ID: 1163631339

View in Genome Browser
Species Human (GRCh38)
Location 19:18419435-18419457
Sequence AAAAAGCCACCCTGCGGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163631335_1163631339 -1 Left 1163631335 19:18419413-18419435 CCGCGCGGAGGAAAGGGAGGAAA 0: 1
1: 0
2: 3
3: 13
4: 198
Right 1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 81
1163631329_1163631339 10 Left 1163631329 19:18419402-18419424 CCCGGAACAGCCCGCGCGGAGGA 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 81
1163631330_1163631339 9 Left 1163631330 19:18419403-18419425 CCGGAACAGCCCGCGCGGAGGAA 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 81
1163631334_1163631339 0 Left 1163631334 19:18419412-18419434 CCCGCGCGGAGGAAAGGGAGGAA 0: 1
1: 0
2: 3
3: 22
4: 198
Right 1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163631339 Original CRISPR AAAAAGCCACCCTGCGGCCG GGG Exonic
900205380 1:1429765-1429787 AGAGAGCCAGCCTGCGGCCAGGG - Intergenic
902584243 1:17428268-17428290 CAAAAGCCACCATGTGGACGTGG + Intronic
903356266 1:22749686-22749708 CATAAGCCACCCTGTGGACGGGG - Intronic
910482814 1:87676798-87676820 AAAAAGCAAACCTGCTGCCATGG - Intergenic
912775151 1:112502176-112502198 AGAGAGCGATCCTGCGGCCGTGG + Intronic
919729501 1:200903856-200903878 AAAAAACCACCCTGCCCCCTTGG + Intronic
919738418 1:200968097-200968119 AAGAAGCCACCCTGCTCCTGGGG + Intergenic
920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG + Intronic
921255961 1:213339787-213339809 GAAAAGCCACCATGCGTCCTGGG - Intergenic
923939133 1:238800719-238800741 AAAAAGCCAGCCTGGTGCAGTGG + Intergenic
1064350733 10:14573923-14573945 AAAAAACCACCCTAGGGCCCAGG + Intronic
1067034031 10:42899922-42899944 AAAAATCCAGCCTGGGCCCGTGG - Intergenic
1068118716 10:52762403-52762425 AAAAAGTCACTCTGCGGTCTGGG - Intergenic
1071601044 10:86958895-86958917 AAAATGCCTCCCTGGGGCTGGGG - Intronic
1076029529 10:127145706-127145728 ACAAAGCCACCCTGCCTCCCTGG + Intronic
1077718565 11:4605024-4605046 AAACAGCCAACTTGGGGCCGGGG + Intronic
1079033603 11:17003796-17003818 AAAAACCAACCCTGCTGCCCAGG + Intronic
1081874759 11:46401022-46401044 AAAAAGTCAACCTACGGCCTTGG + Intronic
1084542650 11:69797185-69797207 AAAGAGCCAGCCTGGCGCCGTGG - Intergenic
1085026478 11:73239496-73239518 AAATGGCTACCCTGCTGCCGTGG - Intergenic
1097155168 12:57006705-57006727 AAAAAGCCAGCCTGGGGACTTGG - Intergenic
1101157812 12:101944132-101944154 CAAAAGCCACTCTGAGGCTGTGG - Intronic
1102601563 12:114035276-114035298 AAAAAGCCACCCTGATGCCCTGG + Intergenic
1104801631 12:131558655-131558677 AAACAGCTACCCTGGGGCCAGGG - Intergenic
1105904119 13:24787572-24787594 AAAAAGCCACACTGAGGCCCAGG - Intronic
1107302130 13:38976843-38976865 AAAAAGCCACCCAGCTGCATGGG + Intronic
1107541841 13:41395823-41395845 AAAAAACAACACTGTGGCCGGGG - Intergenic
1113783648 13:112990464-112990486 AATAAACCACCCGGTGGCCGAGG + Intronic
1120934885 14:89885386-89885408 AAAAACCCAGCCAGCGGGCGTGG + Intronic
1130884278 15:88080593-88080615 CAAAAGCCACCCTGGGCCTGAGG + Intronic
1132953942 16:2581110-2581132 GAGAAGCCTCCCTGCGGCCTGGG - Intronic
1132960403 16:2619053-2619075 GAGAAGCCTCCCTGCGGCCTGGG + Intergenic
1133784643 16:8964249-8964271 CAGAAGCCACCCGGCAGCCGGGG + Intronic
1136608315 16:31351455-31351477 AAAAACCCACCCTGAAGGCGTGG - Intergenic
1140289069 16:73633451-73633473 ATAAAACCACCCTCAGGCCGGGG + Intergenic
1142789321 17:2251369-2251391 AAAGAGCCACGCTGAGGCTGAGG + Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1147312746 17:39605015-39605037 AAACAGACACCCAGCTGCCGAGG - Exonic
1147838398 17:43351721-43351743 AGAAAGCCACCCAGGTGCCGAGG - Intergenic
1148589488 17:48805110-48805132 AAAATGCCACCCGGCCTCCGCGG + Intronic
1150138885 17:62712225-62712247 ACAAAGCCACCCAGCCCCCGGGG + Intronic
1150388307 17:64776988-64777010 AAAACGGCACCCGGCGGGCGGGG - Intergenic
1152111157 17:78358460-78358482 AGAAAGTCACCCAGCTGCCGGGG - Exonic
1154173827 18:12068592-12068614 AAAAAGCCACCCTGCGGCCGGGG - Intergenic
1161582011 19:5086250-5086272 GAAAAGCCACCCTCCTGCCCTGG + Intronic
1162654431 19:12117749-12117771 ACAACCCCACCTTGCGGCCGAGG - Intronic
1162705341 19:12551162-12551184 CCCAACCCACCCTGCGGCCGAGG + Intronic
1163240781 19:16062243-16062265 AAAAAGCCTCCCTGAGGAAGTGG - Intergenic
1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG + Exonic
1163844463 19:19630409-19630431 AGCAAGCCACCCTGGGGCCAGGG + Intronic
1167979044 19:53257606-53257628 AGCAAGCCACCCAGCTGCCGAGG + Intergenic
929781903 2:44962488-44962510 GAAGAGCCCCACTGCGGCCGGGG - Intergenic
932213457 2:69950280-69950302 ACACAGCCACCCTGCTGCTGGGG + Intergenic
933895477 2:86807172-86807194 AAAAAGCCAGCGTGCTGGCGCGG + Intronic
937855744 2:126671075-126671097 AAAAATCCACCCTGAGGTCAGGG + Intronic
943561115 2:189463613-189463635 AAAAAGCCACCCTGAGCCACAGG + Intronic
949018157 2:241725230-241725252 TAAAAGCCACACTGAGGTCGCGG - Exonic
1175968599 20:62672696-62672718 ACACAGCCATCCTGGGGCCGGGG - Intronic
1179096601 21:38321555-38321577 ATAAATCCACCCTGAGGCAGGGG + Intergenic
1179992224 21:44954040-44954062 AAGAAGCCACGCTGCTCCCGGGG + Intronic
1180833807 22:18919839-18919861 AAAGTGCCACCCTGAGGCCCAGG + Intronic
1182696945 22:32204339-32204361 AGCAAGCCACCCCGCGGCTGCGG + Intergenic
1182986867 22:34727642-34727664 AAAAAGACACCCTGTGTCCATGG + Intergenic
1184420929 22:44382506-44382528 ATAAAGCCGCCCTGCGGTCTAGG - Intergenic
1203283893 22_KI270734v1_random:145137-145159 AAAGTGCCACCCTGAGGCCCAGG + Intergenic
954797686 3:53169782-53169804 AACAGGGCACCCTGCGGCTGGGG + Intronic
960577222 3:119241083-119241105 TTAAAGCCACCCAGAGGCCGAGG - Intronic
961719037 3:128879943-128879965 AGAGATACACCCTGCGGCCGAGG + Intronic
970977192 4:22055787-22055809 AAACAGCCACCCTGTGGCCATGG + Intergenic
980885373 4:138756953-138756975 AAAAAGCCACGCTTCTGCCAGGG - Intergenic
984505049 4:180606997-180607019 ACAAAGCCAGCCTGAGGCCAGGG + Intergenic
997595900 5:135107370-135107392 AAGAAGCCATCCAGCTGCCGAGG + Intronic
1002550909 5:179990990-179991012 AACAAGCCACCCAGGTGCCGAGG - Intronic
1002928766 6:1619757-1619779 AAAAAGCCAGACTCCAGCCGAGG + Intergenic
1007729080 6:43934960-43934982 AAAAACCCACCCTGAGGCTGTGG + Intergenic
1015758431 6:136631839-136631861 AAAAAGCCACCATCCTGCCATGG + Intronic
1019161201 6:170067949-170067971 CAAAGGCCACCCTGCGGCCACGG + Intergenic
1019586028 7:1804071-1804093 AAATAGCCAGCCGGCGGCCCCGG - Intergenic
1032561948 7:132901447-132901469 AAGAAGCCACCCTGAGGCAAAGG + Intronic
1033707179 7:143901541-143901563 ACAAACCCACACTGCGCCCGTGG + Intronic
1035685279 8:1519725-1519747 AAGAAGCCAGCCTGCGGGCCTGG + Intronic
1040602221 8:48896546-48896568 AAAAAGCCACCCAGGGCCAGAGG - Intergenic
1186158020 X:6746019-6746041 ACAAAGCCCCCCTGGGGCTGTGG + Intergenic
1187801088 X:23063804-23063826 AAAAAGACACCCTGTGCCCTTGG + Intergenic
1192847795 X:74924451-74924473 GAAAACCCACGCGGCGGCCGAGG - Intronic
1194292025 X:92085493-92085515 AAAAAGCCACCCAGATGCCATGG + Intronic
1194751218 X:97686239-97686261 AAAAAGCCACCCTGTAGGCTGGG + Intergenic
1200178106 X:154132448-154132470 AAAAATCTACCCTGCAGCCTGGG + Intergenic