ID: 1163630024

View in Genome Browser
Species Human (GRCh38)
Location 19:18413578-18413600
Sequence CACTGAGAATGTGGGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163630011_1163630024 23 Left 1163630011 19:18413532-18413554 CCCCCAACCTCATTTTGATTTCC No data
Right 1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG No data
1163630013_1163630024 21 Left 1163630013 19:18413534-18413556 CCCAACCTCATTTTGATTTCCCA No data
Right 1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG No data
1163630015_1163630024 16 Left 1163630015 19:18413539-18413561 CCTCATTTTGATTTCCCAGAAAA No data
Right 1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG No data
1163630012_1163630024 22 Left 1163630012 19:18413533-18413555 CCCCAACCTCATTTTGATTTCCC No data
Right 1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG No data
1163630018_1163630024 1 Left 1163630018 19:18413554-18413576 CCAGAAAACAGACCCAAGATGGC No data
Right 1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG No data
1163630016_1163630024 2 Left 1163630016 19:18413553-18413575 CCCAGAAAACAGACCCAAGATGG No data
Right 1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG No data
1163630014_1163630024 20 Left 1163630014 19:18413535-18413557 CCAACCTCATTTTGATTTCCCAG No data
Right 1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG No data
1163630010_1163630024 26 Left 1163630010 19:18413529-18413551 CCACCCCCAACCTCATTTTGATT No data
Right 1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163630024 Original CRISPR CACTGAGAATGTGGGGCACA TGG Intergenic
No off target data available for this crispr