ID: 1163626024

View in Genome Browser
Species Human (GRCh38)
Location 19:18390240-18390262
Sequence GTCCGGGGCCTGGCATAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163626024_1163626029 1 Left 1163626024 19:18390240-18390262 CCACTTTATGCCAGGCCCCGGAC No data
Right 1163626029 19:18390264-18390286 CAGCTGTAAAAAGACACACAAGG No data
1163626024_1163626032 25 Left 1163626024 19:18390240-18390262 CCACTTTATGCCAGGCCCCGGAC No data
Right 1163626032 19:18390288-18390310 CCACCCCACTTTGCGGAGCCTGG No data
1163626024_1163626030 18 Left 1163626024 19:18390240-18390262 CCACTTTATGCCAGGCCCCGGAC No data
Right 1163626030 19:18390281-18390303 ACAAGGACCACCCCACTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163626024 Original CRISPR GTCCGGGGCCTGGCATAAAG TGG (reversed) Intergenic
No off target data available for this crispr