ID: 1163635068

View in Genome Browser
Species Human (GRCh38)
Location 19:18433837-18433859
Sequence GCCCGACGCCGCCGCGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 262}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163635068_1163635089 15 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635089 19:18433875-18433897 GCAGGCCCCGGCGGGGCGGCCGG 0: 2
1: 0
2: 6
3: 53
4: 589
1163635068_1163635085 6 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635085 19:18433866-18433888 GGCTGGCGGGCAGGCCCCGGCGG 0: 1
1: 1
2: 3
3: 64
4: 549
1163635068_1163635093 19 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635093 19:18433879-18433901 GCCCCGGCGGGGCGGCCGGGGGG 0: 2
1: 2
2: 9
3: 96
4: 898
1163635068_1163635080 -8 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635080 19:18433852-18433874 CGTCGGGCCGGAGGGGCTGGCGG 0: 1
1: 0
2: 0
3: 16
4: 296
1163635068_1163635081 -7 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635081 19:18433853-18433875 GTCGGGCCGGAGGGGCTGGCGGG 0: 1
1: 0
2: 5
3: 39
4: 416
1163635068_1163635090 16 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635090 19:18433876-18433898 CAGGCCCCGGCGGGGCGGCCGGG 0: 2
1: 0
2: 5
3: 54
4: 439
1163635068_1163635087 8 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635087 19:18433868-18433890 CTGGCGGGCAGGCCCCGGCGGGG 0: 2
1: 0
2: 1
3: 31
4: 284
1163635068_1163635092 18 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635092 19:18433878-18433900 GGCCCCGGCGGGGCGGCCGGGGG 0: 3
1: 0
2: 10
3: 85
4: 755
1163635068_1163635084 3 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635084 19:18433863-18433885 AGGGGCTGGCGGGCAGGCCCCGG 0: 1
1: 1
2: 3
3: 90
4: 818
1163635068_1163635086 7 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635086 19:18433867-18433889 GCTGGCGGGCAGGCCCCGGCGGG 0: 1
1: 1
2: 2
3: 60
4: 681
1163635068_1163635082 -3 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635082 19:18433857-18433879 GGCCGGAGGGGCTGGCGGGCAGG 0: 1
1: 0
2: 28
3: 143
4: 1488
1163635068_1163635091 17 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635091 19:18433877-18433899 AGGCCCCGGCGGGGCGGCCGGGG 0: 2
1: 0
2: 8
3: 48
4: 557
1163635068_1163635088 11 Left 1163635068 19:18433837-18433859 CCCCCCCCGCGGCGGCGTCGGGC 0: 1
1: 0
2: 5
3: 16
4: 262
Right 1163635088 19:18433871-18433893 GCGGGCAGGCCCCGGCGGGGCGG 0: 2
1: 1
2: 4
3: 79
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163635068 Original CRISPR GCCCGACGCCGCCGCGGGGG GGG (reversed) Intronic
900113644 1:1019863-1019885 GCCCGGCGCGGCCGTGGGGCGGG - Intergenic
901109611 1:6784851-6784873 GCCCGCCGCCGCTGCCGGTGGGG - Intergenic
901628976 1:10639031-10639053 GCCCGAGGCGGCGGCGGAGGCGG - Exonic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
902585736 1:17437959-17437981 GCCCGGGCCCGCGGCGGGGGAGG - Intronic
903703509 1:25267981-25268003 GCGCGACTGAGCCGCGGGGGTGG + Intronic
903750582 1:25618051-25618073 GCCCGGGGCCGGCGCGGCGGGGG - Exonic
904050206 1:27634288-27634310 GGCCGAGACCGCCGCGGGCGCGG + Intronic
904485939 1:30824608-30824630 GGCCGGCGCCCCCGCCGGGGCGG + Intergenic
905369202 1:37474399-37474421 GCGCGCAGCGGCCGCGGGGGCGG + Intergenic
905449289 1:38046650-38046672 CCCGGACGCCGCGGCGGCGGCGG - Exonic
907038359 1:51236447-51236469 GGCCGCCGCCGCCCCGCGGGGGG + Exonic
907429885 1:54405789-54405811 GCCCGCCGCGGCCTCGGGGAAGG + Intronic
908523394 1:64966129-64966151 GCCCGCCGGCTCCGCGGGGCTGG + Intronic
908555599 1:65254345-65254367 GCCAGGCGCCGCCGTGTGGGCGG + Intronic
908951601 1:69568363-69568385 GCCCGAAGCGCCGGCGGGGGAGG - Intergenic
910450155 1:87335556-87335578 GCCCGGCGCGGCCGGGGGTGGGG + Intronic
910787997 1:91021660-91021682 GGCGGCCGCCGCCGCGGGGCGGG - Intronic
912471856 1:109911681-109911703 GCCCCAAGCAGCCCCGGGGGTGG - Intronic
914803099 1:150974573-150974595 GCCCGAGCCCCGCGCGGGGGTGG - Intronic
916548368 1:165827763-165827785 GTCCGACGCGGGCGCGGGCGGGG + Exonic
916792349 1:168136153-168136175 GCCCGGCGCCGCCGGATGGGCGG - Intronic
917438617 1:175045704-175045726 GCCCGACATCGCCGCGGGCCCGG + Intergenic
918040619 1:180912285-180912307 GCCCGCCGCCGCCTTGGGTGGGG - Intergenic
920021134 1:202957804-202957826 CCCCGAGGCCGCCGCGCGTGGGG - Intronic
922526703 1:226309411-226309433 GCCCGGCGCCGGAGCGCGGGGGG + Exonic
922783321 1:228269980-228270002 GCCCGGCGCGGCCGCGGCCGGGG - Intronic
923506401 1:234609606-234609628 GGCCGCCGCCGCCGCTGGTGGGG - Intergenic
924179148 1:241424067-241424089 GCCCGCCGCCGCTGCAGGGAGGG + Intergenic
1063504018 10:6580176-6580198 GCCCCGCGCCGCCGCCGGGAGGG - Intronic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1067091291 10:43266873-43266895 GCCCGACTGCGGCGCGAGGGCGG - Intronic
1069769355 10:70887925-70887947 CCCCGCCCCCGCCCCGGGGGTGG + Intronic
1073099528 10:100999562-100999584 GCTCGACGCGGCGGCGGCGGTGG - Exonic
1073266418 10:102230802-102230824 GCCCGGGGCAGCCGCGGCGGAGG + Exonic
1074008953 10:109457103-109457125 GCCAGTCGCCGCCGCGCAGGCGG + Intergenic
1075054361 10:119207033-119207055 GCCGGCCGCCGCCGCGTGCGGGG + Intergenic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1076817064 10:132920257-132920279 GCCCTGCGCCGGCGCCGGGGTGG + Intronic
1077048004 11:554715-554737 GCCTGAGGCCGCCGGGGGTGCGG + Exonic
1077115041 11:880325-880347 GCCTGACCCTGCTGCGGGGGCGG - Intronic
1077134909 11:993681-993703 GCAGCACGCCCCCGCGGGGGGGG - Intronic
1079035184 11:17014411-17014433 GCGCGGAGCCGCCGCGGGGTGGG + Exonic
1079163168 11:18012960-18012982 GAGCGCGGCCGCCGCGGGGGCGG + Exonic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1081492584 11:43579622-43579644 GCCCGCCGCCGCCGCGGCGCGGG - Intronic
1083751866 11:64765493-64765515 GGCCATCGCCGCCGCGGGGAGGG + Exonic
1083876096 11:65525126-65525148 GCCCGAACCCGCGGCGGCGGTGG + Exonic
1083965738 11:66042677-66042699 GGCCGGCGCCGCCGCCGGGCAGG + Exonic
1083970307 11:66070406-66070428 CCCCGCCGCCGCCGCCGCGGGGG + Intronic
1084151393 11:67289417-67289439 GCCCGAAGCCGAGGCGGGGCCGG + Exonic
1084165294 11:67372607-67372629 CCCCGCCCCCGCCGCGGGGAAGG - Intronic
1084546846 11:69818946-69818968 AGCCGCCGCCGCCGCGGGGCGGG - Exonic
1084680110 11:70662060-70662082 TCCCGACGCCGCCGCTGCTGAGG - Intronic
1085096038 11:73761215-73761237 CCCCGTCGCCGCCGTGCGGGAGG - Intergenic
1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG + Intronic
1089046105 11:115503559-115503581 GCCCGGCCCCGCGGGGGGGGCGG - Intronic
1091558584 12:1594167-1594189 GCCCGAGGCGGCGGCGGCGGCGG - Intronic
1091823171 12:3491303-3491325 CCCCGAAGCCTCCGCGGCGGCGG - Exonic
1092256236 12:6928064-6928086 GCCGGGCGGCGCGGCGGGGGCGG + Intronic
1092502650 12:9064542-9064564 GCCCGCCGCCGCCGCGGAGTGGG + Intergenic
1092820616 12:12350338-12350360 GCCCGGAGCCTCCGCGGGGAGGG - Exonic
1092894878 12:13001430-13001452 GCCTGTGGCGGCCGCGGGGGTGG + Intergenic
1096460715 12:51820389-51820411 CCCCGCCGCCTCCGCGTGGGAGG - Intergenic
1100260660 12:92929342-92929364 GCCCGCGGCCGCCGGGGGGCGGG + Intergenic
1100444820 12:94650585-94650607 CGCCGCCGCCGCCGCGGGGTGGG + Intergenic
1103309016 12:119989681-119989703 GCGTGCCGCCGGCGCGGGGGAGG + Intergenic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103649640 12:122422636-122422658 GCCCGGCCCCGCGGCGGCGGCGG - Intergenic
1104912299 12:132245116-132245138 GCCTGACTCCTCCGCGGGGCAGG - Intronic
1106956335 13:34942691-34942713 GCCCGGCGCCGCGGCGCTGGTGG + Exonic
1107467877 13:40666075-40666097 GCCCGACGGCGCCGGGCTGGAGG + Exonic
1112050620 13:95641771-95641793 GGCCGCCGCCGCCGCGGGTGCGG - Exonic
1114224188 14:20723430-20723452 GCCCGAACCCCGCGCGGGGGAGG + Intergenic
1117478346 14:56118874-56118896 CCCGGACGGCGGCGCGGGGGCGG + Intronic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1117899136 14:60515142-60515164 GCCCGGCGCCGCCGACGGGAAGG + Intronic
1118220968 14:63853767-63853789 GCCTAGCGCCTCCGCGGGGGCGG + Intronic
1118849475 14:69573077-69573099 GGCCGAGGCCGCGGCGGCGGCGG + Exonic
1119438148 14:74611459-74611481 CCCCAACCCCGCCGCGAGGGCGG - Exonic
1121050454 14:90816367-90816389 TCCCGCCGCCGCCGCGGGCTCGG + Exonic
1121050457 14:90816369-90816391 GCCCGAGCCCGCGGCGGCGGCGG - Exonic
1121710982 14:96039232-96039254 GACGGACCCCGCCCCGGGGGTGG + Intergenic
1122672806 14:103385261-103385283 TCCAGACCTCGCCGCGGGGGCGG - Intergenic
1122689123 14:103523189-103523211 GCCCCTCGCCGCCGCCGCGGGGG - Intergenic
1122898061 14:104770157-104770179 TCCCTACCCCGCTGCGGGGGAGG + Exonic
1123004522 14:105314883-105314905 GCCCCAGGCCGCCGAGGGAGCGG + Exonic
1123036716 14:105474689-105474711 GCCTGGGGGCGCCGCGGGGGCGG - Intronic
1123464559 15:20505967-20505989 GCCCGAGGCTGCCCCGCGGGTGG + Intergenic
1123653555 15:22495074-22495096 GCCCGAGGCTGCCCCGCGGGTGG - Intergenic
1123743975 15:23303934-23303956 GCCCGAGGCTGCCCCGCGGGTGG - Intergenic
1124275288 15:28321934-28321956 GCCCGAGGCTGCCCCGCGGGTGG + Intronic
1124307416 15:28589667-28589689 GCCCGAGGCTGCCCCGCGGGTGG - Intergenic
1125594233 15:40874063-40874085 GCGCTACGCCGCCGCGGGGGAGG + Exonic
1128455192 15:67827979-67828001 GCCCGAGGCGGCGCCGGGGGCGG - Intronic
1129116499 15:73368082-73368104 ACCCGCGGCCGCCGAGGGGGAGG + Exonic
1132079472 15:98852304-98852326 GCCCCACCCCGCCCCGGGTGAGG + Intronic
1132398244 15:101489589-101489611 CACCGACACCGCCGCGGGCGCGG - Exonic
1132724674 16:1333610-1333632 GGCGGACGCCGCTGCGGGGGCGG - Intronic
1132947078 16:2537788-2537810 GCCCGACCCCGCCTGGGGAGGGG - Intergenic
1135572280 16:23558029-23558051 GGCTGAAGCCGCGGCGGGGGCGG + Exonic
1135821733 16:25691916-25691938 GCCCGGCGCCGCCGAGGGAAGGG - Intergenic
1138360748 16:56425438-56425460 GCCCGGCGCGGCGGCGGCGGCGG - Exonic
1138590430 16:57996547-57996569 GCCCTCCGCTGCCGCGGCGGCGG + Exonic
1139806177 16:69566570-69566592 GGCCGGCGGCTCCGCGGGGGAGG - Intronic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1142271831 16:89093912-89093934 GCCCGACCCCGGCGCGCGCGCGG + Exonic
1142300892 16:89257276-89257298 GCGAGACGCTGCCGCGGGGTCGG - Intergenic
1142376873 16:89711139-89711161 GCCCCCCGCCCCCGCTGGGGAGG + Intronic
1142474620 17:181519-181541 GCGCGACCCCGGCCCGGGGGCGG + Exonic
1143519211 17:7436140-7436162 GCCCAAAGCCGGGGCGGGGGCGG - Intronic
1143590956 17:7885532-7885554 GCCGGACGGCGGCGTGGGGGAGG + Intronic
1145878141 17:28335343-28335365 GCGCGCTGCCGCCGCGGGGCCGG - Exonic
1146229541 17:31095450-31095472 GCCTGAGGCAGCCGCGGGGGAGG - Intronic
1146581193 17:34040113-34040135 GCCCGACGCGGCCCCGGGCCCGG + Intronic
1147393008 17:40121875-40121897 GGCCGCCGCCGCCTCGAGGGGGG - Intergenic
1148826460 17:50397617-50397639 GCACGTCGCCGCCGCCGGAGGGG + Intergenic
1149431501 17:56597835-56597857 GCCCGAAGCCGCTGCGGCCGCGG + Intergenic
1149616586 17:58006414-58006436 GGCCGAGGCGGCGGCGGGGGTGG - Exonic
1149678697 17:58488474-58488496 GCACGCGGCCGCCGAGGGGGAGG - Intergenic
1150128454 17:62653377-62653399 TCCAGACCCCGCCCCGGGGGTGG - Intronic
1152222209 17:79075059-79075081 GGCCGCCGCCGCCGCGGCCGCGG - Exonic
1152396302 17:80035759-80035781 CCCGGACGGGGCCGCGGGGGCGG - Intronic
1152654841 17:81514707-81514729 GCGTGACGCGGCCGCGGAGGAGG - Intronic
1152654946 17:81515013-81515035 GCCCGGCGCCTCCGAGGGGTCGG + Intronic
1152744214 17:82031686-82031708 GCCCGGCGCCGCAGCGGCCGCGG - Exonic
1153886976 18:9475755-9475777 GCGCGAGGCCGGCGCGGGAGAGG - Intronic
1154125695 18:11689985-11690007 GCCCGCCGCCCCCGCGGGCCCGG - Intronic
1159955523 18:74515975-74515997 GCCCGTCGCTGCAGCGTGGGTGG - Intronic
1160508883 18:79442309-79442331 GACCGACGCCTCGGCGAGGGTGG - Intronic
1160930597 19:1568016-1568038 GCCCGACGGCGGCGGGGGCGGGG - Exonic
1160967782 19:1754122-1754144 GCCAGACGCTGCGGCGGGGGTGG - Exonic
1160991601 19:1862580-1862602 CCGCGTCGCCGCCGCCGGGGTGG - Intronic
1161031896 19:2061444-2061466 GCGCGCGGCCGCCGCCGGGGAGG - Intergenic
1161388019 19:4007343-4007365 GCCCGACGCCGCCGGGAGTCTGG + Intergenic
1161606642 19:5218752-5218774 GCCTGAAGCCTCCACGGGGGAGG + Intronic
1162128227 19:8510845-8510867 CCCCGACGCCCCCGCGGGTAAGG - Exonic
1162572241 19:11480341-11480363 GTCCGACGCCGCCCTGGAGGCGG - Intronic
1163158204 19:15450068-15450090 CCCCCTCGCCGCCCCGGGGGGGG + Intergenic
1163513057 19:17747652-17747674 TCCTGGCGCCGTCGCGGGGGTGG + Intergenic
1163635068 19:18433837-18433859 GCCCGACGCCGCCGCGGGGGGGG - Intronic
1163666692 19:18606865-18606887 GCCCGCCGCCCCCCCGGGGCCGG - Intronic
1163743881 19:19033459-19033481 GCCTGAGGCGGCGGCGGGGGTGG - Intronic
1163843967 19:19628302-19628324 CCCCGACGCGGCCGTGGAGGCGG - Intronic
1166979875 19:46625997-46626019 GCCCGAGGCTGCAGCGGTGGTGG - Intergenic
1167220399 19:48195369-48195391 GGCCGACGCGGCCGGGGAGGCGG + Exonic
1167272069 19:48511442-48511464 CAGCGAGGCCGCCGCGGGGGTGG + Intronic
1168305539 19:55433278-55433300 GTCCGACGCCGGCGGGGGCGGGG - Exonic
1202683588 1_KI270712v1_random:30377-30399 GCAAAACGCCGCGGCGGGGGCGG - Intergenic
925182105 2:1824000-1824022 GCCCGGCGGCCCCGCTGGGGGGG - Intronic
927168581 2:20350322-20350344 GCCCCACGCCCCCGAGGCGGCGG + Intronic
927751455 2:25673712-25673734 GCGGGGCGCGGCCGCGGGGGCGG - Intergenic
928303524 2:30147321-30147343 GCCCGGCTGCGCGGCGGGGGCGG - Intronic
928511771 2:32010089-32010111 GCCCGCCGCCGCCGCGGGGCCGG + Intronic
928511774 2:32010091-32010113 GCCCGGCCCCGCGGCGGCGGCGG - Intronic
930011415 2:46941026-46941048 CTCCGACTCCGCGGCGGGGGCGG + Intronic
930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG + Intronic
931291841 2:60881026-60881048 TCCCGCCGCTGGCGCGGGGGTGG + Intergenic
932495298 2:72143175-72143197 GCCCTAAGCCGCCGGGAGGGAGG - Intronic
934031861 2:88055595-88055617 GGCCGCCCCCGCCGCCGGGGCGG + Intronic
935396880 2:102619262-102619284 GTCCGACGCTGCCTCCGGGGCGG + Intergenic
936038323 2:109129645-109129667 GGCGGCCACCGCCGCGGGGGCGG + Exonic
941096688 2:161245165-161245187 GCCCGGCGCGGCCGCGGCCGGGG - Intergenic
942446191 2:176080407-176080429 GCCGGCCGCCGCCGCCGAGGAGG + Exonic
944553264 2:200864714-200864736 GCGCGTCTCCGCCGCGGGGCGGG + Intronic
945225872 2:207530478-207530500 TCCCGCCGCCGCCGCCGGGCCGG + Intronic
945225890 2:207530515-207530537 ACCCGGAGCCGCCCCGGGGGAGG + Intronic
946921381 2:224585021-224585043 ACCTGAAGCCGCCGCCGGGGAGG - Exonic
947873494 2:233452985-233453007 GCCCCACGCAGCCCCAGGGGAGG - Intronic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
948993170 2:241564763-241564785 GGCCGACGCCGGCGCGTGGGTGG + Intronic
1168965228 20:1894688-1894710 CCCGGGCGCCGGCGCGGGGGAGG + Intronic
1169171826 20:3471347-3471369 GGCCGAGGCCGCGGCGGCGGCGG + Exonic
1169367278 20:5001553-5001575 GCCCCAGACCGGCGCGGGGGCGG - Intronic
1173221575 20:41136869-41136891 GCCCCGCGCTGCCGGGGGGGCGG + Intergenic
1173672862 20:44810268-44810290 GCCCGGCGCCGGCGCGGGCATGG - Exonic
1174607036 20:51768456-51768478 GCGCCGCGCCGCCCCGGGGGAGG + Exonic
1175926550 20:62474245-62474267 GCCCGGCGCCGGCGCGAGGGAGG + Intronic
1176156937 20:63626796-63626818 GCCTGACGCCGCCGCCCGCGCGG + Intronic
1176201540 20:63863033-63863055 GGCCGGCGCCGACGCGGGGCGGG + Exonic
1176286031 21:5020250-5020272 GGCCGAGGCGGCCGCGGGGGAGG - Intergenic
1176429083 21:6565037-6565059 GCCAGACCCCGCCACGGGGAGGG + Intergenic
1178327893 21:31660053-31660075 GACCGAGGCCGCCGCGGGGCTGG + Intronic
1178513832 21:33229899-33229921 CGCCGCCGCCGGCGCGGGGGCGG - Intronic
1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG + Exonic
1179704573 21:43173353-43173375 GCCAGACCCCGCCACGGGGAGGG + Intergenic
1179871150 21:44243225-44243247 GGCCGAGGCGGCCGCGGGGGAGG + Intergenic
1181586898 22:23857580-23857602 GGGAGTCGCCGCCGCGGGGGGGG - Intronic
1181592674 22:23894725-23894747 GCCCGACGAGGTCGCTGGGGCGG + Exonic
1181670652 22:24424161-24424183 GCCGGCAGCCGCCGCGGGGCAGG - Intronic
1183080490 22:35452718-35452740 GTCCGACTCCTCCGCTGGGGTGG + Intergenic
1183452783 22:37906012-37906034 GCCCGGCGCCGTCGAGGGGCGGG + Intronic
1183525002 22:38317495-38317517 GCCCGCCGCCGCCGCCCCGGAGG + Intronic
1183939520 22:41285569-41285591 GCCCGGGGCCCCCGCGGGCGTGG + Intronic
1184184779 22:42857259-42857281 GAGCGACGAGGCCGCGGGGGCGG + Exonic
1185055263 22:48575863-48575885 GCCCGCCGCGGCGGCGGTGGCGG + Intronic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
951543673 3:23806199-23806221 GCACGGGGCCGGCGCGGGGGGGG + Intronic
952942685 3:38455501-38455523 TCCCCACGCTGCTGCGGGGGTGG + Intronic
959849824 3:111072388-111072410 GACCCGCGCGGCCGCGGGGGAGG - Intronic
963253096 3:143120076-143120098 GCGCGACCCCGCAGCGGCGGCGG - Exonic
964358519 3:155871168-155871190 GCCCCACAGCGGCGCGGGGGAGG - Intronic
967904102 3:194486795-194486817 GCACGCCGCCGCCGCGGGCGCGG - Intronic
968186961 3:196639634-196639656 GCGCGGCGCGGGCGCGGGGGTGG - Intergenic
968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372739 4:10939-10961 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968835792 4:2963577-2963599 GCCCCTCGCCGCCGCGGCCGGGG - Intergenic
969113372 4:4857075-4857097 CCTGGACTCCGCCGCGGGGGGGG - Intergenic
971230842 4:24799481-24799503 GCGGGACGCCCCCGCGGAGGTGG - Intronic
971457935 4:26861325-26861347 GCCGGCCGCCGCGGCGGGAGAGG - Exonic
978443975 4:108763119-108763141 GCCCGCGGCCCCGGCGGGGGAGG - Intergenic
982245253 4:153344634-153344656 CGCCGACTACGCCGCGGGGGCGG - Exonic
984811096 4:183797358-183797380 GCCCAGCGGCCCCGCGGGGGCGG - Intergenic
985462652 4:190121598-190121620 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462662 4:190121656-190121678 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462667 4:190121685-190121707 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462672 4:190121714-190121736 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462677 4:190121743-190121765 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985688552 5:1294743-1294765 GCCGGACGCCGACCCCGGGGAGG + Intronic
986831138 5:11579864-11579886 GCTGGACGCCGCAGCCGGGGAGG - Intronic
987050462 5:14143751-14143773 GCCGGAGGACGCGGCGGGGGCGG - Exonic
988727324 5:33938048-33938070 GCCCCACGCGGCCGCGGAGCCGG + Exonic
989229989 5:39074476-39074498 CGCCGTCGCCGCCGAGGGGGCGG - Intergenic
989812669 5:45696207-45696229 GCCCGTCGCGGCGGCGGCGGCGG + Intergenic
992939530 5:81750087-81750109 GCCAGCCGCCGCCGCGGAGTTGG + Intronic
994072732 5:95620470-95620492 GCCCGCCGCCGCCGCACAGGCGG - Exonic
994171402 5:96662602-96662624 CCCCGGCGCCCCCGCGGGGCAGG + Intronic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
1002187119 5:177459570-177459592 GCCCCAGGCCTCGGCGGGGGTGG - Intronic
1007558108 6:42783149-42783171 GCGCGCCGCCGCCGCGGGCTCGG - Intronic
1007631702 6:43276467-43276489 GCGCGGCGCCGCCACGGGGGTGG + Intronic
1011640192 6:89411343-89411365 GCCCCGCGTCGCCGCGGGAGGGG - Intronic
1012916865 6:105179953-105179975 GCCCGGCGCCGCAGGGTGGGCGG - Intronic
1015749960 6:136550009-136550031 ACCCGAGGCCGCGGCGGGGAGGG + Intronic
1016923214 6:149317061-149317083 GGCCGGCGGCGCCGCGCGGGTGG - Intronic
1017877666 6:158537275-158537297 TCCCGACGCCGCAGCGCGCGCGG - Intronic
1019404520 7:876696-876718 GCTGGACGCCGCCGCGGTTGCGG - Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019992773 7:4703499-4703521 GCCCGACCCTGCTGCGCGGGAGG + Intronic
1020037664 7:4974442-4974464 GCCCGAGGCCGCCGCGGAGGCGG + Intergenic
1020162154 7:5781182-5781204 GCCCGAGGCCGCCGCGGAGGCGG - Intronic
1021231099 7:18086896-18086918 CGCCGCCGCCGCCGCGCGGGGGG - Intergenic
1021313176 7:19117147-19117169 GCCCGGCGGAGCCGCGGGTGGGG - Exonic
1026000464 7:66556696-66556718 GCAGGACGCCGCCTCGGCGGGGG - Intergenic
1026360502 7:69598233-69598255 GCCGGCCGGGGCCGCGGGGGCGG + Intergenic
1029456912 7:100676129-100676151 GCCCGAGGCCGCCGGGGAAGTGG - Intronic
1029493582 7:100885262-100885284 GCCCAAGGACGCCGCGGGGCTGG + Exonic
1029604493 7:101590418-101590440 GCACCAGGCCACCGCGGGGGTGG - Intergenic
1031899434 7:127392847-127392869 GCCCGCCGCGGCCGGTGGGGAGG + Intronic
1032014534 7:128369597-128369619 GGCCGAGGCCGGAGCGGGGGCGG + Intergenic
1032021559 7:128409662-128409684 ACCCGGCGACGCTGCGGGGGAGG - Intronic
1032037590 7:128531549-128531571 GCCCGACGCGGGCGCGGGACCGG - Intergenic
1032075154 7:128832584-128832606 GCCAGGCACCGCCACGGGGGAGG - Intronic
1032122873 7:129169356-129169378 GGCCTAGGCCGCCGCGGGGGCGG - Intronic
1034781867 7:153888238-153888260 TCCAGACGCCGCCGCCGGGCGGG + Intronic
1036454288 8:8893682-8893704 TCCCGGCACCGCCCCGGGGGCGG + Intergenic
1037535222 8:19817431-19817453 CGCCGCCGCCACCGCGGGGGAGG - Exonic
1037820320 8:22131925-22131947 TCCCGGCTCCGCTGCGGGGGTGG + Intronic
1038566283 8:28622581-28622603 GCCGGGAGCCGCCGAGGGGGCGG + Intronic
1041369458 8:57143461-57143483 GCCCTCCGCCGCAGCGGGGCTGG + Intergenic
1043428461 8:80171564-80171586 GCCCGACGCCTCTGGGGGTGGGG - Intronic
1045222577 8:100213258-100213280 GCCCGCCGCCGCCGCCGCAGAGG - Exonic
1049109790 8:140635638-140635660 ACCCGACGCGGCCGGGGCGGCGG + Intergenic
1049850529 8:144827792-144827814 ACCTCGCGCCGCCGCGGGGGAGG - Intronic
1050472542 9:6008034-6008056 GCGCGCCGCCGCCGGGGGGGAGG - Intergenic
1050552245 9:6758379-6758401 GCCGGCCGCGGCCGCAGGGGAGG + Intronic
1051287390 9:15510767-15510789 GAGCGACGCCACCGAGGGGGGGG + Intronic
1053129132 9:35605445-35605467 GCCAGCCGGCGCGGCGGGGGCGG + Intronic
1053239861 9:36487204-36487226 GCCCGGCCCCGCCGACGGGGAGG - Intronic
1056746763 9:89310440-89310462 GCCCGGAGCCGGCGCGGTGGCGG - Intergenic
1057489149 9:95508373-95508395 CGCCGCCGCCGCCGCGGGGACGG + Exonic
1057881528 9:98796302-98796324 GCCCGGGGCCGCAGCGGCGGGGG - Exonic
1061700277 9:132410359-132410381 GTCAGGGGCCGCCGCGGGGGCGG - Exonic
1062400425 9:136370286-136370308 GCCCGACGCCTCCGGGTAGGAGG - Exonic
1062472458 9:136712494-136712516 GGCCGACGGCGGCGCGGCGGGGG - Intergenic
1062595070 9:137295744-137295766 ACCAGACGCCGCCGCGCGTGGGG - Intergenic
1189474021 X:41334992-41335014 GCCCTGCGCCGCAGCCGGGGAGG + Intronic
1189821593 X:44873836-44873858 GCCCGAGGCCCCAGCGGAGGCGG - Intronic
1198517842 X:137427146-137427168 GGCCGACGCCGACGGGAGGGAGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic