ID: 1163631404

View in Genome Browser
Species Human (GRCh38)
Location 19:18419642-18419664
Sequence GAGCAGCATGTACGCCAAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 76}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163631400_1163631404 -6 Left 1163631400 19:18419625-18419647 CCGGCGGCGGCGGCGTGGAGCAG 0: 1
1: 0
2: 5
3: 25
4: 226
Right 1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG 0: 1
1: 0
2: 1
3: 4
4: 76
1163631387_1163631404 23 Left 1163631387 19:18419596-18419618 CCCGCGGCGCCGCCTGACAGGTG 0: 2
1: 0
2: 0
3: 17
4: 90
Right 1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG 0: 1
1: 0
2: 1
3: 4
4: 76
1163631399_1163631404 -5 Left 1163631399 19:18419624-18419646 CCCGGCGGCGGCGGCGTGGAGCA 0: 1
1: 0
2: 3
3: 22
4: 190
Right 1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG 0: 1
1: 0
2: 1
3: 4
4: 76
1163631391_1163631404 14 Left 1163631391 19:18419605-18419627 CCGCCTGACAGGTGTGGGCCCCG 0: 2
1: 0
2: 0
3: 14
4: 130
Right 1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG 0: 1
1: 0
2: 1
3: 4
4: 76
1163631388_1163631404 22 Left 1163631388 19:18419597-18419619 CCGCGGCGCCGCCTGACAGGTGT 0: 2
1: 0
2: 0
3: 2
4: 54
Right 1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG 0: 1
1: 0
2: 1
3: 4
4: 76
1163631398_1163631404 -4 Left 1163631398 19:18419623-18419645 CCCCGGCGGCGGCGGCGTGGAGC 0: 1
1: 0
2: 4
3: 36
4: 301
Right 1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG 0: 1
1: 0
2: 1
3: 4
4: 76
1163631393_1163631404 11 Left 1163631393 19:18419608-18419630 CCTGACAGGTGTGGGCCCCGGCG 0: 2
1: 0
2: 0
3: 9
4: 108
Right 1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG 0: 1
1: 0
2: 1
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163631404 Original CRISPR GAGCAGCATGTACGCCAAGG GGG Exonic
901815175 1:11789679-11789701 GAGCAGCCTGATGGCCAAGGGGG - Exonic
903317701 1:22521531-22521553 GAGCAGCAAATACGTCAGGGTGG - Exonic
908452491 1:64269695-64269717 GAGCAGCAGGGAGGCAAAGGAGG - Intergenic
908489354 1:64627526-64627548 GAGCATCATGAACTCCAAGAAGG - Intronic
910215791 1:84843063-84843085 AAGCAGCATGAAGACCAAGGCGG - Intronic
911118865 1:94275017-94275039 GAGCAGCATGTAGAGCAAGTGGG + Intronic
924845005 1:247758272-247758294 GATGAGCATGTTCCCCAAGGTGG + Exonic
924858282 1:247896212-247896234 GAGCAGGATAAACACCAAGGGGG - Exonic
1067950168 10:50727954-50727976 GAGCAGCATGGAAGCCACTGAGG - Intergenic
1068861913 10:61855993-61856015 GAGCAGCAAGAAGGCCAATGTGG + Intergenic
1069703300 10:70441530-70441552 GCTCAGCATGTACGCCAGAGGGG + Exonic
1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG + Exonic
1079978504 11:27123657-27123679 CAGCAGCATGAACTCTAAGGGGG + Intronic
1080690690 11:34555218-34555240 CAGCAGCATGTACCCAGAGGAGG + Intergenic
1081741827 11:45446323-45446345 GAGCTGCATCTGCCCCAAGGAGG - Intergenic
1084065102 11:66699506-66699528 GAGCACCATGGACGCCAATGGGG - Exonic
1090518627 11:127455209-127455231 GCCCAGCATGTATGCCCAGGTGG - Intergenic
1096030901 12:48413945-48413967 GAGCTGGATGGAAGCCAAGGAGG - Intergenic
1098644430 12:72880688-72880710 GACCAGCCTGGAGGCCAAGGAGG - Intergenic
1101407015 12:104437621-104437643 CAGCACCATGTCCTCCAAGGGGG - Intergenic
1102430501 12:112879416-112879438 CAGCTGCATGTACTCCCAGGAGG - Intronic
1107679109 13:42829539-42829561 GAGCAGCAAGGAGGCCAATGTGG - Intergenic
1107782329 13:43917020-43917042 GTGCAGCAAGTAGTCCAAGGAGG - Intergenic
1111561113 13:89948181-89948203 GAGCAGCTTGTAGGCCAAAAAGG + Intergenic
1118976171 14:70678541-70678563 GAGGATCATGTAAGCCCAGGAGG + Intergenic
1130368579 15:83263461-83263483 GAGCAGCATGTACAGTCAGGAGG - Exonic
1133815887 16:9197073-9197095 GAACAGGATGTAAGACAAGGCGG + Intergenic
1136867037 16:33767212-33767234 GAGGAGCCTGTAGGCCATGGCGG - Intergenic
1138470791 16:57234142-57234164 GAGCAGCAAGGAGGCCAGGGTGG - Intronic
1203105127 16_KI270728v1_random:1348991-1349013 GAGGAGCCTGTAGGCCATGGCGG + Intergenic
1203128387 16_KI270728v1_random:1613377-1613399 GAGGAGCCTGTAGGCCATGGCGG - Intergenic
1148863897 17:50618795-50618817 GAGCAACAAGGAGGCCAAGGAGG + Exonic
1151028029 17:70702833-70702855 GAGCAGAAGGTATGCAAAGGTGG - Intergenic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1154063278 18:11083505-11083527 GAGAAGCCTGTACACAAAGGGGG + Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1158196027 18:54885905-54885927 GAGCAGCAAGTGAGCAAAGGGGG + Intronic
1162158982 19:8697991-8698013 GAGCAGCATCTCCGCCAGGAAGG + Exonic
1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG + Exonic
1164723271 19:30447544-30447566 CAGCAGCATGAGTGCCAAGGAGG + Intronic
1166760327 19:45220378-45220400 GAGGATCATGTAAGCCCAGGTGG + Intronic
926905274 2:17799682-17799704 GAGCAGCCTGTCTTCCAAGGAGG + Intronic
927772874 2:25878641-25878663 CAGGAGCATGCGCGCCAAGGAGG + Intergenic
929128174 2:38539460-38539482 CAGCAGCAGGTGAGCCAAGGAGG + Intergenic
930720416 2:54632646-54632668 GACCACCATGGACGCCAATGAGG + Exonic
931189975 2:59990800-59990822 GAGCAGCATGTGAGGCAAGCTGG - Intergenic
938303627 2:130233269-130233291 GAGCAGCAAGAAAGCCAATGTGG - Intergenic
938453052 2:131440990-131441012 GAGCAGCAAGAAAGCCAATGTGG + Intergenic
945561636 2:211347417-211347439 AAGCAGCCTGTACACCAGGGTGG - Intergenic
947979548 2:234397500-234397522 GAGCAGCATTTACTCAAAAGAGG + Intergenic
1169163425 20:3402665-3402687 GAGGATCATGTGAGCCAAGGAGG - Intronic
1169170600 20:3461635-3461657 CAGCACCATGTACGCCTGGGAGG - Intergenic
1170507953 20:17047958-17047980 GAGCAGCCTGGATTCCAAGGAGG - Intergenic
1171519305 20:25763980-25764002 TAGCAGCATGTATGCCAGTGAGG + Intronic
1172951284 20:38724796-38724818 GAGCGGCATGTTCGCCAGGATGG + Exonic
1175458581 20:59133842-59133864 GAGCAGCATGGAAGTCAAGTAGG - Intergenic
1175992673 20:62797204-62797226 GAGCACCATGTACGACATGCAGG + Exonic
1176444667 21:6810979-6811001 GCGCAGCAGGAACGCCATGGTGG - Intergenic
1179483670 21:41694708-41694730 GACAAGCATGTTCACCAAGGTGG + Intergenic
1181169467 22:21000159-21000181 GCGCAGCATATACGCTGAGGGGG + Exonic
1181330521 22:22087172-22087194 GAGAAGCATCTACTCCCAGGTGG - Intergenic
1183397307 22:37579345-37579367 GAGGATCATTTAAGCCAAGGAGG + Intronic
954283985 3:49604843-49604865 GAGCAGCAAGCACGCCAGTGTGG - Intronic
955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG + Intronic
973338305 4:48978629-48978651 GGGCAGCATCTACGCAAAAGAGG - Intergenic
978435923 4:108684534-108684556 AAAAAGCATGTACACCAAGGGGG - Intergenic
1018810420 6:167294516-167294538 GAGCAGCCTGTACAGCGAGGAGG + Exonic
1022459902 7:30595077-30595099 GAGCAGCATGGACGGCGCGGGGG + Exonic
1028613311 7:92736495-92736517 GAGCAGCATCTAAGCCAATCTGG + Intronic
1030546292 7:110900414-110900436 GACCAGCATGGACGCTAAGGAGG - Intronic
1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG + Intergenic
1038719349 8:30019620-30019642 GAGGATCATGTAAGCCCAGGAGG + Intergenic
1059448910 9:114357806-114357828 GAGCAGCAAGTATTCCAAGAAGG + Intronic
1059919922 9:119148711-119148733 GATCAGCATATACACCAATGAGG - Intergenic
1061034512 9:128106236-128106258 GAGCAGCATCTACCCAATGGAGG + Exonic
1062287272 9:135778751-135778773 GAGCACCATGAGCGCCGAGGAGG + Exonic
1062655400 9:137602090-137602112 GAGCAGCAGGGATGCAAAGGTGG + Intergenic
1203524531 Un_GL000213v1:73548-73570 GCGCAGCAGGAACGCCATGGTGG + Intergenic
1189709142 X:43791312-43791334 GGGCGGGATGTACTCCAAGGAGG - Intronic
1191100713 X:56724398-56724420 CAGCACCATGGAGGCCAAGGTGG + Intergenic
1191976985 X:66883871-66883893 GAACAGCAAGTAGGCCAATGTGG - Intergenic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic