ID: 1163641603

View in Genome Browser
Species Human (GRCh38)
Location 19:18465454-18465476
Sequence TCCGCGTCTCCTCCTCCGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 235}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163641597_1163641603 19 Left 1163641597 19:18465412-18465434 CCAGGTAGCGGCCTCCAGCCTTG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 235
1163641595_1163641603 30 Left 1163641595 19:18465401-18465423 CCACTGCTCACCCAGGTAGCGGC 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 235
1163641600_1163641603 5 Left 1163641600 19:18465426-18465448 CCAGCCTTGATGACAATGGCACT 0: 1
1: 0
2: 1
3: 23
4: 411
Right 1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 235
1163641601_1163641603 1 Left 1163641601 19:18465430-18465452 CCTTGATGACAATGGCACTTCGG 0: 1
1: 0
2: 2
3: 100
4: 977
Right 1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 235
1163641596_1163641603 20 Left 1163641596 19:18465411-18465433 CCCAGGTAGCGGCCTCCAGCCTT 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 235
1163641599_1163641603 8 Left 1163641599 19:18465423-18465445 CCTCCAGCCTTGATGACAATGGC 0: 1
1: 0
2: 0
3: 34
4: 395
Right 1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163641603 Original CRISPR TCCGCGTCTCCTCCTCCGCC TGG Exonic
900103368 1:972107-972129 TCTGCTTCTCCTTCTCCTCCAGG - Exonic
900514685 1:3075941-3075963 TGCGTGACTCCTCCTCCCCCAGG - Intronic
901007931 1:6180555-6180577 TCCTCGCCTCCCCCTGCGCCCGG - Intergenic
901181007 1:7341887-7341909 TCCTCGCCTCCTCCCCCACCAGG + Intronic
902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG + Intergenic
902671161 1:17974923-17974945 TCCTCGCCTCCTCCTCAGCATGG + Intergenic
902732136 1:18376644-18376666 TCCCAGACTCCTCCTCCTCCTGG + Intronic
902770485 1:18642927-18642949 ACCCCGTCTCTTCCTCCTCCAGG - Intronic
904133969 1:28296803-28296825 TCCATGCCTCCTCCCCCGCCAGG + Intergenic
904236954 1:29122505-29122527 GCCGCCTCTCCTCCTCTGCCTGG - Intronic
904674436 1:32190075-32190097 TGCGCTTCTCCTCCTCCTCCCGG - Exonic
908372884 1:63501444-63501466 TCCTCCTCTCCCCCTCCCCCTGG - Intronic
913287635 1:117241299-117241321 TACGCATCTCATTCTCCGCCTGG + Intergenic
913958790 1:143323869-143323891 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
914053107 1:144149249-144149271 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
914126090 1:144817292-144817314 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
915302972 1:154961990-154962012 TCCGCGGCGGCTCCACCGCCCGG - Intronic
916019193 1:160777775-160777797 TCCCCGTCTCCTCTTGCCCCAGG + Intergenic
916587924 1:166165050-166165072 GCCGCGGCTCCTCAACCGCCAGG - Intronic
916716476 1:167451060-167451082 TCCACCTCTGCTCCTCTGCCCGG - Intronic
918051461 1:180976508-180976530 TCAGCTTCTCCTCCTCCCCTCGG + Exonic
919639675 1:200036060-200036082 GACGCATCTCATCCTCCGCCGGG - Intronic
919926324 1:202193727-202193749 TCCTTGACTCCTCCTCCGGCTGG + Intergenic
922602804 1:226870296-226870318 TCCACATCCCCTCCTCCTCCCGG - Intronic
1063429559 10:5977246-5977268 GCCGCGTCCCCTCCCCGGCCTGG + Intronic
1065133069 10:22642062-22642084 TCCGCATCTCTGCCTCCTCCAGG - Intronic
1065520623 10:26567405-26567427 TCCCCGCCTCCTGCTCCGCCGGG - Exonic
1066758898 10:38736750-38736772 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1073076662 10:100828741-100828763 TCCCAGCCTCCTCCTCCGGCAGG + Exonic
1075465061 10:122644981-122645003 TCTTCCTCTCCTCCTCTGCCAGG + Intergenic
1075536305 10:123275011-123275033 TCCCCGCCGCCCCCTCCGCCGGG - Intergenic
1075600923 10:123768579-123768601 TCCGCGTCTCCTCCACCAGGTGG + Exonic
1076127102 10:127983870-127983892 TCCGGGGCTCCTCCACCTCCCGG + Intronic
1076458748 10:130623767-130623789 AGAGCGTCTCCTCCTCCTCCTGG + Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077221499 11:1419985-1420007 TCCGCGCCTCCTCCCACACCCGG + Intronic
1081857366 11:46312354-46312376 TCCGCTTCTCCTCCTCTGTCAGG - Exonic
1082802743 11:57426599-57426621 TCCGCTTCTCCACCTGCTCCCGG - Exonic
1083174314 11:60939638-60939660 TCCCCCTCTGCTCCTCCACCAGG - Exonic
1083202606 11:61129613-61129635 TCCGCCTCTCCTTCCCCGCAAGG - Intergenic
1083441214 11:62677955-62677977 TCCGCCTCTCCTCAGCAGCCCGG + Exonic
1083636236 11:64122493-64122515 ACCGGGTCTCCTCCTTCCCCTGG + Intronic
1084150322 11:67285101-67285123 TCTGCGTCTCCTCCACCGACTGG - Exonic
1084516328 11:69639597-69639619 CCCGCGCCCCCTCCCCCGCCGGG - Intergenic
1084680025 11:70661730-70661752 ACCGCGGCCGCTCCTCCGCCGGG + Exonic
1085011013 11:73141925-73141947 TCCGGCCCTCCTCCTCCTCCTGG - Exonic
1085561076 11:77473575-77473597 TCGGCTCCTCCTCCTCCTCCCGG + Exonic
1085666140 11:78417416-78417438 GCTGCGGCTCCTGCTCCGCCAGG - Intronic
1088604138 11:111512581-111512603 TCCCCTTCGCCTCCTCGGCCCGG - Intergenic
1089498419 11:118919217-118919239 TCTGCCTCTCCTCCTCCCCGTGG - Intronic
1089556333 11:119317497-119317519 TCCGCTACTGCTCCTCCCCCAGG - Intronic
1096154203 12:49332858-49332880 GCCGGGTCTCCTCCTCTTCCCGG + Exonic
1097081321 12:56433305-56433327 TCAGCATCTCCTCCTCTGCCCGG + Intronic
1100469056 12:94873828-94873850 TCCGCGCCTCCGCCGCAGCCCGG - Intergenic
1101146770 12:101848075-101848097 TCCGCTTCAACCCCTCCGCCGGG - Intergenic
1102278342 12:111599339-111599361 TCCGCCGCCCCTCCCCCGCCCGG - Exonic
1103706063 12:122873376-122873398 TGCCCTTCTCCTCATCCGCCAGG - Intronic
1103971878 12:124677649-124677671 TCCAGGTCTCCTCTTCCGCTAGG - Intergenic
1104041356 12:125133446-125133468 TCCCCGTCTCCTCATCCCCTGGG + Intronic
1104668167 12:130662282-130662304 CTCGCGTCTCCTCCTTGGCCAGG + Intronic
1104811174 12:131621174-131621196 TCCCCGCCGCCTCCTCCTCCAGG - Intergenic
1105004208 12:132710967-132710989 TCCGCGTCCCCGCCTGCGCGCGG - Exonic
1105809330 13:23980339-23980361 CCCGCGGCTCCTCCGTCGCCCGG - Intronic
1106683445 13:32031588-32031610 TCGGCCGCTCCTCCTCCTCCGGG - Exonic
1107018265 13:35726155-35726177 TCCCCTTCTCCTCCTTCCCCAGG - Intergenic
1112374472 13:98825873-98825895 TCCCCGGCTCCTCCTCAGGCAGG + Exonic
1119668124 14:76499135-76499157 TCCTCCTCTTCTCCTCCCCCCGG + Intronic
1119743315 14:77027834-77027856 TCCGCGGCGCCTTCTCCTCCGGG + Exonic
1119789857 14:77340511-77340533 CCTCCGTCTCCTCCTCCGCCTGG + Exonic
1122081702 14:99271333-99271355 GCCGCACCTCCTCCTCTGCCCGG + Intronic
1122144957 14:99683742-99683764 CCCGGGGCGCCTCCTCCGCCCGG - Intergenic
1122400009 14:101461443-101461465 TCTGCTTCTCCTCCTCCCCTGGG - Intergenic
1122736759 14:103847763-103847785 TCCGCCCCTCCCCCGCCGCCGGG - Intergenic
1122975483 14:105169043-105169065 GCTGCCTCCCCTCCTCCGCCTGG + Intergenic
1123422678 15:20144902-20144924 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1123442328 15:20301447-20301469 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1123531904 15:21151442-21151464 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1124130934 15:26985158-26985180 TCCCAGCCTCCTCCTCTGCCAGG + Intronic
1125609586 15:40961296-40961318 CCTGCCTCTCCTCCTTCGCCTGG + Intergenic
1128451167 15:67806708-67806730 TCCGCCTCTCCTCCAGCGCCCGG - Exonic
1128735112 15:70049193-70049215 TCCCTCTCTCCTCCTCAGCCTGG - Exonic
1129440815 15:75579503-75579525 TCCCGGTCCCCTCCCCCGCCCGG - Intergenic
1129695955 15:77740838-77740860 TCAGCTTCTCCTTCTCCTCCTGG - Intronic
1129801049 15:78414663-78414685 TCCTGGTCTTCTCCTCCTCCAGG + Intergenic
1130179906 15:81615143-81615165 TCACTGTCTCCTCCTCCACCAGG + Intergenic
1131177765 15:90220686-90220708 TAAGCCTCACCTCCTCCGCCAGG + Intronic
1131701005 15:94935277-94935299 TCCTCATCTCCACCTCAGCCTGG + Intergenic
1132111627 15:99105862-99105884 GCCGCGTCTCTTCCTCCGCCTGG - Exonic
1132658383 16:1050827-1050849 TACGCGTCGCCGCCTCGGCCCGG + Intergenic
1132698404 16:1212071-1212093 GCCGCGCCTCCTCCGCCTCCTGG - Exonic
1134626457 16:15726098-15726120 TTCGTGGCTCCTCCTCCCCCAGG + Exonic
1136718889 16:32304103-32304125 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1136723910 16:32342459-32342481 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1136773027 16:32857855-32857877 TGGGTGTCTCCTCCTCCTCCTGG - Intergenic
1136837262 16:33510367-33510389 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1136842238 16:33548503-33548525 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1136862068 16:33710439-33710461 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1136897588 16:34003664-34003686 TGGGTGTCTCCTCCTCCTCCTGG + Intergenic
1137847453 16:51704741-51704763 TCCGTCTCTCCTGCTCCACCAGG + Intergenic
1139216346 16:65127431-65127453 TGCATGTCTCATCCTCCGCCTGG + Intergenic
1141566117 16:84903210-84903232 TCCGGGTCTCCTCTCCAGCCTGG + Intronic
1141941276 16:87277821-87277843 ACCGCCTGTCCTCCTCCTCCAGG + Intronic
1142228776 16:88889707-88889729 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228788 16:88889755-88889777 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228807 16:88889834-88889856 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228827 16:88889913-88889935 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228856 16:88890024-88890046 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228869 16:88890073-88890095 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1203002521 16_KI270728v1_random:175306-175328 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1203007542 16_KI270728v1_random:213668-213690 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1203075452 16_KI270728v1_random:1119965-1119987 TGGGTGTCTCCTCCTCCTCCTGG - Intergenic
1203123562 16_KI270728v1_random:1558622-1558644 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1203134126 16_KI270728v1_random:1711712-1711734 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1203147438 16_KI270728v1_random:1810646-1810668 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1203152403 16_KI270728v1_random:1848800-1848822 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1142596321 17:1031666-1031688 TCCCCGACTCCTCCAGCGCCAGG + Intronic
1143091198 17:4450021-4450043 TCCTTCTCTCCTCCTCCTCCTGG + Intronic
1145211628 17:21017551-21017573 TGCGAGTCTCCTCCACCGCCAGG - Intronic
1145248467 17:21284800-21284822 GCCGCCGCTGCTCCTCCGCCTGG + Exonic
1145264837 17:21374738-21374760 TCCTGGTTTCCTCCTCCTCCTGG - Intergenic
1145765488 17:27456194-27456216 TCCGCGCCAGCTCCTCCCCCAGG - Intergenic
1145886389 17:28385012-28385034 TCAGCGTCTTCTCCTCCGTGGGG + Intronic
1146061072 17:29607720-29607742 TCCACTCCTCCTCCTCCTCCAGG + Exonic
1146371023 17:32265808-32265830 CCCGAGTCTCCTCCTCCCCGCGG - Intergenic
1146594482 17:34157109-34157131 CCCTCCTCTCCTCCTCCTCCAGG + Intronic
1146718108 17:35103324-35103346 TCTGCTTCTCCTCCTCCTGCAGG - Exonic
1147139553 17:38453698-38453720 TCCGCGCCTCCTGCGCCTCCCGG - Intronic
1147891970 17:43723668-43723690 TCAGGGTCTCCTCCTTCACCAGG - Intergenic
1152627611 17:81395125-81395147 TCTACGCCTCCCCCTCCGCCGGG + Intergenic
1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG + Intergenic
1156392046 18:36659895-36659917 TCTGTGTCTCCTTCTCTGCCTGG + Intronic
1157246364 18:46058429-46058451 TCAGCGCCACCTCCTCCTCCCGG + Intronic
1158976573 18:62715952-62715974 CCCGCGCCGCCTCCTGCGCCCGG - Exonic
1160722946 19:605238-605260 CCTGCGTCTCCCCCTCCGTCAGG - Intronic
1160768954 19:821864-821886 ACCCAGTCTCCTCCGCCGCCCGG - Intronic
1161380974 19:3964720-3964742 TCAGCGACTCCTTCTCCGCCAGG + Exonic
1161434463 19:4254423-4254445 CCCTCTTCTCCTCCTCCTCCAGG - Exonic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1161735582 19:5990460-5990482 TCCCCAGCTCCTCCTCGGCCGGG - Intergenic
1162464449 19:10831667-10831689 TCCTCTCCTCCTCCTCCTCCTGG + Exonic
1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG + Exonic
1163674264 19:18647524-18647546 TCCTCCTCTCTTCCTCCTCCAGG - Intronic
1163807078 19:19405923-19405945 TCCCCGGCCCCTCCGCCGCCCGG + Intronic
1165329719 19:35134740-35134762 ACTACGTCTCCTCCTCCACCAGG + Exonic
1166706043 19:44908599-44908621 CCCGCGTCTCCTCCGCCACCGGG - Exonic
1167042091 19:47028325-47028347 TCCCTGCCTCCACCTCCGCCTGG - Intronic
1202692502 1_KI270712v1_random:101672-101694 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
926193518 2:10745769-10745791 TCCTCCTTTCCTCCTCCCCCAGG + Intronic
928025357 2:27735286-27735308 GCCAAGTCTCCTCCTCTGCCTGG - Intergenic
928158045 2:28894611-28894633 TCCGCCTCACTTCCTCCTCCAGG + Intergenic
929608471 2:43251916-43251938 TCCGTGTTTCTTCCTCCTCCCGG + Intronic
930482080 2:51961099-51961121 TCCACGTTTCCTCCTCTTCCTGG - Intergenic
931067075 2:58599124-58599146 TCTGTGTCACCTCCTCCTCCAGG + Intergenic
931442393 2:62299446-62299468 TCCCCTCCTCCTCCTCCTCCTGG - Intergenic
931774646 2:65530109-65530131 TCACCGTGTCCTCCTCCTCCCGG - Intergenic
934059957 2:88284276-88284298 TCGGCCCCTCCGCCTCCGCCTGG + Intergenic
934322225 2:91981090-91981112 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
934460513 2:94211881-94211903 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
938414530 2:131093341-131093363 CCCGCGTCTCCGCCGCCTCCCGG + Exonic
942277256 2:174332467-174332489 TCCTCTTCTCCTCCTCCCCTCGG - Intergenic
943646145 2:190408906-190408928 TGCCCGGGTCCTCCTCCGCCCGG + Intronic
944271169 2:197786180-197786202 TCCGCTTCTCCCCACCCGCCAGG - Exonic
944711182 2:202336355-202336377 TGCCCGTCTCTTCCTCCTCCTGG + Intergenic
1168960866 20:1868804-1868826 TCCTCCTCTCCTCCCCCGACCGG + Intergenic
1170921544 20:20684190-20684212 TCCACATTTCCTCCTCCCCCCGG + Intronic
1171227152 20:23451380-23451402 TCCTCACCTCCTCCTCCCCCTGG + Intronic
1172239251 20:33401355-33401377 TCCGCGGCCCCTCCTGCCCCAGG + Intronic
1172507952 20:35477945-35477967 TCCTCTTCTCTGCCTCCGCCAGG - Exonic
1172760527 20:37318147-37318169 TCTGCGTCTCCCACTCAGCCAGG - Intergenic
1174766099 20:53255408-53255430 TCAGCTTCTCCTCCTCCTTCAGG - Exonic
1175036277 20:56004216-56004238 CCCGCGTCGCCTCCTACCCCGGG + Exonic
1177510735 21:22084281-22084303 TCTTTGTCTCCTCCTCCTCCCGG + Intergenic
1179643844 21:42763488-42763510 TCCTTGTCTCCTCCTGCTCCTGG - Intronic
1181045256 22:20211256-20211278 TGAGGGTCTCCTCCTCAGCCAGG - Intergenic
1183323045 22:37176698-37176720 TCCCCGCCTCCTCCTCCACTTGG - Intergenic
1183366864 22:37411449-37411471 TCCGCTTCCCCTCCTCACCCAGG - Intronic
1184470259 22:44692152-44692174 CACCCGTCTCCTCCTCCTCCCGG + Intronic
1184593986 22:45503241-45503263 TCCTCATCTCCTCCCCGGCCTGG + Intronic
1184826094 22:46952296-46952318 GCCGCTTGTCCTCCTCTGCCTGG + Intronic
1185190361 22:49432619-49432641 TCAGCCTCTCTTCCCCCGCCGGG - Intronic
953844047 3:46412838-46412860 TCCACTTCTCCTCCTCCGATAGG + Intronic
955195518 3:56801890-56801912 TCCGTGTCGCCGCCGCCGCCCGG - Intronic
961008907 3:123423314-123423336 TCCGCTTCCCCTTCTCCGCAGGG - Intronic
961443763 3:126968464-126968486 CCCCCTTCTCCTCCTCCGCAGGG - Intergenic
967142365 3:186571403-186571425 TCCGCTTCTCCACCTCAGCGGGG - Intronic
967648160 3:191952328-191952350 TCCGGGTCTCCTCCCCAGCCAGG + Intergenic
968093927 3:195914856-195914878 TCCGTCTCTTCACCTCCGCCAGG - Intergenic
968286222 3:197510338-197510360 TCCGCGTTTCCGCCTCTCCCTGG - Exonic
968541801 4:1171814-1171836 TCCTCGCCTCCTGCTCCACCAGG - Intronic
969370158 4:6726930-6726952 TCCTTCTCTCCTCCTCCCCCAGG - Intergenic
976268891 4:83210994-83211016 TCCCCCTTTCCTCCTCCCCCAGG + Intergenic
978126980 4:105146656-105146678 GCCGGCTCTCCTCCTCCGCCCGG - Exonic
983357375 4:166681057-166681079 TCCACGCCTCTTCCTCTGCCTGG + Intergenic
984811092 4:183797349-183797371 CCCGCGTCTCCGCCCCCGCGGGG + Intergenic
986330695 5:6714191-6714213 GCCGCGTCGCCCCCGCCGCCCGG + Intergenic
990007742 5:50963559-50963581 GCCTCCGCTCCTCCTCCGCCCGG + Intergenic
994425122 5:99575874-99575896 TCCTCATCTCCACCTCAGCCTGG - Intergenic
994436216 5:99736371-99736393 TCCTCATCTCCACCTCAGCCTGG + Intergenic
997926176 5:138032974-138032996 TCTGCGTCGCCACCACCGCCGGG - Exonic
999979944 5:156948418-156948440 TCTGTGTCTTCTCCTCAGCCTGG - Exonic
1001091913 5:168748061-168748083 TCAGAGACTCCTCCTCTGCCAGG + Intronic
1001470207 5:172006552-172006574 CCGCCGTCGCCTCCTCCGCCCGG - Exonic
1002434835 5:179224897-179224919 TCCCTGTATCCTCCTCCGTCTGG + Intronic
1004910394 6:20277426-20277448 CCCGCCTCTCCTCCTCAGTCAGG + Intergenic
1007747362 6:44051386-44051408 TCACCGTCTCCTCCTACCCCAGG - Intergenic
1009625485 6:66135204-66135226 TCCCCTTCTCCACCTCTGCCAGG - Intergenic
1012824908 6:104135271-104135293 TGTGCGTGTCCTCCTCCCCCAGG + Intergenic
1019366910 7:638028-638050 CCCGCGTCTTCTCCGCCGGCGGG - Intronic
1019421743 7:954122-954144 GCCGCCTCCCCTCCCCCGCCGGG - Intronic
1019470674 7:1218909-1218931 CCTGCTTCTCCTCCTCTGCCCGG - Intergenic
1019524863 7:1476368-1476390 TCCGCGTCTCCGCCTCGGCCAGG + Exonic
1019527651 7:1487911-1487933 TCCGGGTCTCCTCATCCGTCAGG + Exonic
1019554820 7:1624003-1624025 CCGGCGTCTTCTCCTCCACCCGG + Intergenic
1019700998 7:2475034-2475056 TCCGGGGACCCTCCTCCGCCTGG - Intronic
1021162992 7:17298917-17298939 GCCCAGGCTCCTCCTCCGCCCGG + Exonic
1023937115 7:44748409-44748431 TCTTCCTTTCCTCCTCCGCCGGG + Intergenic
1026681146 7:72467458-72467480 TCTCCGGCTCCTCCTCCACCTGG - Intergenic
1028078068 7:86539115-86539137 CCCTCCTCTCCTCCTCCCCCAGG - Intergenic
1029690420 7:102177653-102177675 TCCCCACCTCCTCCTCCTCCAGG + Intronic
1030209315 7:106980837-106980859 TCAGCCTCTCCTGCTCCACCTGG + Intergenic
1032074672 7:128830718-128830740 TCCACGGCGCGTCCTCCGCCAGG - Exonic
1032448293 7:132003509-132003531 TCCAAGTCTCTTCCTCTGCCTGG - Intergenic
1033031675 7:137832998-137833020 TCCTTGTCTCCACCTCAGCCTGG + Intronic
1033039588 7:137905800-137905822 TCCTCTTCTCCTCCTCTGTCAGG + Exonic
1034417976 7:150975141-150975163 GGCGCGCCCCCTCCTCCGCCTGG + Intronic
1034589738 7:152129070-152129092 TCCGCAGCTCCCCCGCCGCCAGG - Intergenic
1035388597 7:158490370-158490392 CCCGCGTCTCCTCCAGGGCCTGG - Intronic
1037160896 8:15770732-15770754 TCCTTGTCTCCTCCTCAGACTGG - Intergenic
1037856036 8:22371072-22371094 TCTGCGTCTCTGCCTCTGCCAGG - Intronic
1038267741 8:26049394-26049416 TCCTCTGCTCCTCCTCCCCCTGG + Intergenic
1045506406 8:102781841-102781863 TCCCCCTCTCCTCTTCTGCCAGG + Intergenic
1049788383 8:144462192-144462214 TCCGCGTCTCCTCGGAGGCCAGG - Intronic
1053691011 9:40587578-40587600 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1054273794 9:63049913-63049935 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1054302271 9:63388549-63388571 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1054401046 9:64715055-64715077 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1054434652 9:65199369-65199391 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1054495737 9:65822312-65822334 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic
1057076543 9:92141187-92141209 TCCTTGACTCCTCCTCCGGCTGG + Intergenic
1057949653 9:99359581-99359603 TCCGTGGCTCCTCCTCCCACCGG - Intergenic
1060653751 9:125353312-125353334 TCCTCATCTCCACCTCAGCCTGG + Intronic
1061490094 9:130939706-130939728 CCCCCGCCTTCTCCTCCGCCGGG + Intergenic
1061584668 9:131558085-131558107 TCCGCGAGGCCTCCTCAGCCTGG - Intergenic
1062048220 9:134434121-134434143 TCAGCGCCTCCACCTCGGCCGGG - Exonic
1062190793 9:135246894-135246916 TCCCCTCCTCCTCCTCCTCCCGG - Intergenic
1062569923 9:137180327-137180349 GCCGCTTCTCATCCTCCTCCCGG + Exonic
1062620326 9:137417639-137417661 CGCGCGCCTCCTCCTCCGCTCGG - Intronic
1186466315 X:9786581-9786603 CCCGCGTCTCGGCCTCGGCCAGG - Exonic
1187281419 X:17860898-17860920 CCCGCGTCCCCGCCCCCGCCCGG + Intronic
1195197790 X:102516525-102516547 TTCGCGTCTGCACCGCCGCCCGG - Intronic
1200216653 X:154371122-154371144 TCCACGGCGCGTCCTCCGCCAGG + Exonic
1201189715 Y:11436275-11436297 TAGGTGTCTCCTCCTCCTCCTGG - Intergenic
1202583930 Y:26405694-26405716 TAGGTGTCTCCTCCTCCTCCTGG + Intergenic