ID: 1163622844

View in Genome Browser
Species Human (GRCh38)
Location 19:18371053-18371075
Sequence GCAGAATCACTTGAACCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163622842_1163622844 1 Left 1163622842 19:18371029-18371051 CCAGCTACTTGGGAGGCTGAGGC No data
Right 1163622844 19:18371053-18371075 GCAGAATCACTTGAACCCGGCGG No data
1163622838_1163622844 10 Left 1163622838 19:18371020-18371042 CCTGTAATCCCAGCTACTTGGGA No data
Right 1163622844 19:18371053-18371075 GCAGAATCACTTGAACCCGGCGG No data
1163622840_1163622844 2 Left 1163622840 19:18371028-18371050 CCCAGCTACTTGGGAGGCTGAGG No data
Right 1163622844 19:18371053-18371075 GCAGAATCACTTGAACCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163622844 Original CRISPR GCAGAATCACTTGAACCCGG CGG Intergenic