ID: 1163622842

View in Genome Browser
Species Human (GRCh38)
Location 19:18371029-18371051
Sequence GCCTCAGCCTCCCAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1008369
Summary {0: 81212, 1: 190903, 2: 234468, 3: 228974, 4: 272812}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163622842_1163622843 -2 Left 1163622842 19:18371029-18371051 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1163622843 19:18371050-18371072 GCAGCAGAATCACTTGAACCCGG 0: 267
1: 37334
2: 87039
3: 104574
4: 124892
1163622842_1163622844 1 Left 1163622842 19:18371029-18371051 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1163622844 19:18371053-18371075 GCAGAATCACTTGAACCCGGCGG No data
1163622842_1163622845 2 Left 1163622842 19:18371029-18371051 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1163622845 19:18371054-18371076 CAGAATCACTTGAACCCGGCGGG No data
1163622842_1163622846 5 Left 1163622842 19:18371029-18371051 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1163622846 19:18371057-18371079 AATCACTTGAACCCGGCGGGTGG 0: 2
1: 252
2: 11349
3: 56017
4: 94839
1163622842_1163622847 8 Left 1163622842 19:18371029-18371051 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1163622847 19:18371060-18371082 CACTTGAACCCGGCGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163622842 Original CRISPR GCCTCAGCCTCCCAAGTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr