197676196-197676218 CCTACCTAGCTCCCAGGGCTTGG + Intronic
920345132 1:205301511-205301533 ACTCCCAGGCTCCGAGGGCTGGG - Intergenic
920382509 1:205543594-205543616 CCGCATGCGCTCCCAGAGCTGGG - Intergenic
1062760261 10:12088-12110 CCACCCTGGCTCCCTGGGCTAGG + Intergenic
1062960170 10:1567453-1567475 CCTCCCACTCTCCCAGGCCAGGG + Intronic
1063373093 10:5534286-5534308 CCCACTGCGCTCCCAGGGCAGGG + Intergenic
1064278725 10:13931522-13931544 CCTTCCTGACTCCCAGGGCTAGG + Intronic
1064607767 10:17061643-17061665 CCTCCCTCCTTCCCAGGGCAGGG - Intronic
1065844939 10:29736365-29736387 GCCCCCCCGGTCCCAGGGCTGGG + Intronic
1066465033 10:35642895-35642917 CCCCTCGCGCGCCCAAGGCTGGG - Intergenic
1068108485 10:52650452-52650474 CCTCCACCCCTCCCAGGCCTAGG - Intergenic
1069865732 10:71501777-71501799 CCTCCCACTCTCCCTGGGATGGG - Intronic
1069909221 10:71749648-71749670 CCTCCTGCTCTGCCTGGGCTGGG - Exonic
1069978618 10:72236363-72236385 CCGTCCTCCCTCCCAGGGCTTGG + Intergenic
1070665759 10:78342317-78342339 CCTCCCTCCCTCCCAGGCCCAGG - Intergenic
1070859284 10:79637834-79637856 CCTCGGGAGCTCCCAGGTCTGGG + Intergenic
1073207481 10:101776425-101776447 CCTCGCGCGCTCCCCGGTCCCGG + Intronic
1076029793 10:127147604-127147626 CCTCCCAGTCTCCCAGGGCCTGG + Intronic
1076697574 10:132254497-132254519 TCTCCTGGGCTCCCAGGTCTGGG - Intronic
1076697599 10:132254602-132254624 TCTCCTGGGCTCCCAGGTCTGGG - Intronic
1076697624 10:132254707-132254729 TCTCCTGGGCTCCCAGGTCTGGG - Intronic
1076944971 10:133640544-133640566 CCTCCCGCGCCCCCGGGGCTGGG + Intergenic
1077506061 11:2930441-2930463 CTTCCCGGGTTCCCAGGGGTGGG + Intergenic
1080012367 11:27472104-27472126 CCGCCCGCACTCACAGCGCTTGG + Exonic
1080601847 11:33828918-33828940 CCTCGCGGGATCCCAGGGCCGGG - Intergenic
1080836268 11:35943970-35943992 CCTCCCGCCTTCCCCGGGCCCGG - Intronic
1080932461 11:36826094-36826116 CCTCCCTCTCTCCCAGAGGTTGG + Intergenic
1081861275 11:46334506-46334528 CCTTTCAAGCTCCCAGGGCTGGG - Intronic
1082862745 11:57871372-57871394 CCTCCCTCCCTCCCAGAGATGGG + Intergenic
1083271413 11:61574738-61574760 TCTCCCGCTCTGCCAGGCCTGGG - Intronic
1083272787 11:61580635-61580657 GATCCCGCGCCCCCGGGGCTGGG + Intronic
1083540936 11:63511119-63511141 CCTCCTGCTCTGTCAGGGCTGGG + Intronic
1083714290 11:64567020-64567042 GCTCCCACGCTCCCAGGGGCTGG - Intronic
1083728944 11:64642890-64642912 CCTACCCCGCTCCCGGAGCTCGG - Intronic
1083740528 11:64708632-64708654 CCTCCTGCTCTCCCAGGGTCTGG - Intronic
1083936478 11:65872472-65872494 CCTCGGGGCCTCCCAGGGCTGGG + Intronic
1084531220 11:69728954-69728976 CCACCCTCCCTCCCAGGCCTGGG - Intergenic
1084948949 11:72654206-72654228 CCTCCCCTGGTCCCAGCGCTGGG - Intronic
1085450343 11:76628533-76628555 CCTCCCACGCACCCAGGGTTTGG - Intergenic
1085561057 11:77473497-77473519 CGTCCCGGGCTGCCAGGGCTGGG - Intronic
1088823520 11:113475422-113475444 CCTCCCGCGCTCCCCGCGCTCGG - Intronic
1089176063 11:116549718-116549740 CCTCCCTCCCTCCCAGGAATGGG + Intergenic
1089729530 11:120511706-120511728 CCTCCCGCGCTCCCCGCGCCGGG + Intergenic
1090178619 11:124673815-124673837 CCTCCCGCGACCTCAGGACTGGG + Exonic
1092230121 12:6771484-6771506 CCTCCAACTCTCCCTGGGCTGGG + Intergenic
1094807816 12:34108522-34108544 CCACCCTAGCTCCCTGGGCTAGG + Intergenic
1097980097 12:65729381-65729403 CCTCCTGCGCGCCCAGACCTCGG + Intergenic
1100392814 12:94158816-94158838 CCTCCCATGTTCCCAGCGCTTGG - Intronic
1102029070 12:109729698-109729720 CCACCCCCGCTCCCTGGGCCTGG + Intronic
1102190706 12:110985839-110985861 TCTCCAGCTCTCCCATGGCTGGG + Intergenic
1102347641 12:112169862-112169884 CCTCCTGGGCCCCCAGTGCTTGG + Intronic
1102499018 12:113338523-113338545 CCTCCCTGTCTCCCAGGACTGGG + Intronic
1103205461 12:119125429-119125451 CCCCTCGCGGTCCCAGAGCTCGG + Exonic
1104971993 12:132534922-132534944 CCTGCAGCGCTCCCAGGTATGGG + Intronic
1107263081 13:38518786-38518808 CCTCCCTCGTACCCAGGGCCAGG - Intergenic
1108691946 13:52867101-52867123 CTTCCCTGGCTCCCATGGCTAGG + Intergenic
1110450944 13:75636651-75636673 CCTCCAGCCCTTCCATGGCTAGG - Intronic
1112020623 13:95368080-95368102 CCACACCCGCTCCCAGAGCTAGG + Intergenic
1112692712 13:101915979-101916001 CCTCCCGGGTTCCCAGACCTTGG - Intronic
1113885980 13:113658576-113658598 CCTCACGCCCTCCCAGGCCAGGG - Intergenic
1113892236 13:113742534-113742556 CCTCCCGCTCCCTCATGGCTCGG + Intergenic
1113936181 13:113996262-113996284 CCTCCCGCTCCCCCGGGGCAGGG + Intronic
1114031597 14:18584492-18584514 CCACCCTGGCTCCCTGGGCTAGG + Intergenic
1114479335 14:23022417-23022439 CCTCCCGTGCTCCCCAGGCGTGG - Intronic
1115218049 14:31031979-31032001 CCTCCCGCGCTCAAATAGCTGGG - Intronic
1115566598 14:34630069-34630091 CCCACCGCGCTCCCGGGACTCGG + Intronic
1116286404 14:42978218-42978240 CCTCCCCTGCTCCCAGCCCTTGG + Intergenic
1119262531 14:73245982-73246004 ACTCCTGGGCTCCCTGGGCTCGG + Intronic
1119479783 14:74952056-74952078 CCTCAGGCACTGCCAGGGCTGGG + Intronic
1121446287 14:93981197-93981219 CCTTCCTCCCTCCCAGGACTTGG - Intergenic
1121820524 14:96962181-96962203 CCTAACACCCTCCCAGGGCTGGG + Intergenic
1122297172 14:100712169-100712191 CCTCCCTCCCGCCCAGGCCTCGG - Intergenic
1124159135 15:27253304-27253326 CCTCCCAGCATCCCAGGGCTGGG - Intronic
1124652471 15:31483880-31483902 CCTGCCGCGGGCCCGGGGCTCGG + Exonic
1125506625 15:40271286-40271308 CCTCGCAGGCTTCCAGGGCTGGG + Intronic
1127841599 15:62836358-62836380 CCTCCCTGACTCCCAGGGTTTGG + Intronic
1128997245 15:72306207-72306229 CCTCCCACGCACCCAGCTCTTGG - Intronic
1130273028 15:82462235-82462257 CCACCCTGGCTCCCAAGGCTTGG + Intergenic
1130487311 15:84405214-84405236 CCACCCTGGCTCCCAAGGCTTGG - Intergenic
1130587669 15:85194201-85194223 CCACCCTGGCTCCCAAGGCTTGG + Intergenic
1131429751 15:92377347-92377369 GCTCCAGAGCTCCCGGGGCTGGG + Intergenic
1132055723 15:98649176-98649198 CCTCCCGCGCGGCCAGGGCCGGG + Exonic
1132745963 16:1436413-1436435 CCTGCCCCTCTCCCAGGGCCTGG + Intronic
1132870097 16:2112114-2112136 CCCCCCGCCCTCCCCGGGCCTGG - Intronic
1132931304 16:2460434-2460456 CGCCCCGAGCGCCCAGGGCTGGG + Intronic
1134091577 16:11394244-11394266 CCTGCCGTGCCCCCAAGGCTGGG - Intronic
1135588230 16:23687592-23687614 CAGCCCACGCTCCGAGGGCTTGG - Exonic
1136083655 16:27869092-27869114 CCTCCCGTCCTCCCAGAGCTGGG + Intronic
1136219971 16:28822818-28822840 CCTTACCCACTCCCAGGGCTAGG + Intergenic
1136408574 16:30063943-30063965 CCTGCCGAGCACCCAGGCCTGGG + Exonic
1136501113 16:30670030-30670052 CCTCATGCCCTCCGAGGGCTGGG + Exonic
1136573151 16:31108697-31108719 CTGGCCGCGCTCCCAGGGCCCGG + Intronic
1137861434 16:51850621-51850643 CCTCTGCCACTCCCAGGGCTGGG + Intergenic
1138117679 16:54373371-54373393 CCTCACAGGCTCCCAGGACTTGG + Intergenic
1138991074 16:62392040-62392062 CCTTCCGTGCTGCCAGGGGTGGG + Intergenic
1139314768 16:66058966-66058988 CCTCCAGGACACCCAGGGCTAGG + Intergenic
1140855686 16:78975796-78975818 CCTCCCACCCTCCAAGGGCCTGG - Intronic
1141431391 16:83971995-83972017 CCTCTCCCCCTCCCCGGGCTGGG - Intronic
1142002521 16:87671668-87671690 GCACCCGGGCTCCCAGTGCTGGG + Intronic
1142031159 16:87839213-87839235 CCCACTGCCCTCCCAGGGCTGGG - Intronic
1142114789 16:88351026-88351048 CCTGCCGCGCTCCCCCGGCGTGG + Intergenic
1142336117 16:89490420-89490442 CCTCGGGCGCGCCCACGGCTCGG + Exonic
1142556630 17:782617-782639 CATCCCGCGCTCCCAGCACCTGG + Exonic
1142671142 17:1487971-1487993 CCTCCAGCCCGCCCAGGGGTGGG + Intronic
1143401919 17:6651725-6651747 CCTCAGGCGCTCCCACGGCCCGG - Exonic
1144807948 17:17979892-17979914 TCTCCTGGGTTCCCAGGGCTGGG - Intronic
1144807985 17:17980022-17980044 TCTCCTGGGTTCCCAGGGCTGGG - Intronic
1145904072 17:28506863-28506885 GCTCCCCAGCTCCCAGAGCTGGG - Intronic
1147582290 17:41634253-41634275 CCTCCCACCCACCCAGGGCCTGG + Intergenic
1147595274 17:41712641-41712663 CCTCCTCACCTCCCAGGGCTGGG - Intronic
1148052602 17:44776527-44776549 CCTCCCTCCCTCGTAGGGCTGGG - Intronic
1148323631 17:46771477-46771499 GCCCCCGCGTTCCCGGGGCTGGG - Intronic
1149528887 17:57379317-57379339 CCTCCCGCCCACCCTGGGCTGGG + Intronic
1150422872 17:65055031-65055053 CCTCCCGAGCTTCCAGCGTTTGG - Intronic
1151683436 17:75633725-75633747 CCTGCAGCGCTCTCAGGTCTGGG - Intronic
1151943446 17:77306631-77306653 CCCCCTTCACTCCCAGGGCTGGG - Intronic
1151972614 17:77466572-77466594 CCTCCCGAGGACCCAGGGCCTGG - Intronic
1152229423 17:79107037-79107059 CCTCCCGCCATCCCAGTGCAAGG + Intronic
1152354777 17:79801400-79801422 CCTCCCGCGGTCCCGGAGCCGGG + Intronic
1152425588 17:80216930-80216952 CCCCCCGGGATCCCAGGGATGGG + Intronic
1152656161 17:81520055-81520077 TCTCCGGCCTTCCCAGGGCTGGG + Intronic
1152854709 17:82658213-82658235 TCTCCCGCCCTCCCAAGGCTCGG + Intronic
1152900997 17:82941122-82941144 CCTCCCGCAGTCCCTGCGCTGGG + Intronic
1152953169 18:12442-12464 CCACCCTGGCTCCCTGGGCTAGG + Intergenic
1155331824 18:24726715-24726737 TCTACCGCTCTCCCGGGGCTTGG + Intergenic
1155540358 18:26863307-26863329 CGTGCCGCGCTCCCAGATCTGGG - Intronic
1157330510 18:46700617-46700639 CCTCTCAGACTCCCAGGGCTTGG + Intronic
1160456277 18:79004159-79004181 CCTCACGTCCTCCCTGGGCTCGG + Intergenic
1160859241 19:1230749-1230771 CCGCCCATGCTCCCAAGGCTGGG - Exonic
1160910250 19:1470772-1470794 CCACCCGCACTCCCACAGCTGGG - Exonic
1161350098 19:3786448-3786470 CCTCCCGCGCGCCCCGGGCGGGG + Intronic
1162345591 19:10116300-10116322 CCTCCCGCCCTCTCTGGGGTGGG - Intronic
1162768882 19:12937423-12937445 ACTCCCGCGCTCCCAGGTCCAGG + Intergenic
1162909887 19:13842961-13842983 CCTCCCCCCCTCCCCGGGCCGGG + Intergenic
1163310994 19:16514603-16514625 CCTCCTGCGCTCCCTGGACGCGG + Exonic
1163318057 19:16555058-16555080 CCTCCCGGGCGCTCAAGGCTGGG - Intronic
1163612815 19:18309909-18309931 CCTCCCGCGCTCCCAGGGCTGGG - Intronic
1163630343 19:18415230-18415252 CCTCCCACGCACGCACGGCTGGG + Intergenic
1163698936 19:18777581-18777603 CCACCCGCCCGCCCAGGGCTGGG + Exonic
1163786412 19:19277160-19277182 CCTCCCGCGGGTGCAGGGCTGGG + Intronic
1165248683 19:34513166-34513188 CCTCTGGGCCTCCCAGGGCTGGG + Intergenic
1165256234 19:34578540-34578562 CCTCTGGGCCTCCCAGGGCTGGG + Intergenic
1165258951 19:34597012-34597034 CCTCTGGGCCTCCCAGGGCTTGG + Intronic
1165266332 19:34665789-34665811 CCTCTGGGCCTCCCAGGGCTGGG - Intronic
1165273968 19:34732880-34732902 CCTCTGGGCCTCCCAGGGCTGGG - Intergenic
1166257897 19:41619259-41619281 CCTTCCCCGTCCCCAGGGCTGGG + Exonic
1166862527 19:45818449-45818471 CCTGCCACTCCCCCAGGGCTTGG - Intronic
1167152905 19:47719780-47719802 CCTCCCGCTGTCCCAGGTCCAGG - Intronic
925317842 2:2939049-2939071 CCTCCACAGCTCCCAGGGGTGGG - Intergenic
925905091 2:8535418-8535440 TCTCCTCCGCTCCCAGGCCTGGG + Intergenic
927811687 2:26184116-26184138 TCTTCCGCCCTCCCGGGGCTCGG - Intronic
927872348 2:26631651-26631673 CTTTCCACTCTCCCAGGGCTGGG - Intronic
928303506 2:30147245-30147267 CCGCCCGCGGTCCCAGCGCCGGG - Intronic
932798163 2:74715622-74715644 CCTCCCGCGCTCTCCCGCCTGGG + Intergenic
933984226 2:87577225-87577247 CCTCCCGCACCCCCAGGGGCCGG - Intergenic
934614417 2:95762497-95762519 CCTCCCACGGACCCAGAGCTTGG + Intergenic
934646488 2:96062002-96062024 CCTCCCACGGACCCAGAGCTTGG - Intergenic
936152783 2:110030799-110030821 CCTCACACTCTCCCATGGCTGGG + Intergenic
936191897 2:110340613-110340635 CCTCACACTCTCCCATGGCTGGG - Intergenic
936309628 2:111373571-111373593 CCTCCCGCACCCCCAGGGGCCGG + Intergenic
940625946 2:156175454-156175476 TCTCCTCTGCTCCCAGGGCTTGG - Intergenic
940637807 2:156319931-156319953 GCTCCAGCGCTCGCAGGCCTAGG + Intergenic
942928056 2:181457227-181457249 CATCCCGCGCTCTGCGGGCTGGG + Exonic
947525388 2:230874083-230874105 ACTCCCTCCCTCCCAGGTCTGGG - Intronic
947640985 2:231707875-231707897 CCTCGCGCCCTCCCAGGGCAGGG - Intronic
948461567 2:238132320-238132342 CCTCCGGAGCACCCTGGGCTGGG - Exonic
948918876 2:241052243-241052265 CCTCCTGCGCCTCCAGGGCCTGG - Intronic
949032511 2:241803766-241803788 CCGCGCGCGCTCCCGGGTCTCGG - Exonic
949066653 2:241994777-241994799 CCACCTGCGTGCCCAGGGCTGGG + Intergenic
1168891249 20:1296445-1296467 CCTCCCGCCCTCCGAAGCCTAGG - Intronic
1169360778 20:4947064-4947086 CCTCCAGAGTTCCCAGGTCTGGG + Intronic
1172167735 20:32909118-32909140 CCTCCCACGCTCCGTGGGCTGGG + Intronic
1173738734 20:45380642-45380664 ACTCCTGAGCTTCCAGGGCTGGG + Intronic
1174364760 20:50049916-50049938 CCTCCCCCTCCCCCAGGTCTGGG + Intergenic
1175257422 20:57655703-57655725 ACTCCCAGACTCCCAGGGCTCGG + Intronic
1175996090 20:62812947-62812969 CCACCCTGGCTCCCAGGGGTTGG - Exonic
1176016838 20:62938218-62938240 CCTCCCGCGCTGCGCGGTCTGGG - Exonic
1176239195 20:64068059-64068081 CCTCCCCCGCTCCCTGGCTTTGG - Exonic
1176382600 21:6120730-6120752 CCACCCGGGGTCCCAGGGCGGGG - Intronic
1178620048 21:34166476-34166498 CTCCCCGCCCTGCCAGGGCTGGG - Intergenic
1179740869 21:43417509-43417531 CCACCCGGGGTCCCAGGGCGGGG + Intronic
1179887039 21:44318678-44318700 CCTCCGGTGCTCACAGTGCTGGG - Intronic
1180075416 21:45459269-45459291 CCTGCCCCTCACCCAGGGCTGGG - Intronic
1180078145 21:45473553-45473575 CTGCCCGCCCTCCCAGGCCTTGG + Intronic
1180455709 22:15511549-15511571 CCACCCTGGCTCCCTGGGCTAGG + Intergenic
1181008290 22:20025015-20025037 CCTCCTTCCCTGCCAGGGCTGGG - Intronic
1182945940 22:34322185-34322207 CCTCGGCCGCTCCCAGTGCTGGG - Intergenic
1184258508 22:43301188-43301210 CCTCCAGGGCTGCCACGGCTGGG + Intronic
1184499930 22:44865478-44865500 CCTCCCCCACTGCCAGGTCTAGG - Intergenic
1185253054 22:49815794-49815816 CCTCCCGAGCTCCCAGGCACTGG + Intronic
1185342783 22:50299169-50299191 CCTCCTGCCCTCCCAGGCCTAGG - Intronic
949405040 3:3705396-3705418 CCTCCCCCGCTCCCCTGTCTTGG - Intronic
950262983 3:11555333-11555355 CCTCCCGCTCCACCAGGGCCAGG - Exonic
950492925 3:13317072-13317094 CCTCTCGCTCACCCAGGGCTTGG + Exonic
950660932 3:14466676-14466698 CCTCCCTCCCATCCAGGGCTGGG + Intronic
951040239 3:17981602-17981624 TCTCCTGCACTCCCAGAGCTGGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
961564516 3:127754122-127754144 CCTCCCGCTCACCCAGGCCCTGG + Intronic
961870432 3:129983880-129983902 ACTCCCTCGCTCCCAGACCTGGG - Intergenic
966944126 3:184765763-184765785 CCTCCCTCGCTGCGAGGTCTTGG - Intergenic
968562304 4:1290360-1290382 CCTCCCGGGAGCCCAGGGCTGGG + Intronic
968819089 4:2836646-2836668 CTTGCCTGGCTCCCAGGGCTAGG + Exonic
968973623 4:3809954-3809976 CCTCCCGCACTCCCTGGTCCAGG - Intergenic
969051137 4:4373778-4373800 CCTCCCTCACTCCCACAGCTGGG + Intronic
969666455 4:8560213-8560235 CCTCCCTCGCTCCCATGGACAGG + Intronic
969704178 4:8783067-8783089 CCTCCCTCCCTCCCGGGGATGGG + Intergenic
971251064 4:24973932-24973954 CCTCTCGGGCTTCCCGGGCTCGG - Intronic
972290448 4:37686139-37686161 CCTTCCGCGCTCCCGGGACCGGG + Intronic
972730302 4:41788229-41788251 TCTCCCCCACTCCCAGGGCTGGG - Intergenic
978393538 4:108253031-108253053 CCCCCCCCGCCCCCAGGACTAGG - Intergenic
982202726 4:152975340-152975362 CCTCCAGGGTTCCCAGGGCATGG + Exonic
985448353 4:190041053-190041075 CCTCCCGCGCCCCCGGGGCTGGG + Intergenic
985537600 5:473655-473677 CCTCCCGCGCTGCAGGGCCTGGG - Intronic
985565307 5:612433-612455 CCTCCGGCGCACCCAGGTCGCGG - Exonic
985778307 5:1856896-1856918 ACGCCCCCGCTCCCAGGGCCGGG + Intergenic
985994874 5:3592338-3592360 CCTTCAGCGCGTCCAGGGCTGGG - Intergenic
986009346 5:3698341-3698363 CCGACCCCACTCCCAGGGCTGGG + Intergenic
987317588 5:16738296-16738318 CCACCCCTGCTCCCAGGCCTGGG - Intronic
988482145 5:31639563-31639585 CTCCCCGCCCTGCCAGGGCTGGG - Intronic
989146631 5:38257315-38257337 CCTCCCGCGCTCCCAAACATAGG + Intergenic
992529848 5:77643483-77643505 CTTCCTGGCCTCCCAGGGCTGGG + Intergenic
994175116 5:96702716-96702738 CATCCCGGGCTCCCGGGGCGGGG + Intronic
994367051 5:98928582-98928604 CCTCCCCCGCGCCCAGGCCCGGG + Exonic
995224819 5:109690198-109690220 CCTGCCGCCCTCCCCGGGGTCGG - Exonic
998288155 5:140883970-140883992 CCTCCCGCGCTGCCAGCCCCGGG - Exonic
1000210131 5:159100696-159100718 CCTCCAGCGCGCTCAGGGCGCGG - Intergenic
1001651629 5:173320096-173320118 CCTGCCGCGGCACCAGGGCTAGG + Intronic
1002055119 5:176594332-176594354 CCCCCTGCTCTCCCATGGCTGGG + Intronic
1002187181 5:177459813-177459835 CCTCTCCCGCCCCCAGGGCCTGG + Intronic
1002291811 5:178205265-178205287 GCTCGCGCGCTGCCAGGGCCAGG + Intronic
1002919368 6:1555304-1555326 CGTCCCGATCTGCCAGGGCTGGG - Intergenic
1003175931 6:3752094-3752116 CCTCGGGACCTCCCAGGGCTAGG + Intergenic
1006474211 6:34244563-34244585 CCTCCTGCCCTCCCTGGGCCTGG + Intronic
1006808625 6:36805638-36805660 CCTCCCTGGGCCCCAGGGCTGGG + Intronic
1006932783 6:37697691-37697713 CCTCCCGGGCTCCGAGCTCTCGG + Exonic
1007633247 6:43284162-43284184 CCTCCCGCTCTTCCTGGGCAAGG - Exonic
1007702461 6:43772931-43772953 CCTCCTGTGCTCCCTGGCCTTGG + Intronic
1009973301 6:70647184-70647206 CCTGACTCTCTCCCAGGGCTGGG - Intergenic
1015181643 6:130366709-130366731 TCTCTCGCGCTCCCGGGACTGGG - Intronic
1017717271 6:157221912-157221934 ATGCCCGGGCTCCCAGGGCTGGG - Intergenic
1018682012 6:166272125-166272147 CAGCCTGCGCTCCAAGGGCTGGG + Intergenic
1019392189 7:794818-794840 CCGCCTGCGCTGCCAGGGCAGGG + Intergenic
1019417737 7:935082-935104 ACTCCGGAGCTCCCAGGGCACGG + Intronic
1019522953 7:1468801-1468823 CCTCCCCAGCCCCCAGGGGTGGG - Intergenic
1019527981 7:1489387-1489409 CCTCCCACGCAGCCAGGCCTAGG + Exonic
1020137384 7:5594585-5594607 CCGCCCCCGGGCCCAGGGCTCGG + Intronic
1021717708 7:23474317-23474339 GCTCCCGCGCTCCCCGGGGCCGG + Intergenic
1022046788 7:26628050-26628072 CCTCCCTCCCTCCCCGGCCTGGG - Intergenic
1026850000 7:73718493-73718515 CCCACCCCGCTCCCTGGGCTAGG - Intronic
1029799462 7:102931056-102931078 CATCACTGGCTCCCAGGGCTGGG - Intronic
1032125406 7:129189266-129189288 CCGCCCGCGCTCCGAGGCCCAGG - Exonic
1032195450 7:129785945-129785967 CCTCCGACCCTCCCAGGGCGCGG + Intergenic
1034494105 7:151409949-151409971 CCTCTCGCGCCCACGGGGCTGGG + Intronic
1035034787 7:155887472-155887494 CCAACCGCCCTTCCAGGGCTGGG + Intergenic
1035583585 8:755633-755655 CCTCCCTCTCTCCCTGGGCCTGG - Intergenic
1038963505 8:32548092-32548114 CCTCCCGCGCTGGCCGGGCGGGG - Intronic
1039561236 8:38514047-38514069 CCTCCCTCCCTCCCTGGGCTGGG + Intronic
1040110182 8:43563751-43563773 CCTCCCACGCACCCTGGGTTGGG + Intergenic
1044492613 8:92837311-92837333 CCTCCCGCTGCCCCAGGGATTGG + Intergenic
1048308098 8:133297378-133297400 CCTCCCGGGCGCGCCGGGCTGGG + Exonic
1049552665 8:143267630-143267652 CCCACCCCGCTCCCCGGGCTTGG - Intronic
1057072859 9:92115256-92115278 CCTCCCACCCTCCCCGGGCCCGG + Intronic
1060235525 9:121860015-121860037 CCTCCAGCCCACCCAAGGCTGGG + Intronic
1060271333 9:122144290-122144312 TCTCCCTCGATCTCAGGGCTGGG + Exonic
1060519037 9:124283502-124283524 CCTCCCGCGATACCAAGTCTAGG - Intronic
1061060949 9:128250390-128250412 CCTCCCGCGGGCCCCGGGCTGGG - Intronic
1061287257 9:129631115-129631137 CCTCCAGCACTCCCTGTGCTTGG + Intronic
1061295799 9:129676074-129676096 CCTCCCGTTTTTCCAGGGCTGGG + Intronic
1061449489 9:130660680-130660702 CCTCCCCCGCACCCAGGCCCGGG + Intergenic
1061808481 9:133149219-133149241 CCGCCCCGGCTCCCCGGGCTCGG + Intronic
1062119408 9:134826144-134826166 CATCCTGCCGTCCCAGGGCTGGG + Intronic
1062449691 9:136610285-136610307 CCTCTGGGGCTCCCAGGGCCAGG + Intergenic
1187270596 X:17776306-17776328 CCTCCCTGGCTTCCAGTGCTGGG - Intergenic
1187295200 X:17992657-17992679 CCTCCAGAGCTGCCAGGGCTGGG + Intergenic
1187319911 X:18229419-18229441 CCTCCCTGGCTTCCAGTGCTGGG + Intergenic
1187343454 X:18441976-18441998 CCTACCCCTCTCCCAGGACTTGG + Intronic
1187725978 X:22202683-22202705 CCTACCATGCTCCCAGGCCTGGG + Intronic
1188645008 X:32554791-32554813 CCTCCCTCCCTCCCAGGTTTTGG - Intronic
1189974395 X:46447227-46447249 CATCCCGCGTTCCCAGGGGGCGG + Exonic
1198530583 X:137547320-137547342 CCTTCCGAGCTCCCTGGCCTCGG + Intergenic
1200049563 X:153421633-153421655 CCGCCAGCGCACCCAGGGCGCGG + Intergenic
1200228328 X:154431629-154431651 CCTCCAGCACTCTCAGGGCAGGG - Intronic
1202369847 Y:24189096-24189118 CCACCCTGGCCCCCAGGGCTTGG - Intergenic
1202500937 Y:25481021-25481043 CCACCCTGGCCCCCAGGGCTTGG + Intergenic