ID: 1163612826

View in Genome Browser
Species Human (GRCh38)
Location 19:18309957-18309979
Sequence CAGCTTGCAGGGGTGGTACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163612826_1163612836 11 Left 1163612826 19:18309957-18309979 CCCCGTACCACCCCTGCAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1163612836 19:18309991-18310013 TCCCGGGACATACGTGGCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1163612826_1163612838 12 Left 1163612826 19:18309957-18309979 CCCCGTACCACCCCTGCAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1163612838 19:18309992-18310014 CCCGGGACATACGTGGCAAAGGG 0: 1
1: 0
2: 1
3: 5
4: 41
1163612826_1163612834 -5 Left 1163612826 19:18309957-18309979 CCCCGTACCACCCCTGCAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1163612834 19:18309975-18309997 AGCTGCACAGTATCAGTCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 119
1163612826_1163612840 25 Left 1163612826 19:18309957-18309979 CCCCGTACCACCCCTGCAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1163612840 19:18310005-18310027 TGGCAAAGGGTCCACCCTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 142
1163612826_1163612841 29 Left 1163612826 19:18309957-18309979 CCCCGTACCACCCCTGCAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1163612841 19:18310009-18310031 AAAGGGTCCACCCTGCAGGCAGG 0: 1
1: 0
2: 0
3: 41
4: 241
1163612826_1163612835 5 Left 1163612826 19:18309957-18309979 CCCCGTACCACCCCTGCAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1163612835 19:18309985-18310007 TATCAGTCCCGGGACATACGTGG 0: 1
1: 0
2: 0
3: 0
4: 18
1163612826_1163612833 -6 Left 1163612826 19:18309957-18309979 CCCCGTACCACCCCTGCAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1163612833 19:18309974-18309996 AAGCTGCACAGTATCAGTCCCGG 0: 1
1: 0
2: 1
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163612826 Original CRISPR CAGCTTGCAGGGGTGGTACG GGG (reversed) Intronic
900871496 1:5307266-5307288 CTGCCTGCAGGGCTGGGACGAGG - Intergenic
902247195 1:15128820-15128842 CAGCTGGCAGGGATGGTGGGGGG - Intergenic
902333616 1:15742784-15742806 CAGCGTGCAGGGGTGTTAGGAGG - Intronic
902514950 1:16985103-16985125 CAGGATGCTGGGGTGGGACGGGG + Intergenic
902903308 1:19535261-19535283 GAGCTTGGAGGGGTGGTCAGGGG - Intergenic
902999257 1:20253141-20253163 CAGCTTGCAGTGATGCTGCGGGG + Intergenic
903377564 1:22876376-22876398 GGGCATGCAGGGGTTGTACGGGG - Intronic
905344694 1:37303338-37303360 CAGCTTGCAGGACTGGGGCGAGG - Intergenic
905462674 1:38131821-38131843 CAGGATGCAGGGGTTGTAGGGGG + Intergenic
907525680 1:55052677-55052699 CACCTGGCAGGGGTGGTCAGCGG + Exonic
916189516 1:162165550-162165572 TAGCTCGCAGAGGTGGTAAGTGG + Intronic
917968720 1:180194171-180194193 CAGCCTGAAGGGCTGGTGCGTGG + Intronic
919802085 1:201360075-201360097 CACCCTGCAGGGGTGGTGCATGG - Intronic
919972308 1:202589224-202589246 CCGCTGGCAGGGTTTGTACGTGG + Exonic
920685953 1:208109134-208109156 CAGGTGGCAGGGGTGGGAGGTGG + Intronic
921176263 1:212597523-212597545 CACCTTGCAGGGTTGATATGGGG - Intronic
921625486 1:217373826-217373848 CAGCTTCCATGGCTGGTGCGGGG - Intergenic
1063325282 10:5094345-5094367 CAGTTTGCAGGGGTGGGGGGAGG + Exonic
1068681579 10:59826001-59826023 CAGCTTCCAGGGGCAGTACAGGG - Intronic
1069717631 10:70531160-70531182 CAGGTTGCAGGGATGGTGTGGGG + Intronic
1069778569 10:70940979-70941001 CAGCTGGCAGGGCTGGGAGGAGG - Intergenic
1073446642 10:103584959-103584981 CAGCGTGCCGGGGTCGCACGTGG - Exonic
1075514617 10:123099085-123099107 AACCTTGCAGGGGTGGTGCCCGG + Intergenic
1075787675 10:125061115-125061137 CAGCTTGCTGGGATGGTCCCAGG - Intronic
1076759503 10:132594814-132594836 CAGCCTGCAGGGCTGGCAGGGGG - Intronic
1077845511 11:6019540-6019562 CATCTTGCATGGGTGGTGGGAGG + Intergenic
1081648681 11:44808252-44808274 CAGCTAGAAGAGGTGGTGCGAGG + Intronic
1083856023 11:65393588-65393610 CAGCTTGTAGGGCTGGTGCTTGG - Exonic
1084172985 11:67409548-67409570 CAGCTGGCAGGAGTGCGACGAGG + Exonic
1086112966 11:83218799-83218821 AAGCTTGCAGGCTTGGTACAAGG + Intronic
1088503615 11:110508044-110508066 CAGCTTCCACGGCTGGTACCAGG - Intergenic
1089735358 11:120547015-120547037 CAGGGTGCCGGGGAGGTACGTGG - Intronic
1090462546 11:126905144-126905166 CAGCTTGCAGAGGAGGAACGGGG + Intronic
1091617801 12:2062864-2062886 CAGCTTACAGGGATGGTCCCCGG - Intronic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1097633974 12:62099750-62099772 CACCATGCAGGGGTGCCACGGGG - Intronic
1101878690 12:108611915-108611937 CATCTTGCAGGGGTGTTGTGGGG - Intergenic
1102522086 12:113484489-113484511 CAGCTTGTAGGGGCGGTGGGAGG - Intergenic
1103744680 12:123114442-123114464 CAGCTTGCATGGGAGGAACCTGG + Intronic
1103906166 12:124328219-124328241 CAGCTTGGTGGGGAGGTACGGGG - Intronic
1104406334 12:128520230-128520252 GAGCATGCAGGGGTGATACGTGG - Intronic
1105624073 13:22096324-22096346 CAGCTGCAAGGGGTGGTAGGAGG + Intergenic
1108038356 13:46315865-46315887 CAGGTGGCAGGTGTGGTAGGTGG - Intergenic
1109325137 13:60858438-60858460 CAGCTGCCAGCGGTGGTAAGTGG - Intergenic
1112371527 13:98798081-98798103 CTGCTTGCAAGGGTGGTGCAGGG - Intronic
1113761936 13:112854374-112854396 GAGCTTGCAGGCGTAGCACGTGG - Exonic
1118134574 14:63008719-63008741 CAGCTTGCAGGTGTGCTTTGAGG - Intronic
1119212402 14:72842222-72842244 CACCTTGCAGGGGAGTTACTGGG - Intronic
1119857457 14:77911219-77911241 CAGCTAGCAGGGGTAGAACCAGG + Intronic
1119858889 14:77922453-77922475 CACCTTCCAGGGGTGTTATGAGG + Intronic
1119906111 14:78303617-78303639 GAGCTGGCAGGGGTGATAGGTGG - Intronic
1122635176 14:103126481-103126503 CAGCCTCCAGGGGTGGCACCAGG - Exonic
1124237833 15:28005053-28005075 CAGCTCGCAGGGGCAGTGCGAGG - Intronic
1124663429 15:31569945-31569967 CAGCTTGCAGGCGGGTTGCGTGG - Intronic
1125183336 15:36902402-36902424 CTGCCTGCAGGGGTGGGAGGTGG + Intronic
1126096825 15:45095948-45095970 CAGTGTGAAGGGGTGGTACTCGG + Exonic
1126108394 15:45161828-45161850 CAGTGTGAAGGGGTGGTACTCGG - Exonic
1126567929 15:50119324-50119346 CAGCTTCCGGTGGTGGTAAGTGG - Intronic
1127601698 15:60543984-60544006 CATCTTGGAGAGGTGGTAAGTGG + Intronic
1128371444 15:67042595-67042617 CAGTTTGCAGTGGTGGGAAGAGG - Intergenic
1130202147 15:81842037-81842059 CAGCTTACACAGGTGGTAAGTGG - Intergenic
1130429883 15:83836819-83836841 CAGCTTGAAAGGGTGGTGAGTGG + Intronic
1132882318 16:2167921-2167943 AAGCATGCAGGGATGGCACGGGG - Intronic
1132981605 16:2741068-2741090 CAGGTGGCAGGGGCAGTACGAGG + Intergenic
1133822856 16:9252367-9252389 CACCCTGCAAGGGTGGTACCTGG - Intergenic
1134032304 16:11002069-11002091 CAGCTTGTGTGGCTGGTACGTGG + Intronic
1134247900 16:12553591-12553613 CATCTTGCAGGGGTGGGGGGTGG - Intronic
1134319607 16:13150710-13150732 CTGCTTGCAGGGGTGGTGGGAGG - Intronic
1136181341 16:28554390-28554412 CAGCTTCCAGGTGGGGTACTCGG + Intronic
1138659602 16:58509423-58509445 CTGTTTGCAGGGCTGGCACGTGG + Intronic
1142234506 16:88915429-88915451 CAGCGTGGAGGAGTGGAACGTGG + Intronic
1142855115 17:2724747-2724769 CAGCTGGCAGGAGAGGTAGGCGG + Intergenic
1146277222 17:31523493-31523515 CTGCCTGCAGGGGTGGGAGGAGG - Exonic
1149295513 17:55258679-55258701 CAGCTTGCAGAGTTGCTAGGAGG - Intergenic
1152487540 17:80603987-80604009 CTGCTTACAGGGGTGGCCCGTGG - Intronic
1152581422 17:81166934-81166956 CACCTTGCAGGGTTGGGGCGGGG + Intergenic
1153946896 18:10026388-10026410 CAGCTTGCTGGGGTGGGAGAAGG - Intergenic
1159009056 18:63040960-63040982 CAGTTTGCTGGGGTGGAAGGAGG + Intergenic
1160837767 19:1132677-1132699 CAGCCTGCAGGGGTGGGGTGGGG - Intronic
1162109781 19:8393716-8393738 CAGCTTCCAGGGGAGGGATGGGG + Intronic
1162826091 19:13253132-13253154 CAGCGAGCAGGGGTGGGAAGTGG + Intronic
1163612826 19:18309957-18309979 CAGCTTGCAGGGGTGGTACGGGG - Intronic
1163795329 19:19334632-19334654 CAGCTTCCAGGGGTGACACCAGG + Intronic
1164747647 19:30627989-30628011 CGGGAAGCAGGGGTGGTACGGGG - Intronic
1164752962 19:30669676-30669698 AAGCTTGCAGGGGGGCTGCGTGG + Intronic
1165755912 19:38292895-38292917 CATCTTGAAGGGGTGGTGGGAGG + Intronic
1167151784 19:47714176-47714198 CAGCTTGCAGGGGTGCCCAGTGG - Intronic
925352713 2:3212696-3212718 CAGCCTGCAGGTGTGGTCCACGG + Intronic
926002771 2:9347104-9347126 CATCCTGCAGGGGTGGTAGGTGG + Intronic
926795997 2:16619201-16619223 CAGCCAGCAGGGGTGATAGGAGG + Intronic
928840574 2:35599857-35599879 CAGCTTTCATGGCTGGTACCAGG - Intergenic
929556122 2:42926741-42926763 CAGCCTGGAGGGGTGGGAGGAGG - Intergenic
931020730 2:58041911-58041933 CAGCTTGAAAGGGGGGTAGGAGG - Intronic
933301134 2:80542707-80542729 CAGCAAGCAGGGATGGTACGGGG + Intronic
937368351 2:121281186-121281208 CATATTGCAGGGGTGGCAGGCGG + Exonic
937424698 2:121789371-121789393 CAGCCTGCAGGGTGGGTAGGGGG + Intergenic
938063791 2:128270437-128270459 CAGCATGGATGGGTGGTACCAGG - Intronic
938683947 2:133718742-133718764 CAGCTGCCAGTGGCGGTACGAGG + Intergenic
940219406 2:151336025-151336047 CAGGTTGCAGGAGTGGTGTGGGG - Intergenic
940864937 2:158808372-158808394 CAGCTTATAGGGTTGTTACGTGG + Intronic
941748510 2:169111760-169111782 CAGCATGCAGAGGTGGAACCTGG - Intergenic
1169054870 20:2612274-2612296 CAGGGTGCAGGGGTGGTCGGGGG - Exonic
1171190954 20:23159224-23159246 CAGCTTGCACCGGTGGCAAGGGG - Intergenic
1172183648 20:33018618-33018640 CAGCCTGTAGGGGTGGGAGGGGG - Exonic
1173971721 20:47158165-47158187 CTGCTTGCAGGTGTGTTACGAGG - Intronic
1176411688 21:6452560-6452582 CAGCCTGCAGGCGTGGTGCTGGG - Intergenic
1179231101 21:39504484-39504506 CAGACTGCAGAGGTGGTGCGTGG - Intronic
1179687182 21:43060882-43060904 CAGCCTGCAGGCGTGGTGCTGGG - Intronic
1179994742 21:44968668-44968690 CAGCTTTCAGGGCTGGAAAGAGG + Intronic
1181487209 22:23238860-23238882 CAGCTTGCAAGGGGGGTGGGGGG + Intronic
1181491034 22:23260904-23260926 CAGCCTGGAAGGGTGGTAGGGGG - Intronic
1184478035 22:44731971-44731993 CAGCTTGAAGGGGTGGAAACAGG - Intronic
949268824 3:2190608-2190630 CAGTCTGCATGGGTGGTAGGTGG + Intronic
954924747 3:54223451-54223473 GAGCTTGCAGGAGTGGAATGAGG + Intronic
962555919 3:136551373-136551395 TAGCTTGCAGAGGTGGGAGGTGG - Intronic
965823829 3:172710886-172710908 CAGCTTCCAGGGGTCGGACACGG + Exonic
968634646 4:1671702-1671724 CACCTTGCAGGAGTGGTTGGTGG - Intronic
968908161 4:3463917-3463939 CAGCCTCCAGGGGTGCTGCGTGG + Intronic
969397479 4:6931961-6931983 CAGCAAGCAGAGGTGGTACGAGG + Intronic
976850040 4:89534568-89534590 TAGCTTGCAGAGGTGGAAAGAGG - Intergenic
976967672 4:91064747-91064769 CTGCTTGCAGGGCTGTTACTTGG - Intronic
978498582 4:109385280-109385302 CAGCTTCCATGGCTGGCACGGGG - Intergenic
990311505 5:54543516-54543538 CAGCTATCAGTGGTGGTACAAGG + Intronic
1001210155 5:169803503-169803525 TAGTTTGCAGGGGTGGGAGGAGG + Intronic
1001329607 5:170752859-170752881 AAGCTTGCAGAGGTGGCAGGGGG - Intergenic
1001760837 5:174206793-174206815 CAGCTCACAGGGGTGGTACTGGG - Intronic
1002129808 5:177073658-177073680 CAGGTTGCTGGGGTGGGAGGAGG + Intronic
1006151467 6:31992366-31992388 CAGCTGGCAGGGGCGGCAGGTGG - Exonic
1006157768 6:32025104-32025126 CAGCTGGCAGGGGCGGCAGGTGG - Exonic
1009534224 6:64860513-64860535 CAGCTTCCATGGCTGGTACCAGG + Intronic
1009832675 6:68958272-68958294 CAGCATGCAGGGTTGTTAAGAGG + Intronic
1012852841 6:104467739-104467761 TAGCTTGCAGGGTTAGTATGAGG - Intergenic
1017328183 6:153164790-153164812 CTGCATGCAGGTGTGGAACGGGG - Intergenic
1017453695 6:154578368-154578390 TACCTTGCAGGGGTGGTGCCAGG - Intergenic
1019322220 7:420934-420956 GAGGTTGGAGGGGTGGGACGGGG - Intergenic
1019490556 7:1311295-1311317 CAGGTGGCAGGGGTGGCCCGGGG + Intergenic
1019543304 7:1560971-1560993 CAGGAGGCAGGGGTGGCACGTGG - Intergenic
1021025197 7:15658237-15658259 CAGCCTGCAGGGGAGGTGGGAGG + Intronic
1022128561 7:27381016-27381038 CAGCATCCAGGGGTGGAAAGAGG + Intergenic
1022496596 7:30856800-30856822 CAGCATGCAGAGCTGGTACAAGG + Intronic
1028068583 7:86420126-86420148 AAGCTTGGAGGGGTGGTTGGAGG - Intergenic
1033128196 7:138723097-138723119 CAGCTGGCAAGGCTGGTAAGTGG + Intronic
1035600536 8:894618-894640 CAGCTGGCAGGGGTGGGGTGGGG + Intergenic
1037834704 8:22209187-22209209 CAGCATGGAGCGGTGGCACGAGG - Intronic
1041965392 8:63669647-63669669 CAGCTTCCAGGGTTGGCACTGGG + Intergenic
1043758403 8:84032365-84032387 CAGCTTCCAGGGCTGGCACTGGG - Intergenic
1047018025 8:120744421-120744443 CAGCTTCCAGGGTTGGTAGAGGG - Intronic
1049555477 8:143279316-143279338 GAGCCGGCAGGGGTGGGACGGGG - Intergenic
1051813453 9:21076640-21076662 AAGCTTGCAGGGATGGTGGGGGG + Intergenic
1056169343 9:83968021-83968043 AAGCTGGCAGGGGTGGTAGTTGG - Intergenic
1059312712 9:113399720-113399742 CAACTTGCAGGGGTGGGGGGTGG - Intronic
1061099132 9:128478871-128478893 CAGCTGGAAGGGGTAGTACTGGG - Intronic
1185471990 X:389461-389483 CGTCTTGCAGGGGTGGTGGGTGG + Intergenic
1186710944 X:12195721-12195743 CGGCTTGCAGGGTTGGTCCTTGG - Intronic
1188220214 X:27532238-27532260 CAGATTGCAGGGCTGGAACTGGG + Intergenic
1189976199 X:46463121-46463143 CAGCCTGCAGGGGTGGGCCTAGG + Intronic
1189982867 X:46528500-46528522 CAGCCTGCAGGGGTGGGCCTAGG - Intronic
1191846665 X:65552002-65552024 CAGCTTGTAGGGCTGGTTCTTGG + Intergenic
1193392797 X:80948969-80948991 CTGCTGGCAGTGGTGGTACAGGG + Intergenic
1199786581 X:151111879-151111901 CAGCTAGCAGTGGGGGGACGTGG + Intergenic