ID: 1163635581

View in Genome Browser
Species Human (GRCh38)
Location 19:18435749-18435771
Sequence GAGCCTGACCACTGCGTGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163635581_1163635584 1 Left 1163635581 19:18435749-18435771 CCACGCACGCAGTGGTCAGGCTC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635581_1163635585 2 Left 1163635581 19:18435749-18435771 CCACGCACGCAGTGGTCAGGCTC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1163635585 19:18435774-18435796 CGCCGGGCGTATAGAGCACTGGG 0: 1
1: 0
2: 0
3: 1
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163635581 Original CRISPR GAGCCTGACCACTGCGTGCG TGG (reversed) Exonic
900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG + Intergenic
900871501 1:5307277-5307299 GGGCCTGACCTCTGCCTGCAGGG - Intergenic
902728685 1:18354112-18354134 GAGCCTGTCCTCTGGGTGCCTGG - Intronic
905668306 1:39775514-39775536 GAGCCTGCCCACTGCCTGGATGG + Intronic
915166592 1:153951475-153951497 GAGCCGGAGCACTGAGTGAGGGG + Exonic
917814458 1:178693463-178693485 GAACCTGAGCACTGGGTGTGTGG - Intergenic
1065162949 10:22942283-22942305 GAGCCTGAACACTGTGGGTGCGG + Intronic
1067038114 10:42933868-42933890 GTGCCTGGGCACGGCGTGCGGGG - Intergenic
1067419391 10:46133566-46133588 GAGACTGAGCACTGAGTGCTAGG - Intergenic
1067426615 10:46215845-46215867 GAGACTGAGCACTGAGTGCTAGG + Intergenic
1067504742 10:46840163-46840185 GAGACTGAGCACTGAGTGCTAGG - Intergenic
1070766482 10:79059485-79059507 GAGACTGCCCACTGCGGGAGGGG + Intergenic
1073336556 10:102714450-102714472 TAGCCCGCCCACTGCGTGGGCGG - Intergenic
1076750618 10:132540749-132540771 CAGCCTGAGCACTGCCTGCAGGG - Intronic
1076849465 10:133086017-133086039 GGTCCTGACCACCACGTGCGGGG + Intronic
1078564592 11:12403458-12403480 GAGCATTTCCACTGTGTGCGTGG + Intronic
1090076223 11:123581532-123581554 GAGCCTGTCCACTGTGGGCAGGG - Intronic
1090951513 11:131477466-131477488 GTGGCTGACCACTGAGTGGGAGG + Intronic
1095864622 12:46957885-46957907 GAGCCTGTCCACTGCTTTCCAGG - Intergenic
1105899536 13:24743379-24743401 GAGACTGACCACAGGGTGGGTGG - Intergenic
1108884519 13:55164100-55164122 GAGTTTGACCACAGCGTGCAAGG - Intergenic
1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG + Intergenic
1123036134 14:105472735-105472757 GATCCTGACCCCTGCCTGCCAGG + Intergenic
1129525098 15:76208683-76208705 GAGCCTGAGCACTCCCTGGGAGG + Intronic
1132221536 15:100108999-100109021 GAGACTGATCTCTGCGTGCACGG - Exonic
1132590632 16:724902-724924 GAGCCTCACCACAGCCTGTGTGG + Exonic
1132805822 16:1774633-1774655 CAGCCTGGCCCCTGCCTGCGGGG + Intronic
1134037161 16:11039940-11039962 GAGCCTGAGCCCTGGGTGCTAGG + Intronic
1134300826 16:12989251-12989273 GTGCCTGACCTCTGCCTGCCGGG + Intronic
1142216351 16:88831852-88831874 GAGGCTGAGCACAGGGTGCGTGG + Intronic
1151427276 17:74039177-74039199 GAGCCTGCCCACTGCTTTCAGGG + Intergenic
1152904073 17:82960946-82960968 GAGCCTGACCACAGCCTCTGGGG + Intronic
1160553794 18:79713518-79713540 CAGCCTGACCACTGCGCATGGGG - Intronic
1161664659 19:5568042-5568064 GGGCCTGCCCACTGCGTGCCGGG - Intergenic
1162924086 19:13920951-13920973 GAGCCTGACAAGTGGGTGCCTGG - Intronic
1163635581 19:18435749-18435771 GAGCCTGACCACTGCGTGCGTGG - Exonic
1165928477 19:39342065-39342087 GAGCCTGCCCCCTGCGGGCCTGG + Intronic
1166290554 19:41860546-41860568 GAGCCCGGCCCCTGCGTGTGAGG - Intronic
1167334784 19:48878070-48878092 GAGCCTGAACACTGGCTGAGGGG - Intergenic
1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG + Intronic
926092119 2:10057966-10057988 CAGCCTGGCCAGTGCCTGCGGGG - Exonic
926460053 2:13117942-13117964 GAGCCTGGCCACTCCATGCTGGG - Intergenic
927843176 2:26457894-26457916 GAGCCTGCCTCCTGCTTGCGGGG - Exonic
931695283 2:64866299-64866321 GGGTCTGGCCACTGCGGGCGGGG - Intergenic
937084097 2:119159064-119159086 GTGCCCCGCCACTGCGTGCGTGG - Intergenic
940282041 2:151998777-151998799 GAGCCTCTCCCCTGCGTTCGAGG + Intronic
943635868 2:190306316-190306338 GGGCCTGACCACTCCTTGCCTGG + Intronic
1170573845 20:17648023-17648045 GAGGCTGATGACTGCTTGCGTGG - Intronic
1175608587 20:60331500-60331522 GAGTCTGAACCCTGCGTGCCGGG - Intergenic
1175710953 20:61220545-61220567 GAGCCTGCCCTCTGCCTTCGTGG + Intergenic
1176722441 21:10403218-10403240 GAGCCTGCACACTGCGTGGAAGG + Intergenic
1179720517 21:43313782-43313804 GAGCCGGACCACGGCCTGGGTGG - Intergenic
1180303624 22:11055980-11056002 GAGCCTGCACACTGCGTGGAAGG + Intergenic
1182281222 22:29218722-29218744 GGGCCTGACCCCTGAGTGCCTGG + Intronic
1183753128 22:39733526-39733548 GACCCTGACTACTGCCTGTGTGG + Intergenic
954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG + Exonic
954793316 3:53148439-53148461 GAGGCTGACCTCTGAGTGCAGGG + Intergenic
956290442 3:67654732-67654754 GGGCCTGACCCCTGCGTCCCGGG + Intergenic
981920184 4:150078372-150078394 GGGCCTGACCGCTGCGTGGGAGG + Intronic
994350155 5:98736151-98736173 GAGTCTGTCCACTGCATGCATGG - Intergenic
1002605339 5:180379791-180379813 AAGCCTGAGCACTGTGAGCGTGG + Intergenic
1004353641 6:14912578-14912600 CTGCCTGACCACTGTGTGTGGGG - Intergenic
1010569982 6:77464170-77464192 GAGCCATGCCACTGGGTGCGCGG + Intergenic
1013761751 6:113526774-113526796 GAGCATCACCACTGAGTGGGAGG - Intergenic
1019384415 7:746547-746569 GAGCCTGGGCACGGCGGGCGGGG - Intronic
1047457927 8:125033099-125033121 GACCCTGACCTCTGCCTGGGTGG + Intronic
1048843157 8:138582338-138582360 GAGCATGCCCACTGAGTGCCTGG - Intergenic
1060970016 9:127732503-127732525 GAGCCTGGCCCCTGGGTGTGGGG + Intronic
1062410827 9:136423452-136423474 GAGCCTGACCACCGCAAGCCAGG + Exonic
1198440357 X:136657383-136657405 GACCATGACCACTGCTTGCTGGG + Intronic