ID: 1163641444

View in Genome Browser
Species Human (GRCh38)
Location 19:18464702-18464724
Sequence GTGCCGGGCTTCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163641444_1163641455 13 Left 1163641444 19:18464702-18464724 CCCTCCTCCCTGAAGCCCGGCAC No data
Right 1163641455 19:18464738-18464760 TAATGAGTTCCCATGACTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 232
1163641444_1163641458 25 Left 1163641444 19:18464702-18464724 CCCTCCTCCCTGAAGCCCGGCAC No data
Right 1163641458 19:18464750-18464772 ATGACTCCTGGAGCTCTGCCTGG 0: 1
1: 0
2: 0
3: 18
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163641444 Original CRISPR GTGCCGGGCTTCAGGGAGGA GGG (reversed) Intronic
No off target data available for this crispr