ID: 1163631407

View in Genome Browser
Species Human (GRCh38)
Location 19:18419649-18419671
Sequence ATGTACGCCAAGGGGGGCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 51}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163631399_1163631407 2 Left 1163631399 19:18419624-18419646 CCCGGCGGCGGCGGCGTGGAGCA 0: 1
1: 0
2: 3
3: 22
4: 190
Right 1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG 0: 1
1: 0
2: 1
3: 1
4: 51
1163631388_1163631407 29 Left 1163631388 19:18419597-18419619 CCGCGGCGCCGCCTGACAGGTGT 0: 2
1: 0
2: 0
3: 2
4: 54
Right 1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG 0: 1
1: 0
2: 1
3: 1
4: 51
1163631398_1163631407 3 Left 1163631398 19:18419623-18419645 CCCCGGCGGCGGCGGCGTGGAGC 0: 1
1: 0
2: 4
3: 36
4: 301
Right 1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG 0: 1
1: 0
2: 1
3: 1
4: 51
1163631391_1163631407 21 Left 1163631391 19:18419605-18419627 CCGCCTGACAGGTGTGGGCCCCG 0: 2
1: 0
2: 0
3: 14
4: 130
Right 1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG 0: 1
1: 0
2: 1
3: 1
4: 51
1163631400_1163631407 1 Left 1163631400 19:18419625-18419647 CCGGCGGCGGCGGCGTGGAGCAG 0: 1
1: 0
2: 5
3: 25
4: 226
Right 1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG 0: 1
1: 0
2: 1
3: 1
4: 51
1163631387_1163631407 30 Left 1163631387 19:18419596-18419618 CCCGCGGCGCCGCCTGACAGGTG 0: 2
1: 0
2: 0
3: 17
4: 90
Right 1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG 0: 1
1: 0
2: 1
3: 1
4: 51
1163631393_1163631407 18 Left 1163631393 19:18419608-18419630 CCTGACAGGTGTGGGCCCCGGCG 0: 2
1: 0
2: 0
3: 9
4: 108
Right 1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG 0: 1
1: 0
2: 1
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163631407 Original CRISPR ATGTACGCCAAGGGGGGCAA GGG Exonic
900512208 1:3066165-3066187 ATGTAGGCCCAGTGGGGAAAAGG - Intergenic
905630562 1:39515876-39515898 ATGTACGCCAATCTGGGCATAGG + Intronic
905667198 1:39770294-39770316 ATGTACGCCAATCTGGGCATAGG - Exonic
908497602 1:64710578-64710600 ATGTAGGGCAAGGGGAGTAAAGG - Intergenic
908819485 1:68069128-68069150 ATGTACATCATGGGTGGCAATGG - Intergenic
911301456 1:96179549-96179571 AAGTAAGCAAAGGGGAGCAAAGG - Intergenic
1068556940 10:58468636-58468658 ATGAATCCCAAAGGGGGCAAGGG + Intergenic
1076002017 10:126919848-126919870 ATGTACGGCAAGGTGTGCCAGGG - Intronic
1076412133 10:130259532-130259554 ATTTATGCCAAGGAGGGCAGAGG - Intergenic
1076539658 10:131206186-131206208 GTGTACGCCAAGGTCCGCAAAGG + Intronic
1080473475 11:32568754-32568776 ATGTACAACATGGGTGGCAATGG + Intergenic
1084462766 11:69305300-69305322 ATGAAGGCCCAGAGGGGCAAAGG - Intronic
1091684901 12:2554715-2554737 ATTAACGCCAAGGTGTGCAAAGG + Intronic
1092164869 12:6336563-6336585 ATGTGGGCCAAGTGGGACAAGGG - Intronic
1098715828 12:73827732-73827754 ATGTACAGGAAGGGGTGCAAAGG + Intergenic
1103527662 12:121578801-121578823 GTGCACGCCATGGAGGGCAAAGG - Exonic
1105745536 13:23374225-23374247 ATGTGTGTCAAGGAGGGCAAAGG + Intronic
1113433585 13:110271131-110271153 ATGTAAGCAAATGGGAGCAAAGG + Intronic
1117041748 14:51774570-51774592 ATGAGAGCCATGGGGGGCAAGGG + Intergenic
1117127899 14:52650979-52651001 ATGAACGGCAGGGGGTGCAATGG + Intronic
1118038380 14:61892396-61892418 ATGGAGGCCAAGGGTGGCCAGGG - Intergenic
1126044895 15:44630231-44630253 ATGTAATCCACGGGGGGCAGCGG - Intronic
1142501677 17:336592-336614 CTGTACGTGAAGAGGGGCAACGG - Intronic
1143109746 17:4546363-4546385 TGGGAGGCCAAGGGGGGCAAGGG - Intronic
1151814544 17:76465143-76465165 AGGTACGACTTGGGGGGCAAAGG + Intronic
1152346665 17:79756736-79756758 ATGTTCGCCAAGGGGTGAACAGG + Intergenic
1153823905 18:8856982-8857004 ATGAAGGCCAAGGTGGGGAAGGG + Intergenic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1159922002 18:74235096-74235118 CTGTAAGCCAAGGGAGGCCAAGG + Intergenic
1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG + Exonic
1168175617 19:54625486-54625508 CTGTAGGCCAAGGGGGGTCAGGG + Intronic
945131306 2:206575742-206575764 ATGTATGGCACGGGGAGCAATGG + Intronic
947586103 2:231357966-231357988 ATCTACTCCAAGCGTGGCAAAGG - Intronic
1171562114 20:26135351-26135373 CTGTACGCCTCTGGGGGCAAGGG - Intergenic
1181973940 22:26714803-26714825 ATGTACGACAGGAGGGGCCAAGG - Intergenic
1185342577 22:50298250-50298272 ATGTAGGCCAAGGGCAGCACAGG + Intronic
953088454 3:39697809-39697831 ATGTCCTTCAAGGGGGACAAGGG + Intergenic
959593799 3:108107101-108107123 ATATATGCCAAGTGGAGCAATGG + Intergenic
962459009 3:135591631-135591653 ATGTACGCCACTTGGGGGAAGGG + Intergenic
974097243 4:57376865-57376887 ATCTAAACCAAGGGGGGAAATGG - Intergenic
985354248 4:189100379-189100401 ATGTACGGCACAGGGGGCAGAGG + Intergenic
994192758 5:96886519-96886541 ATGACCTCCTAGGGGGGCAATGG - Intronic
996898795 5:128519878-128519900 AAGGAAGCCAAGGGGGGAAAAGG + Intronic
1002132763 5:177091627-177091649 ATGTCCACCAAGGGGGCCAGAGG - Intronic
1004194898 6:13494387-13494409 ATGTAAGCCTACTGGGGCAAGGG + Intergenic
1005821146 6:29600253-29600275 TTGTACCCCAAGGGGTGCAAAGG - Intronic
1006402294 6:33824941-33824963 GTGTGCGCCAAGGGTGGCAGGGG + Intergenic
1019324921 7:433363-433385 ATGCAAGATAAGGGGGGCAAAGG - Intergenic
1035261294 7:157663185-157663207 AGGTACGGCAGGGGTGGCAAGGG + Intronic
1044696827 8:94932015-94932037 ATGTATGCATAGGGAGGCAAAGG - Intronic
1049929924 9:446355-446377 ATGTAGGCCTAAGGGGGAAAAGG - Exonic
1185889985 X:3815061-3815083 AAGTACGCCAATGGGGTAAAGGG - Intergenic
1193819460 X:86144583-86144605 ATGAATTCCAAGGGAGGCAAAGG - Intergenic
1195323209 X:103737726-103737748 ATGTATGCCCAGGGTTGCAAGGG - Intergenic