ID: 1163622846 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:18371057-18371079 |
Sequence | AATCACTTGAACCCGGCGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1163622840_1163622846 | 6 | Left | 1163622840 | 19:18371028-18371050 | CCCAGCTACTTGGGAGGCTGAGG | No data | ||
Right | 1163622846 | 19:18371057-18371079 | AATCACTTGAACCCGGCGGGTGG | No data | ||||
1163622838_1163622846 | 14 | Left | 1163622838 | 19:18371020-18371042 | CCTGTAATCCCAGCTACTTGGGA | No data | ||
Right | 1163622846 | 19:18371057-18371079 | AATCACTTGAACCCGGCGGGTGG | No data | ||||
1163622842_1163622846 | 5 | Left | 1163622842 | 19:18371029-18371051 | CCAGCTACTTGGGAGGCTGAGGC | No data | ||
Right | 1163622846 | 19:18371057-18371079 | AATCACTTGAACCCGGCGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1163622846 | Original CRISPR | AATCACTTGAACCCGGCGGG TGG | Intergenic | ||