ID: 1163643031

View in Genome Browser
Species Human (GRCh38)
Location 19:18472637-18472659
Sequence ACGTGTCGGGTGCACGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163643031_1163643039 1 Left 1163643031 19:18472637-18472659 CCTGTGACGTGCACCCGACACGT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1163643039 19:18472661-18472683 CTGGTGTGGCCCCAGCCAAGGGG 0: 1
1: 0
2: 4
3: 18
4: 234
1163643031_1163643046 13 Left 1163643031 19:18472637-18472659 CCTGTGACGTGCACCCGACACGT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1163643046 19:18472673-18472695 CAGCCAAGGGGCTATCCTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 139
1163643031_1163643045 12 Left 1163643031 19:18472637-18472659 CCTGTGACGTGCACCCGACACGT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1163643045 19:18472672-18472694 CCAGCCAAGGGGCTATCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 164
1163643031_1163643036 -1 Left 1163643031 19:18472637-18472659 CCTGTGACGTGCACCCGACACGT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1163643036 19:18472659-18472681 TCCTGGTGTGGCCCCAGCCAAGG 0: 1
1: 0
2: 6
3: 37
4: 336
1163643031_1163643043 11 Left 1163643031 19:18472637-18472659 CCTGTGACGTGCACCCGACACGT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1163643043 19:18472671-18472693 CCCAGCCAAGGGGCTATCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 154
1163643031_1163643038 0 Left 1163643031 19:18472637-18472659 CCTGTGACGTGCACCCGACACGT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1163643038 19:18472660-18472682 CCTGGTGTGGCCCCAGCCAAGGG 0: 1
1: 0
2: 3
3: 31
4: 234
1163643031_1163643041 10 Left 1163643031 19:18472637-18472659 CCTGTGACGTGCACCCGACACGT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1163643041 19:18472670-18472692 CCCCAGCCAAGGGGCTATCCTGG 0: 1
1: 0
2: 0
3: 19
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163643031 Original CRISPR ACGTGTCGGGTGCACGTCAC AGG (reversed) Intronic
901820284 1:11824786-11824808 ACGTGGCGGATGAAAGTCACTGG + Intronic
914997152 1:152553807-152553829 AGGTATCGGGTGCATCTCACTGG - Intronic
919850889 1:201671652-201671674 AAGCGTTGGGTGGACGTCACTGG + Intronic
1063413676 10:5856158-5856180 ACGTGTTGGGTGCACGTGCTGGG + Intergenic
1081669202 11:44933824-44933846 ACGTGTGGGGGGCAGCTCACCGG + Exonic
1092547584 12:9465554-9465576 ACGTGTTGGGTGAAATTCACAGG - Intergenic
1094505399 12:31056808-31056830 ACGTGTTGGGTGAAATTCACAGG + Intergenic
1105426016 13:20295779-20295801 AGGAGTCGGGTGCAGGTCAGTGG + Intergenic
1144639164 17:16928094-16928116 TCGTGGTGGGTGCACTTCACAGG - Intergenic
1163643031 19:18472637-18472659 ACGTGTCGGGTGCACGTCACAGG - Intronic
926954964 2:18284325-18284347 AAGTGTTGGCTGAACGTCACCGG + Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
948636869 2:239343908-239343930 ACGTGTCCAGCTCACGTCACAGG + Intronic
1184410133 22:44321640-44321662 ACTTGTCCGGTGCATGTCATGGG - Intergenic
968440671 4:622794-622816 GCGTCTCAGGTGCATGTCACAGG + Intergenic
978380384 4:108121838-108121860 ACCTGTTGGCTGCACATCACTGG + Intronic
1029810004 7:103037918-103037940 AGGTATCTGGTGCACCTCACTGG + Intronic
1035411388 7:158645467-158645489 AGGTGGCTGGTGCACCTCACAGG - Intronic
1057725263 9:97563915-97563937 ACGTGAGGGCTGCACATCACAGG - Intronic
1062161328 9:135081845-135081867 GCGTGTCGGGTGCACGTGTCGGG - Intronic
1192071190 X:67942625-67942647 AGGTATCGGGTTCACCTCACTGG + Intergenic