ID: 1163633282

View in Genome Browser
Species Human (GRCh38)
Location 19:18427618-18427640
Sequence CAGGGTGGGCAGAGGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 834
Summary {0: 1, 1: 1, 2: 13, 3: 85, 4: 734}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163633282_1163633299 22 Left 1163633282 19:18427618-18427640 CCTGGGGCCCTCTGCCCACCCTG 0: 1
1: 1
2: 13
3: 85
4: 734
Right 1163633299 19:18427663-18427685 TCCCTGCCCAGATGTTCTCTGGG 0: 1
1: 0
2: 1
3: 30
4: 246
1163633282_1163633298 21 Left 1163633282 19:18427618-18427640 CCTGGGGCCCTCTGCCCACCCTG 0: 1
1: 1
2: 13
3: 85
4: 734
Right 1163633298 19:18427662-18427684 CTCCCTGCCCAGATGTTCTCTGG 0: 1
1: 0
2: 2
3: 30
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163633282 Original CRISPR CAGGGTGGGCAGAGGGCCCC AGG (reversed) Intronic
900212262 1:1461933-1461955 CACGGTGGGCAGAGCCCTCCAGG + Intronic
900224934 1:1528584-1528606 CACGGTGGGCAGAGCCCTCCAGG + Intronic
900238480 1:1603680-1603702 CAGGGAGGGGACAGAGCCCCTGG + Intergenic
900342312 1:2194874-2194896 CAGGCTGGGATCAGGGCCCCTGG - Intronic
900422223 1:2560582-2560604 CAGAGGGGGCTGAGGGCACCAGG - Intronic
900464452 1:2818289-2818311 CAGGGCTGGCTGGGGGCCCCAGG + Intergenic
900478239 1:2886181-2886203 CAGGCTGGGGACAGGGCTCCAGG + Intergenic
900479677 1:2891944-2891966 CTGGGCAGTCAGAGGGCCCCGGG + Intergenic
900554861 1:3275399-3275421 AGGGGTGGGCAGAGGGGCCAGGG - Intronic
900623366 1:3597278-3597300 CAGGGTGGGCAGGCGGATCCTGG - Intronic
900791526 1:4684027-4684049 GGGAGTGAGCAGAGGGCCCCGGG + Intronic
900862176 1:5241573-5241595 CAGGGAGGGCAGCTGGCCCAGGG - Intergenic
901024909 1:6274078-6274100 CACGGTGTGCAGAGGGGCCTGGG - Intronic
901529108 1:9842661-9842683 CAGGGTGGCCAGAGGCCTCTGGG - Intergenic
902229951 1:15021571-15021593 CCAGGAGGGCGGAGGGCCCCGGG - Intronic
902697317 1:18149156-18149178 CAGGCTGGACAGAGGGGCTCAGG - Intronic
902733213 1:18383532-18383554 CTGGCTGTGCAGAGGCCCCCTGG + Intergenic
902773866 1:18661847-18661869 GGGGGTGGGCGGAGGGCGCCGGG + Intronic
903341229 1:22655774-22655796 CAGAGTGGCCACAGGGACCCAGG - Intronic
903377662 1:22876715-22876737 CAGGGTGGGCGGTGGGCAGCAGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
903849505 1:26297497-26297519 CAGGGTGAGCACAGGGCCTGTGG + Intronic
904069510 1:27782603-27782625 CAGGGTGGGCAGATCGCCTCAGG + Intronic
904130841 1:28274047-28274069 CTGGGTGTGGAGAGGGCTCCAGG - Exonic
904912984 1:33949341-33949363 TGGGGAGGGCAGATGGCCCCAGG + Intronic
904935974 1:34129887-34129909 GAGGGTGAGCAGGGCGCCCCAGG - Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
905485381 1:38292420-38292442 CAGGCTGGGCAGCGGGCCGGTGG - Intergenic
905864462 1:41369131-41369153 CAAGGTGGGCTGAGGGCCTATGG - Intronic
906680830 1:47724680-47724702 CAGGCAGGTCAGAGGGCACCTGG - Intergenic
907237524 1:53062327-53062349 CGGGGTGGGCCGAGGGGCCGGGG + Intronic
907304387 1:53505684-53505706 CAGGGTGGGCACAGGGCTTCTGG + Intergenic
907359950 1:53906319-53906341 CAGGGAGGGCAAAGGGGCCCAGG + Intronic
907452027 1:54551603-54551625 GAGGCTGGGCAGAGGTTCCCAGG - Intronic
907548698 1:55285863-55285885 CAGGGTGGTGACAAGGCCCCAGG + Intergenic
908208092 1:61871794-61871816 CAGGGTGGGCAGATAGCCTGAGG - Intronic
908252279 1:62274539-62274561 CAGGAGGGGCAGGGGGCCCCAGG + Exonic
911123591 1:94319801-94319823 AAGGGTGGGCAGAGTGACCCTGG - Intergenic
912430694 1:109626976-109626998 CAGGCAGGGCAGAGGTGCCCAGG - Intronic
914897306 1:151688202-151688224 CAGGGTGGTCAGAGAGACTCAGG + Intronic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
915917596 1:159950325-159950347 CAGGGTGGGTTGGGGGCCCTGGG - Intergenic
918180711 1:182084314-182084336 CAGTGTGGGGAGAGGACTCCAGG - Intergenic
919923366 1:202179124-202179146 CAGGGTGGGCAGTGGGGCCGAGG - Intergenic
919973449 1:202595452-202595474 CATGGAGGGCAGAGGGCCAAGGG + Exonic
920007678 1:202845248-202845270 CAGGCTGCCCAGAGTGCCCCAGG + Intergenic
920055906 1:203191500-203191522 CAGGGTGGTCAGACATCCCCTGG - Intergenic
920216245 1:204363236-204363258 CAGGCTGGGCAGTGAGACCCCGG - Intronic
920854717 1:209653106-209653128 CAGGGTTGGCAGGGAGCCCTGGG + Intergenic
921080445 1:211735116-211735138 CAAGGTGGGCAGTGGCCCTCTGG - Intergenic
921582966 1:216916247-216916269 CAGGGAGAGCTGAGGGTCCCTGG - Intronic
921637456 1:217513055-217513077 CAAGGTGGGCAGAAGGCCTGAGG + Intronic
922695304 1:227728410-227728432 CAGGGCGGGCGGCGGGGCCCAGG - Intergenic
922698070 1:227741624-227741646 GAGGGTGGGATCAGGGCCCCGGG + Intronic
922724523 1:227916178-227916200 CAGGGTGGGCCCAGGGCCAGTGG + Intergenic
922726077 1:227923683-227923705 CATGGTGGGCAGGGGATCCCAGG - Intronic
922779408 1:228239934-228239956 CTGGGTCTGCAGAGGGCCCGAGG + Intronic
923070800 1:230562747-230562769 CATTGTGGCCAGAAGGCCCCAGG - Intergenic
923565963 1:235076105-235076127 GGGAGTGGGTAGAGGGCCCCTGG - Intergenic
924143011 1:241045856-241045878 CAGGGAAGGCAAAGGGGCCCTGG + Intronic
924585046 1:245354625-245354647 CAAGGTGGACACAGTGCCCCTGG - Intronic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
924740176 1:246790248-246790270 CAGGGAGGGGAGAGGGCTGCTGG + Intergenic
924955780 1:248925317-248925339 AAGGGCGGGCAGTGGGGCCCAGG + Intergenic
1064292724 10:14050641-14050663 CAGGGAGGGCAGGGGGCCTACGG + Intronic
1065814086 10:29469351-29469373 CAGAGTGGACACAGGGGCCCTGG + Intronic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1067124780 10:43506890-43506912 CAGGATGGTCCCAGGGCCCCTGG + Intergenic
1067566210 10:47339734-47339756 CAGGGAGGGCTCAGGGCCCAGGG - Intergenic
1069745966 10:70715301-70715323 CAGGCTGGGAACAGGACCCCAGG + Intronic
1070360735 10:75686156-75686178 CAGGGAGGACAGAGGGCCACTGG + Intronic
1070637291 10:78139622-78139644 CAGGGTGGGCAGGCAGCCCAGGG + Intergenic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070792876 10:79200167-79200189 CAGGGAAGGCTTAGGGCCCCAGG + Intronic
1070830518 10:79415352-79415374 GACGGTGGGCAGAGGGCCTCTGG + Intronic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1071208599 10:83312732-83312754 CAGGGCTGGCAGGGGGCCACTGG - Intergenic
1072586697 10:96789281-96789303 CAAGGTGGGCAGATGGCCTGAGG - Intergenic
1073206352 10:101771346-101771368 CAAGGTAGGCAGAAGGCCACAGG - Intronic
1073471835 10:103727403-103727425 CAGGGAGGACAGGGGGCCCCAGG + Intronic
1074968727 10:118517790-118517812 CAGGGTCCTCAGAGGTCCCCAGG - Intergenic
1075119348 10:119652265-119652287 CAGGGTGCGCCGCGGGTCCCGGG - Intronic
1075782812 10:125027682-125027704 CTGGGTGGTACGAGGGCCCCTGG - Exonic
1075950576 10:126474191-126474213 CATGATGGGCAGAGACCCCCGGG - Intronic
1076119278 10:127922751-127922773 GTGGGTGGGCTGAGAGCCCCAGG + Intronic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076528123 10:131125641-131125663 CAGGGTGGGCTGCAGGCCCCTGG + Intronic
1076606883 10:131695057-131695079 CAGGGTGTCCAGTGGGTCCCTGG + Intergenic
1076624079 10:131810981-131811003 CAGGGTGGGAGGAAGGCCCTGGG - Intergenic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076694186 10:132239236-132239258 CCGGCTGGACCGAGGGCCCCAGG - Intronic
1076727957 10:132422052-132422074 CTCGGAGGGCAGAGGGCGCCAGG + Intergenic
1076736326 10:132460827-132460849 CCAGGTGGGGACAGGGCCCCTGG - Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1076887437 10:133269142-133269164 CTGGGTGGCCTCAGGGCCCCGGG + Intronic
1077133234 11:985378-985400 CAGGGTGGGCTGCGGGCCACTGG + Intronic
1077134447 11:991567-991589 CAGTGAGGCCTGAGGGCCCCTGG + Intronic
1077191771 11:1258696-1258718 CTGGGTGGGCAGAGACCCCATGG - Intronic
1077228798 11:1449629-1449651 CAGGGTGTGCAGCAGGACCCAGG + Intronic
1077231606 11:1460287-1460309 CAGGGTGGGCAGGCGGCGGCCGG - Intronic
1077305362 11:1866539-1866561 CAGGATCTGCAGTGGGCCCCTGG + Exonic
1077305817 11:1868315-1868337 AAGGGTGGGCACGGGGCTCCGGG - Intronic
1077340645 11:2024889-2024911 CAGGTTGGGCAGAGACCCCCAGG + Intergenic
1077403249 11:2369248-2369270 CAGGGAGGGGAGGGGACCCCAGG - Intergenic
1077476319 11:2792113-2792135 CAGGGGTGGCGGAGGGACCCGGG - Intronic
1077544380 11:3162927-3162949 CAGGGTTGGCAGGGGAGCCCAGG - Intronic
1077551613 11:3203037-3203059 CAGGGCAGGCAGCGGGCTCCAGG - Intergenic
1078463081 11:11530208-11530230 CAGAGTGGGGAAGGGGCCCCTGG + Intronic
1079358169 11:19747669-19747691 CAGGGGGAGCAGAGGACGCCAGG - Intronic
1080540358 11:33258192-33258214 GAGGGGGGGCCGAGGCCCCCGGG - Intronic
1080679562 11:34461416-34461438 CTGCGTGGGCAGAGGGCACGTGG + Intronic
1081763114 11:45590975-45590997 CAGAGATGGCAGAGTGCCCCTGG - Intergenic
1081964872 11:47163426-47163448 AAGGATGGGCAGAGGGAGCCAGG - Intronic
1082774615 11:57235820-57235842 CGGGGAGGGCCGAGGGCGCCAGG + Exonic
1083144511 11:60748621-60748643 CAAGGAGTTCAGAGGGCCCCAGG - Intergenic
1083222788 11:61264523-61264545 CAGGGTCGGCACAGGCCCGCTGG + Exonic
1083263690 11:61536491-61536513 CAGGGCAGTCAGAGGGCCACTGG - Intronic
1083302480 11:61746175-61746197 CAGGGTGGGCAGGGGCTCCCAGG - Exonic
1083592564 11:63904174-63904196 TAGGGTGGGCTGAGGGCAGCAGG - Intronic
1083657678 11:64237522-64237544 CAGCGTGGGCAGAGGGGCCTGGG - Exonic
1083680342 11:64348841-64348863 CTGGGGGGGCAGGGGGCGCCAGG - Intronic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084114347 11:67033154-67033176 CAGAGTGGGCAGAGTGGCCGGGG - Intronic
1084267295 11:68011670-68011692 CATGGTGGGTAGAGGGCCTGGGG - Intronic
1084312871 11:68326847-68326869 CATGGTGGGGAGGGGTCCCCGGG + Intronic
1084387970 11:68855733-68855755 CGGGGTGGGCCGGGAGCCCCTGG - Intergenic
1084399231 11:68934082-68934104 CAGGGTGAGCAGACCGCTCCTGG + Intronic
1084422449 11:69067115-69067137 CAGGAGGAGCAGAGGGGCCCAGG - Intronic
1084462114 11:69301970-69301992 CAGTGAGGTCAGAGGGCTCCCGG - Intronic
1084476757 11:69393806-69393828 CAGGGTGGGCAGCTGGCCCCAGG + Intergenic
1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG + Intergenic
1084617719 11:70247504-70247526 CAGAGTGGGGAGAGGGCCCCTGG - Intergenic
1084643071 11:70437369-70437391 CAGGGTGGGCAGACGGGGTCAGG + Intergenic
1084736491 11:71108727-71108749 CAGAGGGGACAGAGTGCCCCCGG - Intronic
1085272646 11:75279357-75279379 CAGGGAGGGGAGAAGGCCCATGG + Intronic
1085297864 11:75441136-75441158 GTTGGGGGGCAGAGGGCCCCTGG - Intronic
1085301239 11:75459986-75460008 CAGGGAGGGCAGATGCCCCATGG - Intronic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1087855929 11:103091889-103091911 CAGGGTGGGCAGGGGAGCCGGGG + Exonic
1088911901 11:114198523-114198545 GAAGGTGGCCAGAGGGGCCCTGG - Intronic
1089089853 11:115862482-115862504 CATGGTGGGCACAGAGCCTCTGG - Intergenic
1089127753 11:116189394-116189416 CTGGATGGGCTGAGGGGCCCAGG - Intergenic
1089201329 11:116726279-116726301 GAGGGTGGGCAGCGGGCTCTAGG - Intergenic
1089300802 11:117497653-117497675 GGGGGTGGGCACTGGGCCCCAGG + Intronic
1089327805 11:117669288-117669310 CAGGGTGGGCAGATGGTCTGGGG + Intronic
1089394763 11:118129348-118129370 AAGGCTGGGGAGAGGGCCCCAGG - Intergenic
1089651962 11:119920407-119920429 CAGGCTGGGCTGAGGGCTGCTGG - Intergenic
1089696559 11:120219496-120219518 GAGGGTGGGGAGGGAGCCCCTGG - Intronic
1090191891 11:124777068-124777090 CAAGGAGGGCAGAGGGCGCTGGG - Intronic
1090242222 11:125192254-125192276 TAGGGTTGGCAGAAGGCTCCAGG + Intronic
1090616587 11:128521485-128521507 GAGGCTGGGTGGAGGGCCCCGGG - Intronic
1090636648 11:128694140-128694162 CAGGGAGGGCCCAGGGCGCCAGG + Exonic
1091106012 11:132920567-132920589 CAGGGTGCACACATGGCCCCAGG + Intronic
1091369160 11:135044402-135044424 CCAGGTGGGCAGTGGTCCCCAGG + Intergenic
1202823630 11_KI270721v1_random:80078-80100 CAGGTTGGGCAGAGACCCCCAGG + Intergenic
1092164630 12:6335419-6335441 CATGGTGTGCAGGGGGCTCCAGG - Intronic
1093641186 12:21528099-21528121 CAGGGTGTGCAGAGGTCCCCAGG + Intronic
1094541793 12:31368977-31368999 CAGGCTGGCCACAGGCCCCCAGG + Intergenic
1095386042 12:41651071-41651093 CTGGGTTGGGAGAGGGCTCCTGG + Intergenic
1096228550 12:49884623-49884645 CAGGCTGGGCACAGGACACCTGG + Intronic
1096242624 12:49967440-49967462 CAGGGTGGACAGTGGACCCTTGG + Intronic
1096259686 12:50082878-50082900 CAGGGAGGGCCGAGGGTGCCCGG - Exonic
1096434415 12:51576605-51576627 CAGGGTGCGCAGTAGGCCCTAGG + Intergenic
1097192473 12:57226109-57226131 CAGGGTGGGGTGAGGGTGCCAGG - Exonic
1097246646 12:57611058-57611080 CCGAGTGGACAGAGGCCCCCTGG - Intronic
1097686049 12:62691844-62691866 CCAGCAGGGCAGAGGGCCCCAGG - Intronic
1098194278 12:67983456-67983478 CAGGGTGTGCAGAGGTCACATGG - Intergenic
1101340971 12:103841407-103841429 CAGGCTGGGCGTGGGGCCCCCGG - Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1102171604 12:110846873-110846895 CTGGGAGGGCACAGGGCCCTCGG - Intronic
1102289439 12:111686775-111686797 CAGGGTGGGGAGGAGGACCCCGG - Intronic
1102534534 12:113570653-113570675 CAGGGTGGGCAGGGGGGCGGGGG + Intergenic
1103737758 12:123071158-123071180 TAGGGTGGGCAGAGGGCTGCAGG + Intronic
1103749958 12:123151488-123151510 CAGGGAGGGCAGAGCGCAGCGGG + Intergenic
1103782601 12:123409033-123409055 CAGGGTGGGCAGGAGACACCAGG - Exonic
1103968247 12:124653506-124653528 CAAGGTGGGGACAGGGCTCCAGG - Intergenic
1104774110 12:131382241-131382263 CAGAGAGGGCACAGTGCCCCGGG - Intergenic
1104774126 12:131382299-131382321 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774142 12:131382357-131382379 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774157 12:131382412-131382434 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774190 12:131382525-131382547 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774207 12:131382580-131382602 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774225 12:131382636-131382658 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774242 12:131382694-131382716 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774277 12:131382806-131382828 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774293 12:131382861-131382883 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774325 12:131382974-131382996 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774342 12:131383029-131383051 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774358 12:131383085-131383107 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774373 12:131383143-131383165 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774391 12:131383199-131383221 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774408 12:131383257-131383279 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774436 12:131383367-131383389 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104774453 12:131383425-131383447 CAGAGAGGGCACAGCGCCCCGGG - Intergenic
1104913608 12:132252263-132252285 CAGGAAGGGCAGAGAGTCCCAGG + Intronic
1104940279 12:132391972-132391994 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940318 12:132392058-132392080 CGGGGTGGCCGGAGGGTCCCTGG - Intergenic
1104940343 12:132392115-132392137 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940370 12:132392172-132392194 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940396 12:132392229-132392251 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940423 12:132392286-132392308 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940450 12:132392343-132392365 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940477 12:132392400-132392422 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940504 12:132392457-132392479 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940543 12:132392543-132392565 CAGGGTGGCCGGAGGGTCCGGGG - Intergenic
1104951799 12:132444470-132444492 CAGGGGAGACAGAGGGCTCCGGG - Intergenic
1105022905 12:132828980-132829002 CCCTGTGGGCAGAGGGTCCCCGG - Intronic
1105217878 13:18300053-18300075 CAGGGTGGGCAGGAGACACCAGG - Intergenic
1108316326 13:49241117-49241139 GGGGGTGGGCAGAGGGGCCTGGG - Intergenic
1108408815 13:50127909-50127931 GAGGGTGCGCAGAGGCCTCCTGG + Intronic
1108903067 13:55436381-55436403 CAGGGCTGGTACAGGGCCCCTGG - Intergenic
1109887245 13:68558226-68558248 GAGAGTGGGCAGTGGGCCACAGG - Intergenic
1111902234 13:94213567-94213589 TCGGGTTGGCAGAGGGCCACCGG + Intronic
1111951695 13:94713203-94713225 CAGCGAGGACAGAGGGGCCCCGG - Intergenic
1112175430 13:97018771-97018793 CAGGGTGAGCACAGGGCCCAGGG - Intergenic
1112344028 13:98576331-98576353 CCGGGTTGGCGGAGGGCCCCAGG - Intronic
1113036190 13:106052453-106052475 CAGGGAGGGCCGCGGGCCCCTGG - Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113671618 13:112179372-112179394 CAGAGTGGGCACAGGGGCTCAGG + Intergenic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1113848419 13:113404890-113404912 CGGCGTGGGGAGAGGGCACCAGG - Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1118410506 14:65472244-65472266 AAGGGTGGGAGGAGGGGCCCTGG + Intronic
1118610013 14:67532917-67532939 AGGGGTGGCCAGAGCGCCCCGGG - Intronic
1118758184 14:68860727-68860749 CAGGGTTGTCAGAGGGTCCCAGG - Intergenic
1119330151 14:73787333-73787355 CAGAGTGGGGAGACGGCGCCTGG - Intronic
1119378584 14:74214452-74214474 AGTGGTGGGCAGAGGGCCCCAGG - Intergenic
1119853016 14:77879470-77879492 CAGTGTGTGCAAAGGGCCCATGG + Intronic
1120645468 14:87069244-87069266 CTGGGTGGTCAGAGGGCCCCGGG - Intergenic
1121285104 14:92729183-92729205 CAGGATGGGCAGAGGTGCGCAGG - Intronic
1121310928 14:92934579-92934601 CAGTGTGGGGACAGGGCCCCCGG + Intronic
1121406978 14:93725105-93725127 CAGGGTGAGGAGGGGGCCCAGGG + Intronic
1121998957 14:98630237-98630259 CAGGGTGGGGAGAGGGCTCTTGG + Intergenic
1122094744 14:99362738-99362760 CAGGGTGCGCAGGGGGCCCTGGG + Intergenic
1122114678 14:99521826-99521848 CACGGTGGGGAGAGGGTACCCGG - Intronic
1122486993 14:102088086-102088108 GAGCGTGGGCAGAGGACCACAGG + Intronic
1122817164 14:104319452-104319474 CAGGGTGGGGAGAGGGTAACAGG + Intergenic
1122881731 14:104693342-104693364 CAGTGAAGGCAGAGGCCCCCAGG + Intronic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1122891215 14:104733131-104733153 GAGGGTGGTCTGAGGGCACCTGG - Intronic
1122901347 14:104783565-104783587 CAGAGTGGGCACAGACCCCCAGG + Intronic
1123935055 15:25190061-25190083 AAAGGTGGGCATAGGGCCCGTGG + Intergenic
1123991866 15:25689417-25689439 CAAGGTGGGGAGACTGCCCCAGG - Intronic
1124011565 15:25843292-25843314 CAGTGTGTGCAGAGGCTCCCAGG + Intronic
1124137664 15:27048954-27048976 CGTGGTGGGCAGCAGGCCCCAGG - Intronic
1124170272 15:27366821-27366843 CAAGGTGGGCAGGGGGACACGGG - Intronic
1125181197 15:36882459-36882481 CAGGGAGGGGACAGGGACCCCGG - Intergenic
1125727813 15:41877018-41877040 CAGGCTGGGCAGGAGGCCCCTGG - Intronic
1125859656 15:42986910-42986932 CAGGGTGGGCTCAGGGGCCGAGG - Intronic
1126100544 15:45115901-45115923 GGAGGTGGGCAGAGGGCACCTGG + Intronic
1127426837 15:58865817-58865839 CGGGCTGGCCTGAGGGCCCCAGG + Intronic
1129069616 15:72939748-72939770 CAGGGTGGGGAGAGGGCTTGGGG + Intergenic
1129200439 15:73995223-73995245 GAGGGTGGGCGGAAGGGCCCAGG - Intronic
1129333192 15:74838220-74838242 CAGGGTGGCCAGAGGCCCTGTGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129696510 15:77743310-77743332 CAGAGGGGACAGAGAGCCCCAGG + Intronic
1130653119 15:85773525-85773547 CGGGGTGGGCACTGGGCCCCAGG + Intronic
1131049021 15:89334421-89334443 CAGGGTGGGCCGCCGTCCCCCGG + Intronic
1131112811 15:89776208-89776230 AAGTCTGGGCAGGGGGCCCCTGG - Intronic
1131521361 15:93118419-93118441 CTGGGAGGGCAGCGGGTCCCTGG - Intergenic
1132028973 15:98425292-98425314 GAGGGAAGGCAGAGGGCCCTAGG + Intergenic
1132314017 15:100878150-100878172 CAGTGTGTGCAGCAGGCCCCAGG - Intronic
1132465271 16:74580-74602 CAGGGTGGGCTGAGAGCCTGGGG - Intronic
1132589456 16:720380-720402 CAGGGAAGGCAGACAGCCCCGGG - Intronic
1132649546 16:1014304-1014326 TAGGATGGGCAGAGGGGACCTGG - Intergenic
1132673527 16:1112349-1112371 CCGGGTGGGCGGTGGGCACCTGG - Intergenic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1133001037 16:2851922-2851944 CAGGCTGGGATGAGGGCCCTGGG + Intergenic
1133034778 16:3028578-3028600 CAAGGAGGTCAGGGGGCCCCTGG + Intronic
1133126428 16:3649757-3649779 CAGATGGGGCAGAGGGTCCCAGG - Intronic
1133188612 16:4116918-4116940 CAGGGCAGGCCGAGTGCCCCGGG - Intergenic
1133236468 16:4389520-4389542 CGGGCTGGGGAGGGGGCCCCAGG - Intronic
1133317034 16:4891282-4891304 CAGTGTGGGAAGGGGGCCCGTGG + Intronic
1133739901 16:8643519-8643541 CAGTGAGGGCAGGGGGCCCCGGG + Intronic
1134006493 16:10821701-10821723 AGGGGTGGGCAGAGGGCCTGAGG + Intergenic
1134044857 16:11093643-11093665 GAGGGTGGGCAGATGCACCCTGG + Intronic
1134265138 16:12686042-12686064 CTGTGTGGACAGAGGGCCACGGG - Intronic
1134691395 16:16192898-16192920 CAGTGAGGGCGGAGGGCCCCAGG + Exonic
1134747639 16:16600477-16600499 GAGGGAGGGCAGAGGGCCTGGGG - Intergenic
1134997828 16:18753182-18753204 GAGGGAGGGCAGAGGGCCTGGGG + Intergenic
1135200864 16:20436747-20436769 GAGGGTGGGCACAGGGCCACTGG - Intronic
1135218251 16:20591120-20591142 GAGGGTGGGCACAGGGCCACTGG + Intergenic
1135748628 16:25038470-25038492 CAGGGTGGGGAGTGGGTACCAGG + Intergenic
1135938896 16:26803909-26803931 GAGGTTGGGCAGAAGGCCCTTGG - Intergenic
1135990827 16:27217788-27217810 CAGGGTTGCCAGAGGGACACAGG - Intronic
1136042405 16:27590713-27590735 CAGGGAGAGGAGAAGGCCCCAGG - Intronic
1136089229 16:27906555-27906577 CAGGAGGTGCAGAGGGCCCCGGG - Intronic
1136294935 16:29296196-29296218 CAGGGTGGGGAGCAGGGCCCTGG - Intergenic
1136708264 16:32209221-32209243 CAGGCCTGGCAGAGGGTCCCTGG - Intergenic
1137557668 16:49482957-49482979 CAGGGTGGCCAGGGGGCACCTGG + Intergenic
1137586078 16:49664633-49664655 CAGGGTGGGGGGACGGCCCCTGG + Intronic
1137734576 16:50714215-50714237 CAGGGTGTGCAGAAGGGCTCTGG + Intronic
1138249742 16:55492783-55492805 CAGGGCGGTCAGGGGGCCGCTGG - Intronic
1138415332 16:56868265-56868287 CAGGGGGGTCAGAGGCCACCTGG - Intronic
1139374358 16:66487544-66487566 CTGGCTGGGCAGAGGGTCCCAGG - Intronic
1139436473 16:66939504-66939526 CAGACTGGGCAGCTGGCCCCTGG + Intronic
1139548872 16:67662553-67662575 CAGGGAGGGCAGAGAGCTGCGGG - Exonic
1139560043 16:67736101-67736123 AAGGGTGGACTGAGGGCCCTGGG - Intronic
1139573107 16:67825590-67825612 CAGGAAGGGCAGAGGGCTTCAGG + Intronic
1141715121 16:85722581-85722603 CTGAGTGGGCCCAGGGCCCCAGG + Intronic
1142100829 16:88270205-88270227 CAGGGTGGGGAGCAGGGCCCTGG - Intergenic
1142126807 16:88414511-88414533 CCGTGAGGGCAGAGGCCCCCAGG + Intergenic
1142153617 16:88523458-88523480 CAGGATGGGCGGGTGGCCCCGGG + Intronic
1142264302 16:89056750-89056772 CAGGGTGGGCCATGGGACCCTGG - Intergenic
1142283617 16:89161764-89161786 CAGGGTGGGCACAGGACCCCAGG + Intergenic
1142289114 16:89184669-89184691 CAGGCTGGGCAGAGGACGCAGGG - Intronic
1142359259 16:89619049-89619071 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359396 16:89619352-89619374 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359411 16:89619383-89619405 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142860079 17:2755885-2755907 CCGGGTGGGCGGAGGGGCGCCGG + Intergenic
1143095645 17:4477025-4477047 CGAGATGGGCAGGGGGCCCCTGG - Intronic
1143789448 17:9281992-9282014 GAGAGTGGGGAGAAGGCCCCAGG - Intronic
1143896147 17:10137771-10137793 CAGGGTGGGCAGATGACCTGAGG - Intronic
1144570081 17:16391989-16392011 CAGGCTTGGGAGAGGGCTCCAGG - Intergenic
1144839329 17:18175936-18175958 CAGTGAGGGCAGAGGGCCCAGGG - Intronic
1145209073 17:20999956-20999978 CAAGGTCCACAGAGGGCCCCGGG + Exonic
1145362233 17:22221749-22221771 CAGGCTTGGGAGAGGGCTCCAGG - Intergenic
1146257301 17:31398972-31398994 TAGGGTGGGCAGCAGGCTCCTGG + Intronic
1146458886 17:33028206-33028228 CAGGGTGGCCACAGGGCCCTGGG - Intronic
1147446578 17:40478522-40478544 CTTGGTGGGCAGCGGGGCCCTGG + Intronic
1147456018 17:40538634-40538656 CAGTGTGGGCATGGGGCCCAAGG - Intergenic
1147722257 17:42546614-42546636 CAGGGTGGGGAGAGCGGGCCAGG + Intergenic
1147723443 17:42552784-42552806 CAGGGTGGGGAGAGCGGGCCAGG + Exonic
1147898687 17:43769445-43769467 CAGGGTGGGGAAAGTGGCCCAGG + Exonic
1148080236 17:44963980-44964002 CTGGGTTGGCAGTGGGGCCCTGG - Intronic
1148129574 17:45254863-45254885 GAGGGTGGGCACAGGGGCCTGGG - Intronic
1148688097 17:49512049-49512071 CAGGGTGAGCAGCGGCCCGCTGG + Exonic
1148805033 17:50259691-50259713 CAGAGTGGGGAGGGGGCTCCTGG - Intergenic
1148870625 17:50657018-50657040 CAGGGAGGGCAGGGAGGCCCGGG - Intronic
1149626670 17:58084472-58084494 GAAGATGGCCAGAGGGCCCCAGG - Intronic
1150130796 17:62667554-62667576 CAGGGTGGGGAGGGGCTCCCAGG + Intronic
1150483517 17:65528517-65528539 CAGGGTGGGAACAGGGCCGAGGG - Intergenic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1150655030 17:67033700-67033722 CTGGGTGGGGTGTGGGCCCCTGG + Intergenic
1151253329 17:72854981-72855003 CAGGGTTTGCTGATGGCCCCTGG - Intronic
1151419968 17:73990812-73990834 CATGGAGGGCAGAGAGCCCCTGG + Intergenic
1151499856 17:74481703-74481725 CTGGGTGGGCAGGAGGTCCCAGG - Intronic
1151658597 17:75507216-75507238 CTGGGAGGGCAGAGAGCCCACGG + Intronic
1151696728 17:75721709-75721731 CAGCGTGGACAGAGGGACCGGGG - Intronic
1151786161 17:76276012-76276034 GGGGGTGGGGAGAGGGCCGCAGG + Intronic
1152243101 17:79170375-79170397 CAGGCTGGGCTGCAGGCCCCTGG - Intronic
1152564952 17:81096249-81096271 CATGGTGGGCAGAGAGCTCAGGG - Intronic
1152627950 17:81396852-81396874 GGCGGCGGGCAGAGGGCCCCGGG - Intronic
1152696795 17:81801669-81801691 CAGGGTGAGCAGACGTCGCCTGG + Intergenic
1152723011 17:81932022-81932044 CAGGGTATGCAGGGGGCTCCAGG - Intergenic
1152730081 17:81965862-81965884 CAGGCTGGGCACAGGGCACCAGG + Intergenic
1152808786 17:82371606-82371628 CGGGGTCGGCGGAGGGTCCCAGG - Intergenic
1153263607 18:3247196-3247218 GAGGCTTGGCTGAGGGCCCCAGG + Intergenic
1153625798 18:7021102-7021124 CAGCGTGGGAAGACGGGCCCAGG - Intronic
1154200120 18:12293884-12293906 CAGGATGGGCAGGGGGAGCCAGG - Intergenic
1154322607 18:13367322-13367344 CAGGTGGGGCAGAGGGGCCTGGG + Intronic
1155071959 18:22324804-22324826 CCACGTGGACAGAGGGCCCCCGG + Intergenic
1155390683 18:25333382-25333404 GAGGGTGGGCAGAAGGGCCAGGG + Intronic
1156222317 18:35065060-35065082 CAAGGTGGGCAGATGGCCTGAGG + Intronic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1156449828 18:37260815-37260837 TGGGGTGGGCAGAGGGCACAGGG - Intronic
1156486450 18:37469047-37469069 TAGGCTGGGAAGATGGCCCCAGG - Intronic
1157221349 18:45830292-45830314 CAGGGTAGGCAGAGAGCTCCAGG - Intronic
1158615590 18:58983614-58983636 CAGGGTGGGATGAGGGCCATGGG - Intronic
1159475596 18:68916874-68916896 CATGGTTTGCAGAGGGCCCAAGG + Intronic
1159511207 18:69400682-69400704 CCGGGTGGGGAGCGGGCCTCGGG + Intergenic
1160015838 18:75139751-75139773 CAGCGTGGGAGGAGGGCCCGGGG - Intergenic
1160430945 18:78812221-78812243 CAGGGCGGGCTGTGGGCTCCTGG + Intergenic
1160435117 18:78845670-78845692 CCAGGTGGGCAAAGGGACCCTGG - Intergenic
1160538012 18:79605626-79605648 CAGGGTGGGCTCCGGGCCACGGG - Intergenic
1160912489 19:1481381-1481403 CAGGGTGGGCCCGAGGCCCCAGG - Intergenic
1161019015 19:1999148-1999170 CCGGGTGGGCTGAGGGCCTGCGG - Intronic
1161086841 19:2339386-2339408 CAGGGTGGGCTCCGGGCACCTGG + Intronic
1161108217 19:2455117-2455139 CAGGGTGGGTAGGGGGCCGAGGG - Intronic
1161202062 19:3020520-3020542 CAGGGAGTGTAGGGGGCCCCTGG - Intronic
1161283068 19:3456213-3456235 CAGGGTGGGCAGCGCCCGCCCGG - Intronic
1161345731 19:3767993-3768015 CAGGGTAGCCCGAGGGCTCCTGG + Intronic
1161577749 19:5064220-5064242 CAGGTTGGACAGAGGCCACCTGG - Intronic
1161666465 19:5579981-5580003 CAGGGTGTGCAGAAGCCCCCAGG - Intergenic
1161682070 19:5685080-5685102 CAGTGTGGGCAGTGAGCACCAGG - Exonic
1161697668 19:5778613-5778635 CAGGGCAGGCACAGAGCCCCCGG + Exonic
1162050027 19:8027504-8027526 CAGGGTGCGCAGAGGACCTCAGG + Intronic
1162095849 19:8309551-8309573 CAGGGTGTGCAGAGGCCACAAGG - Intronic
1162320546 19:9968710-9968732 CTGGGAGGCCAGAGGGCCCCTGG + Exonic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162334225 19:10050262-10050284 CAGGCTGGGCAGGTGGGCCCAGG + Intergenic
1162609705 19:11739341-11739363 CAGGGTGGCCTGTGTGCCCCGGG - Intergenic
1162757432 19:12868657-12868679 GAGGGTGGGCAGAGGTCACCTGG - Exonic
1162788060 19:13048141-13048163 CAGGGTGGGGACAGGCCCCAGGG - Intronic
1163608807 19:18290685-18290707 CAGGGAGGGCGGCGGGCCACAGG - Intergenic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1163709792 19:18839848-18839870 CAGGGTGCTGTGAGGGCCCCAGG + Intronic
1164089892 19:21940640-21940662 CGGGGAGGACAGAGGGACCCAGG - Intronic
1164109307 19:22140216-22140238 CGGGGAGGACAGAGGGGCCCAGG - Intergenic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1165002849 19:32779216-32779238 CAATGTGGGCAGAGGGGCACAGG + Intronic
1165061378 19:33206833-33206855 CAGGGTGACCTGAGGGCCCATGG + Intronic
1165329871 19:35135428-35135450 CAGGGTGGGAGGAGAGGCCCTGG + Intronic
1165734914 19:38169947-38169969 CAGGGTGAGATGAGGGGCCCAGG + Intronic
1166048999 19:40246993-40247015 TAGGGTGGGCAGTGGGAGCCAGG - Intronic
1166101992 19:40576543-40576565 CGGGGTGGGGAGAGGGGCACGGG + Intergenic
1166104168 19:40589447-40589469 CAGGGTGGGATGGGGGGCCCAGG + Intronic
1166326519 19:42054225-42054247 CAGGGAGGGCAGAGGGCCACAGG + Intronic
1166694942 19:44846931-44846953 CGGGGTGGGGAGGGGGCACCAGG - Intronic
1166777808 19:45323244-45323266 CAGGGGGAGCCGAGGGCCACAGG - Intergenic
1167045159 19:47045425-47045447 GAGGGTGGGCGGGGGGTCCCCGG - Exonic
1167153415 19:47723131-47723153 CAGGGTGGGCAGGGGGATCCAGG - Intronic
1167502955 19:49857656-49857678 CGGGGTGGGAAGAGGGGCCCAGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167799077 19:51728655-51728677 CAGTGAGGGCAAGGGGCCCCTGG + Intergenic
1168058055 19:53874459-53874481 CCAGGTGGGCAGAGTGCACCAGG - Exonic
1168152180 19:54455157-54455179 CAGGGTGGGCAGCTGGCCAGTGG - Intronic
1168288160 19:55344677-55344699 CAGGGAGGCCAGAGAGCCCCAGG + Intronic
1168307357 19:55442756-55442778 CAGGGCGGGCAGCGGGCCCGCGG + Exonic
1168345901 19:55650075-55650097 GTGGGTGGGAAGATGGCCCCTGG - Intronic
1168355625 19:55698066-55698088 CAGGGTGATCAGAGGTCACCTGG + Intronic
925128480 2:1477857-1477879 CAGGTGGGACAGAGGGGCCCCGG - Intronic
925164118 2:1705197-1705219 CAGGGGAGGCCCAGGGCCCCTGG - Intronic
925629993 2:5882205-5882227 CAGGGAGGTCAAAGGGCCCGGGG - Intergenic
926012095 2:9416536-9416558 CAGGGCGGGCTGAAGACCCCTGG - Intronic
926045431 2:9706343-9706365 CTGGGTGGTCAGAGGCCCACAGG + Intergenic
926154818 2:10448049-10448071 CGGGGCGGGCTGCGGGCCCCGGG - Intronic
926245817 2:11121890-11121912 CAGGGTGGGAAGTGGGTGCCTGG - Intergenic
929583798 2:43101198-43101220 CGGGGTGGGCAGGGGGCCCAGGG + Intergenic
931691490 2:64838078-64838100 CAAGCTGGGCAGAGTGCCCTGGG + Intergenic
932002522 2:67897775-67897797 TGGGGTGGGGAGAGGGCCCTGGG - Intergenic
932002532 2:67897794-67897816 CAGGTTGGGGAGAGGGCCCTGGG - Intergenic
932418212 2:71586395-71586417 GAGGGTGGGCAGCAGGCCCCTGG + Intronic
932447948 2:71792077-71792099 CTGGGTGGGCTGGGGGCTCCAGG - Intergenic
932755321 2:74404141-74404163 CAGGGATGGCAGATGGCCTCTGG - Intergenic
933997269 2:87679200-87679222 CAGTGTGGGGAGGGAGCCCCTGG + Intergenic
934296426 2:91746612-91746634 CAGGGTGGGCAGGAGACACCAGG + Intergenic
934552606 2:95271555-95271577 CAGGGTGAGCACGTGGCCCCAGG + Intergenic
934664184 2:96158462-96158484 CAGGGAGAGCAGAGGCCCCATGG + Intergenic
934750870 2:96793349-96793371 CAGGGTGAGCTTTGGGCCCCTGG - Intronic
934753484 2:96809526-96809548 CAGGGTGGGCAGGGGGCCCCGGG - Exonic
934925197 2:98377382-98377404 CTGGGTGGGGAGAGGTCCCGGGG - Intronic
936155285 2:110042971-110042993 CAGGGCTGGGAGGGGGCCCCTGG - Intergenic
936173489 2:110197492-110197514 CAGGGTGAGCAGGGGGCCCACGG + Intronic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
936189395 2:110328442-110328464 CAGGGCTGGGAGGGGGCCCCTGG + Intergenic
936235875 2:110742072-110742094 CACGGTGAGGAGAGGGTCCCAGG + Intronic
936296583 2:111271710-111271732 CAGTGTGGGGAGGGAGCCCCTGG - Intergenic
936912055 2:117603525-117603547 CAGGGTGGCCTGAGGTCCCCAGG - Intergenic
937043958 2:118841372-118841394 CAGGGTGTCCTGAGGGCCCTGGG + Intergenic
937349533 2:121151962-121151984 CAAGGTGTGCTGAGAGCCCCAGG + Intergenic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
941490112 2:166133209-166133231 CAGGGAAGGCAGAGGGCAACTGG - Intergenic
941917334 2:170821434-170821456 CAGGTTGGGAAGAGGGGCCAGGG + Intronic
942173880 2:173312734-173312756 CAGGGTGGGCAGGAGACACCAGG - Intergenic
942266408 2:174230939-174230961 CAGAATGGGCACAGGTCCCCAGG - Intronic
942851909 2:180496951-180496973 CAAGGTGGGCAGATTGCCCAAGG - Intergenic
942965878 2:181891960-181891982 CCGGCCGGGCAGGGGGCCCCGGG - Exonic
944816939 2:203386870-203386892 CAGGGTGGGCAGATCGCCTGAGG - Intronic
946153629 2:217792743-217792765 CAGTGTGGGCAAAGGGAGCCAGG - Intergenic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
947135440 2:226972735-226972757 GAGTGTGAGCAGAGAGCCCCTGG - Intronic
947641449 2:231709720-231709742 CAGGGCGGGCAGTGGGACCGAGG - Intronic
947642790 2:231716335-231716357 CAGGGTAGGCAGCAGGGCCCTGG - Intergenic
947761028 2:232604161-232604183 CAGGGTGGGCTGGAGGCTCCAGG - Intergenic
947851928 2:233295181-233295203 CAGGCTTGGCAGAGGGGCCATGG - Exonic
948084564 2:235236698-235236720 ATGGATGGGCAGGGGGCCCCTGG - Intergenic
948207483 2:236169912-236169934 CTGGGTGGGCAGTGGGTCTCCGG - Intergenic
948461482 2:238131986-238132008 CCGGCTGGGCAGAGGTGCCCTGG - Exonic
948729125 2:239952291-239952313 CAGAGTGGGGAGGGGGGCCCAGG + Intronic
948775269 2:240284720-240284742 CTGTGTGGGCAGTGGGACCCGGG + Intergenic
948786170 2:240354104-240354126 CAGGGTGTGCAGTGGGGCCAGGG - Intergenic
948890975 2:240906966-240906988 CAGGGTGGAGAGAGAGCCCGGGG + Intergenic
949003695 2:241633244-241633266 CAGGAGGGGCAGAGGGGCTCTGG + Exonic
949031538 2:241799544-241799566 CAGGCAGGGGAGAGGGTCCCAGG - Intronic
949035497 2:241814152-241814174 GAGGCTGGCCAGAGAGCCCCCGG - Intronic
1168843442 20:924978-925000 CATGGTGGTCTCAGGGCCCCAGG - Intergenic
1168973573 20:1947515-1947537 AGGGGTGGGGAGAGGGCCGCAGG - Intergenic
1169045233 20:2529844-2529866 CTGGGTGGGCAGTGTGCCCAGGG + Intergenic
1169422643 20:5472182-5472204 CAGGGTGGGCACAGTGACCAGGG + Intergenic
1169426827 20:5503600-5503622 CAGGGTGGGCACAGTGACCAGGG - Intergenic
1171089614 20:22271568-22271590 CAGAGTGGGAAGAGGGCTCATGG + Intergenic
1171365273 20:24618313-24618335 CAGTGAGGGCAGAGAGCCCAGGG + Intronic
1172183348 20:33016809-33016831 CAGTGTGAGCATAGGTCCCCAGG - Intronic
1172421886 20:34825256-34825278 CATGTTGGGGAGCGGGCCCCAGG - Intronic
1172566497 20:35934686-35934708 CAGGCTGGGCAGGTGGCCACAGG + Intronic
1172644781 20:36462438-36462460 AAGGGGGGGCCAAGGGCCCCAGG - Intronic
1172684837 20:36745879-36745901 GGGGCGGGGCAGAGGGCCCCGGG + Intronic
1172765111 20:37346688-37346710 CAGGGCGGGCTGAGGGGCCCCGG + Intronic
1172974415 20:38895512-38895534 CAGGCAGGGCACTGGGCCCCGGG - Intronic
1173074869 20:39808076-39808098 CAAGGGGGGCAGAAGGCCCTAGG + Intergenic
1173591593 20:44229069-44229091 CAGAGTGGGCAGACAGCTCCTGG + Intergenic
1174145226 20:48448544-48448566 CATGGTGGGAAGAGGGCAGCAGG + Intergenic
1174457905 20:50662575-50662597 CTGGGTGGGCAGAGGCATCCAGG - Intronic
1174488314 20:50874884-50874906 CAGAGTGGGCAGAGGTGGCCAGG + Intronic
1175108711 20:56631111-56631133 CGGGCTACGCAGAGGGCCCCGGG - Intronic
1175113183 20:56663471-56663493 GAGGGTGTGAACAGGGCCCCAGG - Intergenic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175206772 20:57317318-57317340 CAAGTGGGGCAGAGGGCTCCAGG - Intergenic
1175547180 20:59785925-59785947 CAGGGGAGGCAGAGGGCCGTTGG - Intronic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175654308 20:60755379-60755401 CGGGGTGTGCAGAGAGCCACTGG - Intergenic
1175787850 20:61723346-61723368 CACGGTGCTCAGAGGGCCCCGGG - Intronic
1175828822 20:61951097-61951119 GAGGGTGGGAAGAGGGGCCCAGG - Intergenic
1175930021 20:62489503-62489525 CAGCGTGGCCAGTGGGCTCCGGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176008596 20:62880124-62880146 CTGGTTGGGATGAGGGCCCCGGG + Exonic
1176069543 20:63218892-63218914 CAGGGGGTGCTGAGGTCCCCAGG + Intergenic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1178351537 21:31875175-31875197 CAGGCTGGGCAGAGGCCCCCAGG - Intronic
1179594970 21:42437380-42437402 CAGGGTCCTCAAAGGGCCCCGGG - Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1179794895 21:43776829-43776851 GGGGGTGGACAGAGGGGCCCAGG + Intergenic
1179903499 21:44407005-44407027 CAGAGTGGGCCGAGGGCACCTGG + Intronic
1179928111 21:44549796-44549818 CTGGGTGGGCGGAGGGCCGGTGG - Intronic
1179960228 21:44763867-44763889 CTGGGTGTGCAGGGTGCCCCGGG - Intergenic
1180021804 21:45133323-45133345 CATGCTGGGAAGAGGGCCACAGG - Intronic
1180024679 21:45153718-45153740 CACGGTGCACAGAGGGCCCAGGG - Intronic
1180224832 21:46386195-46386217 CAGGGTGGGAGGAGGGCACGGGG - Intronic
1180914168 22:19473813-19473835 CAGGCTGGGCAAAGAGCCCGAGG + Intronic
1180967662 22:19798983-19799005 GAGGGAGGCCAAAGGGCCCCGGG - Intronic
1180977492 22:19856301-19856323 CAGAGTGGGCAGTGGGCCTGTGG + Intergenic
1181030051 22:20145313-20145335 TAGGGCTGGCAGAGGGCCCTGGG - Intronic
1181085503 22:20437733-20437755 CATGGAGGGCGCAGGGCCCCGGG - Exonic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1181525687 22:23484404-23484426 CAGAGCGGGGAGATGGCCCCTGG + Intergenic
1181549335 22:23628011-23628033 CAGGGTGGGTAGAGGGGCCCTGG - Intronic
1181799279 22:25333869-25333891 CAGGGTGGATAGAGGAACCCTGG + Intergenic
1181808681 22:25390681-25390703 CATGGTGGGGAGGGGTCCCCGGG - Intronic
1182049150 22:27299852-27299874 TGGGGTGGGCTTAGGGCCCCAGG - Intergenic
1182662228 22:31933264-31933286 GAGGATGGGTGGAGGGCCCCAGG - Intergenic
1183244764 22:36685326-36685348 GAAGGCGGGCAGAGGCCCCCGGG - Intronic
1183431413 22:37768188-37768210 CAGGGTGGGCAGTTGGGCCCCGG - Intronic
1183585491 22:38750820-38750842 AAGGCTGGGCAGGGAGCCCCGGG - Intronic
1183640352 22:39088939-39088961 AAGGCAGGGCAGAGGGACCCTGG - Intergenic
1183656670 22:39189669-39189691 CAGAGTGGTTTGAGGGCCCCTGG + Intergenic
1183685125 22:39357322-39357344 CAGAGGGGGCACTGGGCCCCAGG + Intronic
1184101377 22:42343407-42343429 CTGGGCGGGCATCGGGCCCCAGG + Intronic
1184373535 22:44097712-44097734 GAGGGTGGACAGCAGGCCCCAGG - Intronic
1184374855 22:44105248-44105270 CTGGCTGGCCCGAGGGCCCCAGG + Intronic
1184550841 22:45203401-45203423 CAGGCTGAGGACAGGGCCCCAGG + Intronic
1184559756 22:45255387-45255409 CAGGGAGGGGAGAGGGCTCAGGG - Intergenic
1184659635 22:45959952-45959974 GGGGGAGGGCAGATGGCCCCAGG - Intronic
1184677919 22:46053690-46053712 CTGGGGAGGGAGAGGGCCCCAGG - Intronic
1184784257 22:46664196-46664218 CAGGGTGGGAGGTGGCCCCCAGG + Intronic
1184795782 22:46731646-46731668 CAGGGAGGGCAGAGGGCACCTGG + Intronic
1184927252 22:47651496-47651518 CAGGGTGGTCAAAGGGCACAGGG + Intergenic
1184998330 22:48226703-48226725 CTGGGTGGGCATGGTGCCCCCGG - Intergenic
1185018240 22:48358164-48358186 CGGAGTGGGCAGGGGGCCCTCGG + Intergenic
949605831 3:5652493-5652515 CAGGGATGGCAAAGGGACCCTGG + Intergenic
950887852 3:16376383-16376405 CAGGCCAGGCAGAGGCCCCCAGG - Intronic
951264901 3:20553199-20553221 CAGGGAGGGCAGAGGGGCGTGGG + Intergenic
953358777 3:42276953-42276975 CAGAGTGGGTGGAGGGGCCCTGG + Intergenic
953373877 3:42412548-42412570 CAGGGTGAGCAGAGGCCATCAGG - Intergenic
953547637 3:43875386-43875408 TAGGGTGGGCTGAGGGGCCCTGG - Intergenic
953851231 3:46466917-46466939 CTGGGAGGTCAGAGGGCCCTGGG + Intronic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
954379879 3:50213678-50213700 TAGGTTGGGCAGGAGGCCCCTGG + Intronic
954610614 3:51942899-51942921 GAGGGTGGGCAGAGGATCCTGGG - Intronic
954638520 3:52084694-52084716 CAAGGTGAGCAGGAGGCCCCTGG - Intronic
955380395 3:58433718-58433740 CAGGGTGGGCAGGGGTCGCGTGG + Intronic
955996611 3:64685960-64685982 AAGGGTGGGCCGAGGGCTCTGGG - Intronic
956694767 3:71908780-71908802 CACGGTGGGCAGTGGGCTCACGG + Intergenic
956874743 3:73451167-73451189 CCGGGTGGGGAGCAGGCCCCTGG + Intronic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
960474797 3:118110631-118110653 GAGGGTCTGCAGAGGGACCCTGG + Intergenic
960818419 3:121699108-121699130 CAGGATTGGCAGAGTGCCCTTGG - Intronic
960829846 3:121834922-121834944 CTGGGGAGGGAGAGGGCCCCAGG - Intronic
961511675 3:127407387-127407409 CAGGGTTGGCAGTGAGCACCAGG + Intergenic
961591420 3:127984509-127984531 CAGGAGGGGCACAGGGCCACAGG + Exonic
961658895 3:128457977-128457999 CTGGGTGGGCTGTGGGTCCCAGG + Intergenic
961722818 3:128907662-128907684 CAGAGTGGGCAGAAGCCCACTGG + Intronic
961830138 3:129619111-129619133 CAGGGTGGGGGTAGAGCCCCCGG + Intergenic
962676707 3:137763337-137763359 CTGGGTGGGAAGAGGCGCCCAGG + Intergenic
964636239 3:158860618-158860640 CAGGGAGGGAAGAGGGGACCAGG - Intergenic
965439865 3:168699419-168699441 CAGGGCAGGCACAGGGGCCCTGG - Intergenic
965561373 3:170064860-170064882 CAGGGTGGGCAGGAGACACCAGG - Intronic
967869513 3:194218418-194218440 CAGGGGAGGCTGAGAGCCCCTGG - Intergenic
968003158 3:195221526-195221548 TAGGCTGGCCAGAGGCCCCCAGG - Intronic
968058580 3:195711651-195711673 CAGGGTGGGGAAGGGGCCTCAGG - Intergenic
968178206 3:196569088-196569110 CCGGCTGGGCAGCCGGCCCCCGG - Exonic
968374638 4:28851-28873 AAGGGCGGGCAGTGGGGCCCAGG - Intergenic
968510385 4:993014-993036 CAGGCTGGGCACAGCACCCCTGG + Intronic
968536216 4:1131557-1131579 AAGGGTGGGCACAGGGTACCAGG - Intergenic
968579122 4:1381552-1381574 CAGGGCGGGCAGATGGGCCTGGG - Intronic
968600837 4:1508598-1508620 CAGGGTGGGCAGAGCCCGGCTGG - Intergenic
968621580 4:1605656-1605678 CAGGGTCGGCAGGGAGCCCTGGG - Intergenic
968801078 4:2743606-2743628 CAGGGTGTGAACAGGGACCCTGG - Intronic
968813286 4:2809508-2809530 CAGGCTGGGTACAGGGTCCCTGG + Intronic
968813341 4:2809784-2809806 CAGGGCAGGCAGAGGGCCAAGGG - Intronic
969355048 4:6620330-6620352 CAAGGTGGGCAGAAGCCCCTGGG - Intronic
969457736 4:7309780-7309802 CAGGCTGGGGAGAGGGCCTGAGG + Intronic
969466167 4:7357805-7357827 CAGGATGGGGAGAAGGCCCGAGG - Intronic
969689781 4:8698131-8698153 CAGTGTGGACAGATGGACCCGGG - Intergenic
970546796 4:17137938-17137960 GAGGGTGGGCATAGAGCCCTGGG - Intergenic
980105980 4:128588912-128588934 CAGGGTGGGCACAGCACCTCTGG - Intergenic
980988632 4:139719024-139719046 CATGCTGGGCAGAGGGGCTCTGG + Exonic
982467694 4:155750693-155750715 CAAGGAAGGCAGAGGGCCTCTGG - Intergenic
982595856 4:157382015-157382037 CAGTGTGGGCAGAGGCCCTAAGG - Intergenic
983442952 4:167810604-167810626 CAAGGTGGGCAGAGGGCAAGCGG + Intergenic
984944522 4:184960732-184960754 CAGGGCGTGCAGGGGGCCCCAGG + Intergenic
985012097 4:185593189-185593211 CAGTGTGGGCAGAGGCCAACAGG + Intronic
985468552 5:21399-21421 AAGGGCGGGCAGTGGGGCCCAGG - Intergenic
985540593 5:485730-485752 CTGGGTGGGCCGAGGCCCCTGGG + Intronic
985599772 5:821203-821225 GAGTGTGGGCAGGGGACCCCTGG - Intronic
985662670 5:1165103-1165125 CAGGGAGGGCACAGGGCTCTCGG + Intergenic
985937000 5:3105047-3105069 CAGGATGGTCAGAGGGCACTGGG - Intergenic
985999139 5:3616464-3616486 AAGGGGGGGCAGAGGGCATCTGG + Intergenic
986142938 5:5048782-5048804 GAAGGTGGGCAGTGGGCCCAGGG - Intergenic
986387111 5:7245489-7245511 CATGTTGGAGAGAGGGCCCCAGG - Intergenic
986506845 5:8460324-8460346 CAGGGTGTAAAGAAGGCCCCAGG - Intergenic
988663596 5:33300802-33300824 AAGGTTGGGGAGAGGGCCTCAGG - Intergenic
989326151 5:40197788-40197810 CAGAGTGCCCAGAGGGCCCAGGG - Intergenic
991574686 5:68090667-68090689 GGGGGTGGGCAGAGGGCACATGG - Intergenic
991721031 5:69493935-69493957 CAGTGTGGCCAGCGAGCCCCGGG - Intronic
992048844 5:72925549-72925571 CTGGGTGGGCACAGGGTCCACGG + Intergenic
997237059 5:132278779-132278801 CAGGTGGGGCAGAGGGACTCAGG - Intronic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
998153233 5:139769180-139769202 CATGGTGGGAAGAGGGCTCCAGG + Intergenic
999102295 5:149036656-149036678 CAGGGGGAACAGAGGACCCCAGG - Intronic
999232026 5:150067160-150067182 TAGGGTTGGCACTGGGCCCCAGG - Intronic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1000357640 5:160416124-160416146 CAAGGTGGGCAGATGGCCTGGGG - Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG + Intronic
1001600329 5:172924168-172924190 CAGAGAGGGCAGAGGGCACTGGG - Intronic
1001984554 5:176061909-176061931 CAGGGTGGGAGGGGGTCCCCAGG + Exonic
1002055365 5:176595473-176595495 CAAGGTGGGGCGAGTGCCCCAGG - Intronic
1002232960 5:177782288-177782310 CAGGGTGGGAGGGGGTCCCCAGG - Exonic
1002263031 5:178007531-178007553 CAGGGTGGGAGGGGGTCCCCAGG + Intronic
1002363402 5:178691854-178691876 CATGCTGTGCAGAGGGGCCCTGG + Intergenic
1002435417 5:179228153-179228175 GAGGGTGGGCCGGAGGCCCCAGG + Intronic
1002518002 5:179773778-179773800 CACACTGGGAAGAGGGCCCCGGG - Intronic
1002565984 5:180113192-180113214 CAGGATGGACAGAGGGACCGGGG + Intronic
1002591593 5:180294448-180294470 CAGGGTGGGGAGGGGGGCCTTGG + Intergenic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1002784904 6:393105-393127 CAGAGCGGGCGGAGGACCCCGGG + Exonic
1002814741 6:669270-669292 CAGGGCTGGCAGGGGGCCACAGG - Intronic
1002875284 6:1204497-1204519 CAGGGTGATCAGACAGCCCCGGG + Intergenic
1002894886 6:1372149-1372171 CAGGGTGAGCTTAGGGGCCCTGG + Intergenic
1003075748 6:2982549-2982571 CAGGGTGATCAGACAGCCCCTGG - Intergenic
1003896070 6:10608945-10608967 CAGGGTGGCCAGAGAGCTCCTGG + Intronic
1003970061 6:11290692-11290714 AAGGGTGGGCAAGAGGCCCCTGG + Intronic
1004614443 6:17276936-17276958 TGGGCTGGGCAGAGGGCACCGGG - Intergenic
1004986116 6:21084864-21084886 AAGGCTTGGCAGAGAGCCCCGGG + Intronic
1005992500 6:30912149-30912171 GAGGCGGGACAGAGGGCCCCTGG + Intronic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006024762 6:31139734-31139756 CTGGGTGGGAAGAGGGAACCAGG - Exonic
1006030013 6:31171513-31171535 CAGGCTGGGCAGATGGTGCCAGG - Intronic
1006154796 6:32008275-32008297 CAGGGAGGGCAGGGCGTCCCCGG - Intergenic
1006161108 6:32041010-32041032 CAGGGAGGGCAGGGCGTCCCCGG - Exonic
1006359371 6:33578896-33578918 GAGGGTGGGCGAAGGTCCCCAGG - Intronic
1006414057 6:33893039-33893061 CGGGGTGGGGAGAGGGGCCGGGG + Intergenic
1006455680 6:34130520-34130542 CAGGGTGGGGTGAGGGGCCTGGG - Intronic
1006490017 6:34379325-34379347 CAAGGTGGGCAGATCGCCTCAGG + Intronic
1006642045 6:35494646-35494668 CAGGATGGGGAGAGGAGCCCAGG - Intronic
1006830402 6:36964650-36964672 CTGTGTGGGCAGACAGCCCCAGG - Exonic
1006839908 6:37022149-37022171 GCAGGTGGGCACAGGGCCCCAGG + Intronic
1007323585 6:41043829-41043851 CATGGTGTGCACAGAGCCCCAGG + Intronic
1007366578 6:41398376-41398398 CGGGGTGGGTAGGGGGCCTCTGG - Intergenic
1007380159 6:41485017-41485039 CGGAGTGGGCAGATGGCCCAGGG + Intergenic
1007825128 6:44594610-44594632 AAGGGTCTGCAGAGGGCCGCAGG + Intergenic
1011075242 6:83431292-83431314 CATGGTGGGCAGAGGCCCTATGG - Intergenic
1012128999 6:95467212-95467234 CAGGGTGGTCAGGAGACCCCAGG - Intergenic
1012205184 6:96452540-96452562 CAGGCTGGGAAGTGGGCCTCTGG - Intergenic
1012912659 6:105136347-105136369 GAGCGAGGTCAGAGGGCCCCGGG - Intronic
1016215225 6:141591751-141591773 TGGGGTGGGAAGAGGGCACCTGG - Intergenic
1017559895 6:155615680-155615702 CAGGGCGGTCTCAGGGCCCCAGG - Intergenic
1017758945 6:157553191-157553213 CAGGGTGGTCAGAGATTCCCTGG + Intronic
1018384098 6:163287389-163287411 CTGGGAGGGCTGAGGGTCCCCGG - Intronic
1019299508 7:296238-296260 CAGGCAGGGCTGAGGGCACCAGG - Intergenic
1019330487 7:458369-458391 CAGTGGGGGCAGGGGTCCCCTGG + Intergenic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019407593 7:891859-891881 CAGGGAGGGCTCAGTGCCCCAGG - Intronic
1019437898 7:1031372-1031394 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437911 7:1031409-1031431 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437924 7:1031446-1031468 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437936 7:1031483-1031505 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437949 7:1031520-1031542 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437960 7:1031557-1031579 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437971 7:1031594-1031616 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437982 7:1031631-1031653 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437993 7:1031668-1031690 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438006 7:1031705-1031727 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438017 7:1031742-1031764 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438028 7:1031779-1031801 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438039 7:1031816-1031838 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438049 7:1031853-1031875 CAGGGAGGGCAGAGTGGTCCAGG + Intronic
1019444616 7:1064857-1064879 CAGGGCGCACAGAAGGCCCCAGG + Intronic
1019488824 7:1301618-1301640 CGGGGAGGGCACAGGGGCCCTGG + Intergenic
1019501194 7:1365516-1365538 CAGGGGTGGGACAGGGCCCCTGG - Intergenic
1019502291 7:1370257-1370279 CTGTGTGGGCAGAGAGGCCCTGG + Intergenic
1019537576 7:1537264-1537286 CACGGCGGGCAGTGGGCCCGGGG + Intronic
1019621259 7:1993289-1993311 CAGGGAGGGCACAGGGCTTCTGG + Intronic
1019662461 7:2232526-2232548 CACGGTAGGCAGCGGGACCCCGG + Intronic
1019698646 7:2461477-2461499 CAGGGTGGGCTGGGGTCCCAGGG - Intergenic
1019729926 7:2624010-2624032 CAGGGTGGGCCCAGGAGCCCAGG - Intergenic
1019811313 7:3167157-3167179 CAGGTTGCGAAAAGGGCCCCTGG - Intronic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1020085378 7:5307569-5307591 GAGGGTGGGGGCAGGGCCCCTGG + Exonic
1020686660 7:11304591-11304613 CAGGGAGGGCAGGGTGGCCCAGG + Intergenic
1022021016 7:26399112-26399134 AAGGGAGGGCAAGGGGCCCCTGG - Intergenic
1022298827 7:29083382-29083404 CAGGGTGTGGAGTGGGCCTCAGG + Intronic
1023001347 7:35810999-35811021 CAAGGTGGGCAGATTGCCTCAGG - Intronic
1023866787 7:44242176-44242198 CATGGTGGGGAGGGGGCTCCTGG - Intronic
1023868638 7:44251173-44251195 CAGGATGGGCCGAGGCCTCCTGG - Intronic
1023937211 7:44748692-44748714 CAGGGTGGGGCCAGGGCCGCAGG - Intronic
1023990665 7:45126430-45126452 CTGGGTGGGAGGAGGGCCTCGGG + Intergenic
1025005997 7:55355338-55355360 CAGGGTGATCAGAGGTCACCGGG + Intergenic
1025014474 7:55427855-55427877 CAGGGAGGGCTGAGGGCCGGGGG + Intronic
1025769900 7:64494981-64495003 CGGGGAGGACAGAGGGGCCCAGG - Intergenic
1026479586 7:70766183-70766205 CAGGTAGGGCGGAGGGCCCAGGG - Exonic
1027252632 7:76408666-76408688 CAGGCTTGGCAGAGGGCTCTGGG - Intronic
1027345828 7:77258350-77258372 ATGGGTGGGCAGACGGGCCCTGG + Intronic
1028161968 7:87496277-87496299 AAGGGTGGGTAGAGGCCCCAAGG - Intergenic
1028503888 7:91550209-91550231 CAGGGTGGGCAGAGATCCCATGG - Intergenic
1028639348 7:93025954-93025976 AAGGGTGGGCAAAGGGCAACAGG + Intergenic
1028907874 7:96175191-96175213 AAGGGTGAGCAGAGGTTCCCCGG + Intronic
1029155220 7:98512611-98512633 AAAGGTGGGCAGAGTGGCCCTGG + Intergenic
1029176045 7:98665147-98665169 CAGGGAGGCCAGAAGGTCCCAGG - Intergenic
1029272721 7:99386451-99386473 TAGGGTGGGGAGAGGTCCCAGGG + Intronic
1029647488 7:101867399-101867421 CAGGGTGGCAGGTGGGCCCCTGG - Intronic
1031976696 7:128098440-128098462 CAGGTGGGGCAGCGGACCCCAGG + Intergenic
1032083618 7:128872537-128872559 CCAGGAGGGCAGGGGGCCCCTGG - Intronic
1032420948 7:131778635-131778657 CAGGATGGCCAGAGGGCCTAGGG - Intergenic
1032792859 7:135255244-135255266 CAAGGTGGGCAGAGGTACCACGG - Intronic
1033251172 7:139761166-139761188 CAGGGTAACCAGACGGCCCCAGG + Intronic
1033253036 7:139777391-139777413 CAGGGCGGGGAGAGGGGCCGGGG - Intronic
1033311282 7:140263922-140263944 CAGTGTGTTCAGAGGGTCCCTGG - Intergenic
1034413920 7:150955295-150955317 CAGGCTGGGGAGAGGGCTGCTGG - Intronic
1034846688 7:154452679-154452701 CAGGGGTGGCAAGGGGCCCCTGG - Intronic
1035241321 7:157531623-157531645 CAGGGTGGGAGGAGAGGCCCAGG - Intergenic
1035302426 7:157906268-157906290 CAGGGTGGCCACAGAGCCACTGG + Intronic
1035413911 7:158667733-158667755 AAGGGAGGGCGGAGGGCCACAGG - Intronic
1035414072 7:158668196-158668218 AAGGGGGGGCGGAGGGACCCAGG - Intronic
1035519928 8:267172-267194 AAGGGTGGCCAGGGGGACCCTGG + Intergenic
1035609236 8:949041-949063 CAGGGTGGGAGCAGGGCCCGTGG + Intergenic
1036396840 8:8377448-8377470 ATGGGTGGGCAGTGGGGCCCTGG + Exonic
1036587300 8:10136169-10136191 CACGCTGGGCACAGGGACCCCGG + Intronic
1036796201 8:11758319-11758341 CAGGGTGGATGGAGGGCCCATGG - Exonic
1037417648 8:18668170-18668192 CAGAGTGGGCAGAGAGGCCGAGG + Intronic
1037745762 8:21642896-21642918 CAAGGTGGGCAGATCACCCCAGG + Intergenic
1039430125 8:37519438-37519460 CAGGTGGGGCAGGAGGCCCCAGG - Intergenic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1039837082 8:41265132-41265154 CAGGGTGGGGAGGGAGCCTCGGG - Exonic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1042400600 8:68341677-68341699 CAGGATGGGCAGAGGGGCACAGG - Intronic
1042567807 8:70130092-70130114 TAGGGAGGGCAGTGGGCTCCTGG - Intronic
1044712694 8:95072865-95072887 CAGGGAGGGCAGTGGGCACCTGG + Intronic
1044720405 8:95140064-95140086 CAGGATGGGCAGGGAGCTCCAGG - Intronic
1045242914 8:100417908-100417930 CAAGGTGGGCAGATTGCCCGAGG - Intergenic
1045638319 8:104218840-104218862 CAGGGTAGGCTGGGGACCCCTGG + Intronic
1045801727 8:106109966-106109988 CAGGGTGGGCAGAGTGGCACTGG - Intergenic
1046942235 8:119942436-119942458 CAGGGTGGGCAGATCGCCTGAGG - Intronic
1047343005 8:124000908-124000930 TAGAGAGGGCAGAGGGACCCAGG + Intronic
1048444767 8:134485175-134485197 GTGGGTGGGCAGAGCCCCCCAGG - Intronic
1049179772 8:141216242-141216264 CTGGCAGGGCAGGGGGCCCCTGG - Intronic
1049189706 8:141280219-141280241 CAGGGTGGGCAGGGGGCACGTGG - Intronic
1049217592 8:141415239-141415261 CAGGCTGGGAAGAGGGTCCCAGG - Intronic
1049438203 8:142597352-142597374 CACCGTGGGGAGAGGACCCCAGG + Intergenic
1049476267 8:142798265-142798287 CAGGGTCGGCCAGGGGCCCCGGG + Intergenic
1049603925 8:143520416-143520438 CAGGGTGGGCAGCTGGCCATCGG - Intronic
1049664970 8:143838978-143839000 CAGGGTAGGCACGGGGCACCCGG + Intronic
1049798388 8:144506678-144506700 CGGGGTGGGCAGGGGGGGCCGGG + Intronic
1049997628 9:1046969-1046991 CAGAGGGGGAAGGGGGCCCCAGG + Intergenic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1051287184 9:15510049-15510071 CACGGTGGGCAGCAGGCCTCTGG + Intronic
1053148408 9:35727582-35727604 AAGGTTGGGCAAAGTGCCCCAGG - Intronic
1053179701 9:35958032-35958054 CTGGGTGGGCAGAGAGCCTCAGG + Exonic
1053183233 9:35992219-35992241 TTGGATGGGCAGAGAGCCCCAGG + Intergenic
1053184511 9:36003801-36003823 TTGGGTGGGCAGAGAGGCCCAGG + Intergenic
1053185535 9:36013228-36013250 ATGGGTGGGCAGAGAGGCCCAGG - Intergenic
1054357202 9:64072128-64072150 CAGGGTGGGAGGGGGTCCCCAGG + Intergenic
1054454697 9:65423850-65423872 CAGCGAGGTCAGATGGCCCCTGG + Intergenic
1055447020 9:76394060-76394082 CAGGGCGGCCAGAGTCCCCCGGG - Intronic
1056105377 9:83341878-83341900 CAGGGAGGGCGGTGGGCCACAGG + Intronic
1056444190 9:86648858-86648880 CAGTGAGGGCAGGTGGCCCCGGG - Intergenic
1056715251 9:89023143-89023165 CAGGGTGGGCCTGAGGCCCCAGG - Intronic
1057183251 9:93040982-93041004 CAGGGTGGGAGGAGGCCCCAAGG - Intergenic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1058433596 9:104941136-104941158 CAAGGTGGGCAGATCGCCCGAGG - Intergenic
1058645148 9:107124996-107125018 CAGGGTGAGGAGAGAGCCCTTGG + Intergenic
1059421139 9:114193153-114193175 CAGGGAGGGGAGAGGGCTCAAGG + Intronic
1059439562 9:114299377-114299399 AAGGGAGGGCTGGGGGCCCCTGG - Intronic
1059804840 9:117787434-117787456 CAGGGTGGGCAGGTGACCACGGG - Intergenic
1060091798 9:120749545-120749567 CAAGGTGGGCAGATGGCCTGAGG - Intergenic
1060154364 9:121308970-121308992 CACAGTGGGCTGAGGGGCCCTGG + Intronic
1060403766 9:123362817-123362839 CAGGGTGGGCAGAGGTTACAAGG - Intronic
1060926169 9:127456917-127456939 CAGGGCTGGCAGAGGGGCCAGGG - Intronic
1061052904 9:128206554-128206576 CAGGGAGGTCAGAGGTCTCCAGG + Intronic
1061089772 9:128420355-128420377 CAGGGCCGCCAGAGGGCGCCCGG + Intronic
1061148949 9:128818205-128818227 CAGAGCAGGCACAGGGCCCCAGG - Intergenic
1061249837 9:129420286-129420308 CTAGGTGGGCAGAGGGAGCCGGG + Intergenic
1061547862 9:131315175-131315197 CAGGGTAGGCTGAGGGGGCCAGG + Intergenic
1061805066 9:133133230-133133252 CAGGGTGGGCAGGGCTACCCGGG + Intronic
1061930943 9:133832896-133832918 CAGGGTGGACAGTGGCCTCCAGG + Intronic
1062022839 9:134327191-134327213 CCGGGTGGGCAGGGTCCCCCGGG + Intronic
1062029485 9:134355816-134355838 CAGGGTGAGCCCAGGGCCCTGGG - Intronic
1062065977 9:134526437-134526459 CAGGGTGGGTTGAGGGTTCCTGG - Intergenic
1062269163 9:135700810-135700832 CAGGGCCGGGAGAGGGGCCCAGG - Intergenic
1062324021 9:136003997-136004019 CAGGGTGGCCACAGTTCCCCAGG + Intergenic
1062341122 9:136094473-136094495 CGGGGTGCGCGGCGGGCCCCGGG + Intronic
1062367079 9:136215762-136215784 CTGGGAGGGCTGAGAGCCCCAGG + Intronic
1062390328 9:136331275-136331297 CAAGGTGCGAACAGGGCCCCAGG - Intronic
1062505229 9:136870674-136870696 CATGGTGGGCAGAGGGACAGGGG - Intronic
1062600467 9:137316710-137316732 CAGAGTGGGGCGAGGGCCCCGGG + Intronic
1062650012 9:137570781-137570803 CAGGGTGGGCAGTGGTCCTAAGG - Intronic
1202800944 9_KI270719v1_random:174916-174938 CAGTGGCTGCAGAGGGCCCCTGG + Intergenic
1203699084 Un_GL000214v1:120886-120908 CAGGGAGGGTGGAGAGCCCCAGG + Intergenic
1203700038 Un_GL000214v1:127196-127218 CAGGGAGGGTGGAGAGCCCCAGG + Intergenic
1203700949 Un_GL000214v1:133180-133202 CAGGGAGGGTGGAGAGCCCCAGG + Intergenic
1203569382 Un_KI270744v1:117134-117156 CAGGGAGGGTGGAGAGCCCCAGG + Intergenic
1203570332 Un_KI270744v1:123415-123437 CAGGGAGGGTGGAGAGCCCCAGG + Intergenic
1203574582 Un_KI270744v1:165300-165322 AAGGGCGGGCAGTGGGGCCCAGG + Intergenic
1185487951 X:497520-497542 CAGGGTGGGCTCGGGGCCCCGGG + Intergenic
1185737149 X:2502473-2502495 CAGGGTGGGGAGGGGGCTCGTGG - Intronic
1185836011 X:3346483-3346505 CAGGGTGGCCAGGGCGCCCCAGG - Intronic
1187103997 X:16221761-16221783 CTGGTTGGTCAGAGGGCCCAAGG + Intergenic
1189051464 X:37650067-37650089 CAAGGTGGGCAGATCGCCCGAGG + Intronic
1190266370 X:48829533-48829555 CTGGGCGGGGTGAGGGCCCCAGG - Exonic
1190596801 X:52059933-52059955 CGGGGTCTGCAGAAGGCCCCAGG + Intergenic
1190612023 X:52194140-52194162 CGGGGTCTGCAGAAGGCCCCAGG - Intergenic
1191254320 X:58273266-58273288 CAAGGTGGGAAGAAGTCCCCCGG - Intergenic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192264636 X:69530125-69530147 CAGAATGGCCAGAGGGCCTCAGG + Exonic
1195505754 X:105654966-105654988 AAGGGTAGGCAGAAGCCCCCGGG + Intronic
1196001987 X:110795972-110795994 GAGGGCGGGCAGGTGGCCCCGGG - Intergenic
1197239022 X:124103556-124103578 CAGGGTGGGAAGGGGGGCTCAGG - Intronic
1197720049 X:129738998-129739020 CAGGGTGGGCAGAGGAGCTTTGG - Intronic
1200063543 X:153494409-153494431 AAGGGAGGGCACAGGGCGCCAGG + Intronic
1200066024 X:153504452-153504474 GAGTGTGGGCAGAGGGCTCCAGG - Intronic
1200120338 X:153787213-153787235 CGGGGCGTGCAGAGGGCCCCAGG + Intronic
1200256413 X:154585323-154585345 CACGGGCGGCAGAGGTCCCCGGG + Exonic
1200261356 X:154619080-154619102 CACGGGCGGCAGAGGTCCCCGGG - Exonic
1200267339 X:154653377-154653399 CACGGGCGGCAGAGGTCCCCGGG - Exonic
1201240663 Y:11954327-11954349 CAGGGTGGCCAGGGTGCCCGTGG + Intergenic