ID: 1163635774

View in Genome Browser
Species Human (GRCh38)
Location 19:18436716-18436738
Sequence GGCCAACCAGAGCGCGCGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 47}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163635774_1163635782 12 Left 1163635774 19:18436716-18436738 CCGCGCGCGCGCTCTGGTTGGCC 0: 1
1: 1
2: 0
3: 6
4: 47
Right 1163635782 19:18436751-18436773 GGGATGTAAACAGAAGGCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 126
1163635774_1163635776 -9 Left 1163635774 19:18436716-18436738 CCGCGCGCGCGCTCTGGTTGGCC 0: 1
1: 1
2: 0
3: 6
4: 47
Right 1163635776 19:18436730-18436752 TGGTTGGCCGCGATGAATTCGGG 0: 1
1: 0
2: 1
3: 1
4: 20
1163635774_1163635784 20 Left 1163635774 19:18436716-18436738 CCGCGCGCGCGCTCTGGTTGGCC 0: 1
1: 1
2: 0
3: 6
4: 47
Right 1163635784 19:18436759-18436781 AACAGAAGGCCGGGGCCGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 121
1163635774_1163635780 10 Left 1163635774 19:18436716-18436738 CCGCGCGCGCGCTCTGGTTGGCC 0: 1
1: 1
2: 0
3: 6
4: 47
Right 1163635780 19:18436749-18436771 CGGGGATGTAAACAGAAGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 109
1163635774_1163635783 19 Left 1163635774 19:18436716-18436738 CCGCGCGCGCGCTCTGGTTGGCC 0: 1
1: 1
2: 0
3: 6
4: 47
Right 1163635783 19:18436758-18436780 AAACAGAAGGCCGGGGCCGCAGG 0: 1
1: 0
2: 0
3: 26
4: 328
1163635774_1163635781 11 Left 1163635774 19:18436716-18436738 CCGCGCGCGCGCTCTGGTTGGCC 0: 1
1: 1
2: 0
3: 6
4: 47
Right 1163635781 19:18436750-18436772 GGGGATGTAAACAGAAGGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 204
1163635774_1163635779 6 Left 1163635774 19:18436716-18436738 CCGCGCGCGCGCTCTGGTTGGCC 0: 1
1: 1
2: 0
3: 6
4: 47
Right 1163635779 19:18436745-18436767 AATTCGGGGATGTAAACAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 100
1163635774_1163635775 -10 Left 1163635774 19:18436716-18436738 CCGCGCGCGCGCTCTGGTTGGCC 0: 1
1: 1
2: 0
3: 6
4: 47
Right 1163635775 19:18436729-18436751 CTGGTTGGCCGCGATGAATTCGG 0: 1
1: 0
2: 0
3: 0
4: 26
1163635774_1163635777 -8 Left 1163635774 19:18436716-18436738 CCGCGCGCGCGCTCTGGTTGGCC 0: 1
1: 1
2: 0
3: 6
4: 47
Right 1163635777 19:18436731-18436753 GGTTGGCCGCGATGAATTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163635774 Original CRISPR GGCCAACCAGAGCGCGCGCG CGG (reversed) Exonic