ID: 1163628178

View in Genome Browser
Species Human (GRCh38)
Location 19:18402815-18402837
Sequence ATGTTTCAGACTATCCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163628178_1163628185 -7 Left 1163628178 19:18402815-18402837 CCCCATGGGATAGTCTGAAACAT No data
Right 1163628185 19:18402831-18402853 GAAACATGGCCTCGTGGGATGGG No data
1163628178_1163628184 -8 Left 1163628178 19:18402815-18402837 CCCCATGGGATAGTCTGAAACAT No data
Right 1163628184 19:18402830-18402852 TGAAACATGGCCTCGTGGGATGG 0: 4
1: 344
2: 217
3: 183
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163628178 Original CRISPR ATGTTTCAGACTATCCCATG GGG (reversed) Intergenic
No off target data available for this crispr