ID: 1163630462

View in Genome Browser
Species Human (GRCh38)
Location 19:18415647-18415669
Sequence GAGGAACCCTTGGCCAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163630451_1163630462 0 Left 1163630451 19:18415624-18415646 CCTCCTCCCCCAGGAGGACCAAG No data
Right 1163630462 19:18415647-18415669 GAGGAACCCTTGGCCAAAGGAGG No data
1163630453_1163630462 -3 Left 1163630453 19:18415627-18415649 CCTCCCCCAGGAGGACCAAGGAG No data
Right 1163630462 19:18415647-18415669 GAGGAACCCTTGGCCAAAGGAGG No data
1163630458_1163630462 -9 Left 1163630458 19:18415633-18415655 CCAGGAGGACCAAGGAGGAACCC No data
Right 1163630462 19:18415647-18415669 GAGGAACCCTTGGCCAAAGGAGG No data
1163630456_1163630462 -7 Left 1163630456 19:18415631-18415653 CCCCAGGAGGACCAAGGAGGAAC No data
Right 1163630462 19:18415647-18415669 GAGGAACCCTTGGCCAAAGGAGG No data
1163630455_1163630462 -6 Left 1163630455 19:18415630-18415652 CCCCCAGGAGGACCAAGGAGGAA No data
Right 1163630462 19:18415647-18415669 GAGGAACCCTTGGCCAAAGGAGG No data
1163630457_1163630462 -8 Left 1163630457 19:18415632-18415654 CCCAGGAGGACCAAGGAGGAACC No data
Right 1163630462 19:18415647-18415669 GAGGAACCCTTGGCCAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163630462 Original CRISPR GAGGAACCCTTGGCCAAAGG AGG Intergenic