ID: 1163622847

View in Genome Browser
Species Human (GRCh38)
Location 19:18371060-18371082
Sequence CACTTGAACCCGGCGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163622840_1163622847 9 Left 1163622840 19:18371028-18371050 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1163622847 19:18371060-18371082 CACTTGAACCCGGCGGGTGGAGG No data
1163622842_1163622847 8 Left 1163622842 19:18371029-18371051 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1163622847 19:18371060-18371082 CACTTGAACCCGGCGGGTGGAGG No data
1163622838_1163622847 17 Left 1163622838 19:18371020-18371042 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1163622847 19:18371060-18371082 CACTTGAACCCGGCGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163622847 Original CRISPR CACTTGAACCCGGCGGGTGG AGG Intergenic
No off target data available for this crispr