ID: 1163631339

View in Genome Browser
Species Human (GRCh38)
Location 19:18419435-18419457
Sequence AAAAAGCCACCCTGCGGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163631334_1163631339 0 Left 1163631334 19:18419412-18419434 CCCGCGCGGAGGAAAGGGAGGAA 0: 1
1: 0
2: 3
3: 22
4: 198
Right 1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 81
1163631329_1163631339 10 Left 1163631329 19:18419402-18419424 CCCGGAACAGCCCGCGCGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 81
1163631335_1163631339 -1 Left 1163631335 19:18419413-18419435 CCGCGCGGAGGAAAGGGAGGAAA 0: 1
1: 0
2: 3
3: 13
4: 198
Right 1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 81
1163631330_1163631339 9 Left 1163631330 19:18419403-18419425 CCGGAACAGCCCGCGCGGAGGAA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163631339 Original CRISPR AAAAAGCCACCCTGCGGCCG GGG Exonic