ID: 1163622838

View in Genome Browser
Species Human (GRCh38)
Location 19:18371020-18371042
Sequence TCCCAAGTAGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1337359
Summary {0: 48553, 1: 142115, 2: 242012, 3: 520212, 4: 384467}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163622838_1163622847 17 Left 1163622838 19:18371020-18371042 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1163622847 19:18371060-18371082 CACTTGAACCCGGCGGGTGGAGG No data
1163622838_1163622845 11 Left 1163622838 19:18371020-18371042 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1163622845 19:18371054-18371076 CAGAATCACTTGAACCCGGCGGG No data
1163622838_1163622844 10 Left 1163622838 19:18371020-18371042 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1163622844 19:18371053-18371075 GCAGAATCACTTGAACCCGGCGG No data
1163622838_1163622846 14 Left 1163622838 19:18371020-18371042 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1163622846 19:18371057-18371079 AATCACTTGAACCCGGCGGGTGG 0: 2
1: 252
2: 11349
3: 56017
4: 94839
1163622838_1163622843 7 Left 1163622838 19:18371020-18371042 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1163622843 19:18371050-18371072 GCAGCAGAATCACTTGAACCCGG 0: 267
1: 37334
2: 87039
3: 104574
4: 124892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163622838 Original CRISPR TCCCAAGTAGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr