ID: 1163635581

View in Genome Browser
Species Human (GRCh38)
Location 19:18435749-18435771
Sequence GAGCCTGACCACTGCGTGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163635581_1163635584 1 Left 1163635581 19:18435749-18435771 CCACGCACGCAGTGGTCAGGCTC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635581_1163635585 2 Left 1163635581 19:18435749-18435771 CCACGCACGCAGTGGTCAGGCTC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1163635585 19:18435774-18435796 CGCCGGGCGTATAGAGCACTGGG 0: 1
1: 0
2: 0
3: 1
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163635581 Original CRISPR GAGCCTGACCACTGCGTGCG TGG (reversed) Exonic