ID: 1163624406

View in Genome Browser
Species Human (GRCh38)
Location 19:18380636-18380658
Sequence CTGTGAGAGGACAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42905
Summary {0: 1, 1: 4, 2: 107, 3: 2766, 4: 40027}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163624396_1163624406 27 Left 1163624396 19:18380586-18380608 CCAGGCGAGTGGCCAGATGTGGT 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG 0: 1
1: 4
2: 107
3: 2766
4: 40027
1163624398_1163624406 15 Left 1163624398 19:18380598-18380620 CCAGATGTGGTGGCTCATGCCAT 0: 1
1: 13
2: 647
3: 9381
4: 40067
Right 1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG 0: 1
1: 4
2: 107
3: 2766
4: 40027
1163624400_1163624406 -4 Left 1163624400 19:18380617-18380639 CCATCACAGGATCCCAGCACTGT 0: 1
1: 0
2: 1
3: 26
4: 245
Right 1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG 0: 1
1: 4
2: 107
3: 2766
4: 40027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163624406 Original CRISPR CTGTGAGAGGACAAGGAAGG AGG Intronic
Too many off-targets to display for this crispr