ID: 1163622846

View in Genome Browser
Species Human (GRCh38)
Location 19:18371057-18371079
Sequence AATCACTTGAACCCGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163622842_1163622846 5 Left 1163622842 19:18371029-18371051 CCAGCTACTTGGGAGGCTGAGGC No data
Right 1163622846 19:18371057-18371079 AATCACTTGAACCCGGCGGGTGG No data
1163622838_1163622846 14 Left 1163622838 19:18371020-18371042 CCTGTAATCCCAGCTACTTGGGA No data
Right 1163622846 19:18371057-18371079 AATCACTTGAACCCGGCGGGTGG No data
1163622840_1163622846 6 Left 1163622840 19:18371028-18371050 CCCAGCTACTTGGGAGGCTGAGG No data
Right 1163622846 19:18371057-18371079 AATCACTTGAACCCGGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163622846 Original CRISPR AATCACTTGAACCCGGCGGG TGG Intergenic