ID: 1163622840

View in Genome Browser
Species Human (GRCh38)
Location 19:18371028-18371050
Sequence CCTCAGCCTCCCAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163622840_1163622844 2 Left 1163622840 19:18371028-18371050 CCCAGCTACTTGGGAGGCTGAGG No data
Right 1163622844 19:18371053-18371075 GCAGAATCACTTGAACCCGGCGG No data
1163622840_1163622846 6 Left 1163622840 19:18371028-18371050 CCCAGCTACTTGGGAGGCTGAGG No data
Right 1163622846 19:18371057-18371079 AATCACTTGAACCCGGCGGGTGG No data
1163622840_1163622847 9 Left 1163622840 19:18371028-18371050 CCCAGCTACTTGGGAGGCTGAGG No data
Right 1163622847 19:18371060-18371082 CACTTGAACCCGGCGGGTGGAGG No data
1163622840_1163622843 -1 Left 1163622840 19:18371028-18371050 CCCAGCTACTTGGGAGGCTGAGG No data
Right 1163622843 19:18371050-18371072 GCAGCAGAATCACTTGAACCCGG No data
1163622840_1163622845 3 Left 1163622840 19:18371028-18371050 CCCAGCTACTTGGGAGGCTGAGG No data
Right 1163622845 19:18371054-18371076 CAGAATCACTTGAACCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163622840 Original CRISPR CCTCAGCCTCCCAAGTAGCT GGG (reversed) Intergenic