ID: 1163635584

View in Genome Browser
Species Human (GRCh38)
Location 19:18435773-18435795
Sequence TCGCCGGGCGTATAGAGCAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 10}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163635577_1163635584 8 Left 1163635577 19:18435742-18435764 CCGCGCCCCACGCACGCAGTGGT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635569_1163635584 30 Left 1163635569 19:18435720-18435742 CCGGGCAACCCCGCGCCCGCGCC 0: 1
1: 0
2: 6
3: 34
4: 390
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635573_1163635584 15 Left 1163635573 19:18435735-18435757 CCCGCGCCCGCGCCCCACGCACG 0: 1
1: 0
2: 4
3: 38
4: 360
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635575_1163635584 9 Left 1163635575 19:18435741-18435763 CCCGCGCCCCACGCACGCAGTGG 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635574_1163635584 14 Left 1163635574 19:18435736-18435758 CCGCGCCCGCGCCCCACGCACGC 0: 1
1: 0
2: 6
3: 90
4: 540
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635581_1163635584 1 Left 1163635581 19:18435749-18435771 CCACGCACGCAGTGGTCAGGCTC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635579_1163635584 3 Left 1163635579 19:18435747-18435769 CCCCACGCACGCAGTGGTCAGGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635580_1163635584 2 Left 1163635580 19:18435748-18435770 CCCACGCACGCAGTGGTCAGGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635570_1163635584 22 Left 1163635570 19:18435728-18435750 CCCCGCGCCCGCGCCCGCGCCCC 0: 2
1: 11
2: 44
3: 312
4: 1750
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635571_1163635584 21 Left 1163635571 19:18435729-18435751 CCCGCGCCCGCGCCCGCGCCCCA 0: 3
1: 8
2: 48
3: 173
4: 1122
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1163635572_1163635584 20 Left 1163635572 19:18435730-18435752 CCGCGCCCGCGCCCGCGCCCCAC 0: 1
1: 7
2: 39
3: 246
4: 1552
Right 1163635584 19:18435773-18435795 TCGCCGGGCGTATAGAGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163635584 Original CRISPR TCGCCGGGCGTATAGAGCAC TGG Exonic