ID: 1163631413

View in Genome Browser
Species Human (GRCh38)
Location 19:18419683-18419705
Sequence CTCGCGGGCCTGGCTGTCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 2, 1: 0, 2: 3, 3: 10, 4: 126}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163631413_1163631425 1 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631425 19:18419707-18419729 AGTGAGTGCGGGGCCGGGGGCGG 0: 1
1: 0
2: 5
3: 117
4: 1065
1163631413_1163631417 -10 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631417 19:18419696-18419718 GGCCCGCGAGAAGTGAGTGCGGG 0: 1
1: 0
2: 1
3: 7
4: 79
1163631413_1163631424 -2 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631424 19:18419704-18419726 AGAAGTGAGTGCGGGGCCGGGGG 0: 1
1: 0
2: 0
3: 17
4: 252
1163631413_1163631418 -9 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631418 19:18419697-18419719 GCCCGCGAGAAGTGAGTGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 55
1163631413_1163631431 28 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631431 19:18419734-18419756 CGGCGTCCGCGCTCTTCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 22
1163631413_1163631423 -3 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631423 19:18419703-18419725 GAGAAGTGAGTGCGGGGCCGGGG 0: 1
1: 0
2: 0
3: 18
4: 252
1163631413_1163631421 -5 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631421 19:18419701-18419723 GCGAGAAGTGAGTGCGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 174
1163631413_1163631430 27 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631430 19:18419733-18419755 TCGGCGTCCGCGCTCTTCCGTGG 0: 1
1: 0
2: 1
3: 1
4: 36
1163631413_1163631426 2 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631426 19:18419708-18419730 GTGAGTGCGGGGCCGGGGGCGGG 0: 1
1: 2
2: 7
3: 151
4: 1243
1163631413_1163631422 -4 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631422 19:18419702-18419724 CGAGAAGTGAGTGCGGGGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 187
1163631413_1163631427 3 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631427 19:18419709-18419731 TGAGTGCGGGGCCGGGGGCGGGG 0: 1
1: 1
2: 8
3: 150
4: 1104
1163631413_1163631428 8 Left 1163631413 19:18419683-18419705 CCTCCGACAGCCAGGCCCGCGAG 0: 2
1: 0
2: 3
3: 10
4: 126
Right 1163631428 19:18419714-18419736 GCGGGGCCGGGGGCGGGGCTCGG 0: 3
1: 13
2: 142
3: 857
4: 3093

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163631413 Original CRISPR CTCGCGGGCCTGGCTGTCGG AGG (reversed) Exonic
900318032 1:2069155-2069177 CTCCCGGGCGGGGCTGACGGAGG - Intronic
900987219 1:6080202-6080224 CTCCTGGGCCTGGATGTGGGAGG + Intronic
901148533 1:7084796-7084818 CTAGAGGGGCTGGCTGTCCGTGG + Intronic
905339147 1:37266453-37266475 CTCGCAGTCCTGGCTGCTGGCGG - Intergenic
905787653 1:40770791-40770813 CTGGGGGGCCTGCCCGTCGGAGG - Exonic
907447464 1:54518022-54518044 CTTGATGGCCTGGCAGTCGGGGG + Intergenic
920363793 1:205437435-205437457 CCCTTGGGCCTGGCTGTAGGAGG + Intronic
920530009 1:206694956-206694978 CTCGTGAGCCTGGCAGTCAGAGG - Intronic
1063449707 10:6143267-6143289 CTCGTGGGCCTGGCTGTAGATGG - Intergenic
1067851568 10:49758320-49758342 CTCGGGGGCCGGGCTGTGGCAGG - Intronic
1068560812 10:58512876-58512898 CGCGCGGGCGTTGCTGGCGGGGG + Intergenic
1070127569 10:73634525-73634547 CCCGCGGGCCAGGCTGGCAGAGG - Exonic
1071561519 10:86649798-86649820 CTCGCTGGCATGGCTGGAGGTGG - Intergenic
1073504021 10:103967646-103967668 CGCGCGAGCCCGGCTGGCGGCGG - Exonic
1074855057 10:117467274-117467296 CTCCCTGGCCTCGCTGTAGGTGG + Intergenic
1075314010 10:121437749-121437771 CACTCGGGCCTGGCTGTGGGAGG + Intergenic
1075654086 10:124149905-124149927 CTCCCAGGCCTGGCTGACAGGGG + Intergenic
1076917389 10:133431135-133431157 CTAGAGGACCTGGCTGTCGTGGG - Intergenic
1076937484 10:133575894-133575916 CTAGAGGACCTGGCTGTCGTGGG - Intergenic
1077034919 11:489904-489926 CCCGCAGGCCTGGCTGGTGGCGG + Exonic
1077228188 11:1447392-1447414 CTCCCAGGCCTGGCTGCCTGGGG + Intronic
1083753932 11:64778894-64778916 GTCGCGGGATTGGCTGTCGCTGG + Intergenic
1085442489 11:76577383-76577405 CCCTGGGGCCTGGCTGTCTGGGG - Intergenic
1089564699 11:119364393-119364415 CCCGCGGGCCTGCCTGGCCGGGG - Intronic
1089621096 11:119722661-119722683 CTCGGGAGCCTGGCTGCCTGTGG - Intronic
1096774329 12:53955082-53955104 CTCCCTGTCCTGGCCGTCGGCGG + Exonic
1104019134 12:124980247-124980269 CTCGGGGCCCTGGAGGTCGGCGG - Intronic
1106130037 13:26932485-26932507 CTGTCGGGCCTGGCTGTTGAAGG + Intergenic
1110442213 13:75538258-75538280 TTCGCTGGCCTAGCTGTGGGCGG + Intronic
1114485156 14:23057640-23057662 CGCGCGGGCCCGGCTGGCCGGGG - Intergenic
1115545514 14:34462272-34462294 CGGGCGGGCCTGGCGGCCGGGGG - Exonic
1117548650 14:56812380-56812402 CTCGTGGCGCTGGCTGTCGGAGG + Intergenic
1120064011 14:80018552-80018574 CTCGGGGGCCTGTCTGAGGGTGG - Intergenic
1121180648 14:91926169-91926191 ATGGAGGGCATGGCTGTCGGGGG - Intronic
1122130717 14:99603402-99603424 CAGGCTGGCCTGGCTGTCGATGG + Exonic
1124109231 15:26772196-26772218 CTCGGGGGCCTGGCTGGCGTCGG - Intronic
1125805597 15:42491011-42491033 CTCCCTCGCCTGGCTCTCGGCGG - Intronic
1126761159 15:51971477-51971499 CTCGAGGCTCTGGGTGTCGGTGG - Intronic
1129879189 15:78995968-78995990 CTGGCGCTCCTGGCTGTGGGAGG + Intronic
1131428688 15:92368610-92368632 CTCGCAGGCCTCACTCTCGGTGG + Intergenic
1132797466 16:1732266-1732288 ATCGCAGCCCTGGCTGTGGGAGG - Intronic
1132975584 16:2709694-2709716 CCCCAGGGCCTGGCTGTCTGAGG + Intergenic
1133234736 16:4382568-4382590 CTCGCGGGCCTGGGTGACTGGGG - Exonic
1134077969 16:11305444-11305466 CTCCCGGGCCTGGCTGGGCGTGG + Intronic
1136281704 16:29217285-29217307 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1140727842 16:77830032-77830054 CTCGAGGGGCTGGCTGGAGGTGG - Intronic
1141684949 16:85564865-85564887 CCCGCACGCCTGGCTGTCTGAGG - Intergenic
1141799608 16:86297977-86297999 CTCAGGGGCCTGGCTTTGGGAGG - Intergenic
1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1142371860 16:89686970-89686992 CTCCAGGGACCGGCTGTCGGGGG - Intronic
1142383644 16:89748475-89748497 GTCGCCGTCCTGGCTGTGGGTGG + Intronic
1142401458 16:89860856-89860878 CTCCCAGACCTGGCTGGCGGCGG - Intronic
1142742996 17:1941590-1941612 CTCGGGGGCCAGGCGGTGGGGGG + Intronic
1144687728 17:17237164-17237186 GTCACGCGCCTGGGTGTCGGCGG - Exonic
1145388367 17:22435389-22435411 CAGGCGGGGCTGGCTGTTGGAGG + Intergenic
1148238180 17:45983212-45983234 CTGGGGGGCCTGGCTCTCGGAGG - Exonic
1148850137 17:50550628-50550650 CAGGCAGGCCTGGCTGTGGGAGG + Intronic
1151395059 17:73817564-73817586 CTCGTGGGCCTTCCTGCCGGAGG + Intergenic
1152065226 17:78108689-78108711 CTCGTGGGCCTGGGTGTCCAGGG + Exonic
1152109866 17:78352063-78352085 CTCGGGGGACTGGCCGTAGGTGG + Intergenic
1152559073 17:81068830-81068852 CTTGCGTTCCTGGCTGTGGGAGG + Intronic
1152676760 17:81645250-81645272 CTCTGGGGCCTGGCTGTCAAGGG + Exonic
1154173759 18:12068362-12068384 CTCGCGGGCCTGGCTGTCGGAGG + Intergenic
1161476475 19:4488686-4488708 CTCGGGGGCCTCGCTGTCGGAGG - Exonic
1162915684 19:13873275-13873297 CTCGGGGGCGGGGCTCTCGGGGG + Intronic
1163631413 19:18419683-18419705 CTCGCGGGCCTGGCTGTCGGAGG - Exonic
1168341383 19:55624847-55624869 CTCGAGGCTCTGGCTGTCAGGGG + Intergenic
927917456 2:26946155-26946177 CTCGTGGGTCTGGCTGCAGGAGG - Intronic
929777297 2:44937330-44937352 CTCCTGGGCCTGGCAGTGGGAGG + Intergenic
930046337 2:47176169-47176191 CTCGGGGGCTTGGCTGGAGGAGG - Intronic
930873880 2:56192757-56192779 CAGGCTGGCCTGGCTGTCGATGG - Exonic
930951290 2:57146615-57146637 CTGGCGGGAGTGGCTGTCGTTGG - Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
937205014 2:120230848-120230870 CTCCAGGGCCTGGCTCTCAGTGG - Intergenic
937347055 2:121132584-121132606 CTCAGGGACCTGGCTGTCTGTGG + Intergenic
941104722 2:161340272-161340294 CTGGCTGGCTTGGTTGTCGGGGG - Intronic
947298866 2:228665807-228665829 CACCGGGGCCTGTCTGTCGGGGG + Intergenic
948823243 2:240560840-240560862 CGCGCGGGCCGGGCTGCTGGCGG - Exonic
948989890 2:241548397-241548419 CCATCGGGCCTGGCTGTGGGAGG - Intergenic
1168804385 20:663910-663932 CTCGCGGCCCTGGCTGCTGCAGG - Exonic
1170578620 20:17681973-17681995 CGCGCGGGCCGGGCCGTCGGGGG - Intronic
1170852573 20:20017876-20017898 CTCTGCGGCCTGGCCGTCGGCGG - Intronic
1170882012 20:20305086-20305108 CGCGAGGGCCGGGCTGTCTGAGG - Intronic
1173279730 20:41617971-41617993 GCCGCGGGCCTGGCGGGCGGGGG - Intronic
1175220837 20:57415457-57415479 CTGGTGGGCCGGGCTGTGGGCGG - Intergenic
1175859423 20:62142654-62142676 CTCGCTGGCCTGGCCGGTGGCGG - Intronic
1175885520 20:62288315-62288337 CTGGAGGGCCTGGCTGTGGTGGG + Intronic
1178555657 21:33588342-33588364 CTCGCGGGCCGGCCCGTCGGGGG + Exonic
1179595664 21:42441517-42441539 CTCGGGGGCCTGGTTGATGGGGG + Intronic
1179595704 21:42441626-42441648 CTCGGGGGCCTGGTTGATGGGGG + Intronic
1180183072 21:46126604-46126626 CTCGAGGGCCGGGCTGGGGGAGG + Intronic
1184673435 22:46027678-46027700 CTCGCGGGCCCAGCTGGCCGGGG - Intergenic
950569912 3:13793428-13793450 CTTGCGGGCCTGGCTGGCACAGG - Intergenic
950711865 3:14819030-14819052 CTCTCGGGCCTGGCTGAGGAAGG - Exonic
954133619 3:48572135-48572157 CTCGCGGCCCTGGCAGTCCTCGG + Exonic
955753187 3:62203341-62203363 CTCGCCGGCCTGGGGTTCGGCGG + Exonic
961542621 3:127610332-127610354 CTCCAGGGCCTGGCTGCAGGAGG + Intronic
964339973 3:155698020-155698042 CCCGCTGGCCTGGCTGTTGGTGG - Intronic
968061073 3:195726515-195726537 GTCGTGGGCGTGGCTGTTGGGGG - Exonic
968086539 3:195876544-195876566 GGAGCGGGCCTGGGTGTCGGTGG - Intronic
968293486 3:197556006-197556028 CACGGCGGCGTGGCTGTCGGGGG + Intronic
969603227 4:8189245-8189267 CTGGCGGGCCTTGCTCTCTGTGG - Intronic
970469338 4:16361039-16361061 CTCGCGTGCCTTGCTCTCCGCGG + Intergenic
981782086 4:148442248-148442270 CTCGCTGGCCTGGATGTGGTTGG - Exonic
988925904 5:35991012-35991034 CTTGCGGACCTGGCTGGAGGAGG - Intronic
997237154 5:132279333-132279355 CGCGCGCGCGTGGGTGTCGGGGG - Intronic
1001577543 5:172773944-172773966 CTTGTGGGCCTGGCTGCCAGAGG + Intergenic
1002885573 6:1290605-1290627 ATCCCAGGCCTGGCTGTAGGAGG - Intergenic
1003107782 6:3228598-3228620 CCCGGGGGCGGGGCTGTCGGCGG + Intronic
1012465836 6:99515481-99515503 CTCCCGGTCCTGGCTGGGGGCGG - Intronic
1013225613 6:108117960-108117982 CGCGCGGTCCTTGCTGTCAGCGG - Intronic
1017651105 6:156583324-156583346 CACGTGGGCCTGGATGTGGGTGG - Intergenic
1018774126 6:166998584-166998606 CGCCGGCGCCTGGCTGTCGGCGG + Intergenic
1019277586 7:184046-184068 CTCCCGGTGCTGGCTGTGGGTGG - Intergenic
1021828061 7:24573796-24573818 CGCGCGGGCCGGGCTGGGGGCGG - Intronic
1023810291 7:43906418-43906440 CTGGTGGGCCTGGCGGGCGGGGG + Intronic
1033528912 7:142243981-142244003 ATCGTGGGCTGGGCTGTCGGGGG - Intergenic
1034415487 7:150962295-150962317 TTCGAGGGCCTGGCTGGCTGTGG - Intronic
1034430948 7:151040901-151040923 CTCGTGGGCCAGTCTGGCGGAGG + Exonic
1034446381 7:151116113-151116135 GATGGGGGCCTGGCTGTCGGAGG + Intronic
1036701006 8:11013919-11013941 CCTGCGGGCCTGGATGTTGGTGG - Intronic
1037855245 8:22367118-22367140 CTCGCGGCCCTGGCTGTGGTCGG - Intergenic
1037947640 8:22999358-22999380 CTCGCGGGTCTGGGTGGCGCCGG - Intronic
1039119495 8:34129994-34130016 CTCTTGGGCATGGCTGTGGGTGG + Intergenic
1049761397 8:144333439-144333461 CTCGCGGCCCTGGCTGCTGCAGG - Exonic
1053022076 9:34701750-34701772 CTCGGGGGCCTGGGTGGCAGGGG - Intergenic
1056672291 9:88640469-88640491 CTCCCGAGCCTGGATGTGGGAGG - Intergenic
1059197089 9:112380262-112380284 CTGGCCGGCCCGGCTGTGGGAGG + Intronic
1060847535 9:126849215-126849237 CTCGCAGGCCAGGCTGGTGGAGG - Intergenic
1060996113 9:127875645-127875667 CTCGGGGGCATGGATGTCTGGGG - Intronic
1061110750 9:128568564-128568586 CTCGCTGGCCAGGCTTTCAGAGG + Intronic
1061613254 9:131762591-131762613 CTGGCGGGCCTGGCTGCCGGCGG + Intergenic
1062001134 9:134216326-134216348 CTCACAGGCCTGGCTGCCCGTGG + Intergenic
1062452725 9:136622295-136622317 CTCGCTGGCCTGGCTCTCGGAGG - Intergenic
1062503525 9:136861428-136861450 CTCTGAGGCCTGGCTGTGGGTGG + Intronic
1062615002 9:137392373-137392395 AACCCAGGCCTGGCTGTCGGGGG + Intronic
1062637328 9:137498475-137498497 CTCGCGGGCCTGCCAGGAGGGGG - Intronic
1062646750 9:137551750-137551772 CTCGCGGGGCTGGCGGTGCGGGG - Exonic
1185641558 X:1591789-1591811 CTCCCGGGCCTGGCTGCAGCCGG + Intronic
1192495987 X:71616942-71616964 CTCACCTGCCTGGCTGTCTGGGG - Exonic
1198107907 X:133478493-133478515 CTCTCGGGCCTGATTGTCAGAGG + Intergenic