ID: 1163643091

View in Genome Browser
Species Human (GRCh38)
Location 19:18472957-18472979
Sequence CCCCAGGTATAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163643085_1163643091 -10 Left 1163643085 19:18472944-18472966 CCAAAGACTCCCTCCCCAGGTAT 0: 1
1: 0
2: 2
3: 20
4: 205
Right 1163643091 19:18472957-18472979 CCCCAGGTATAGAAGGAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 179
1163643084_1163643091 -9 Left 1163643084 19:18472943-18472965 CCCAAAGACTCCCTCCCCAGGTA 0: 1
1: 0
2: 2
3: 27
4: 205
Right 1163643091 19:18472957-18472979 CCCCAGGTATAGAAGGAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163643091 Original CRISPR CCCCAGGTATAGAAGGAGCA GGG Intronic
900678517 1:3903345-3903367 CCCCAGGTCTGGGATGAGCATGG + Intergenic
900928247 1:5719478-5719500 CCCCAGCTCTAGAAGGAGACAGG + Intergenic
902376932 1:16034371-16034393 ACCCAGGCATAGAAGGCTCATGG - Intergenic
903564362 1:24253656-24253678 CCCCAGGTATCTTATGAGCAGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
906623168 1:47301653-47301675 CCCCAGGAAGAGAAGCAGTAGGG + Exonic
910245054 1:85129576-85129598 CCCCAGATTTAGAAGGAAGAAGG + Intronic
911016368 1:93337343-93337365 TCCCAGGTATAGAAGGCCCAGGG + Intergenic
912431938 1:109632652-109632674 CCCCAGGTAAAGAAGGAAAGTGG + Intergenic
913648054 1:120880297-120880319 CCCTAGGACTAGAAGGATCATGG - Intergenic
918062866 1:181077328-181077350 CCGCAGGTGAAGAAGGACCATGG - Intergenic
920945907 1:210528291-210528313 CCCCTGTGGTAGAAGGAGCAGGG + Intronic
922332844 1:224592862-224592884 CTCCAGGTGTGGAAGGAGCCAGG + Intronic
922858801 1:228797894-228797916 CCCCAGGCCAAGGAGGAGCAAGG + Intergenic
923294436 1:232580026-232580048 CCACAGGCAGAGCAGGAGCATGG + Intergenic
924798223 1:247308458-247308480 ACCCAGGTAAAGAAGGGTCAGGG - Exonic
1063959281 10:11293474-11293496 CCCCAGGTCTAGAATGAGCTAGG - Intronic
1065830835 10:29612204-29612226 CCCAGGGAATAGGAGGAGCATGG + Intronic
1070463048 10:76688972-76688994 CCCCTGGTATAGATAGATCAGGG - Intergenic
1070897883 10:80000709-80000731 CCCCAGAAATAGAAATAGCAAGG + Intergenic
1073600518 10:104842020-104842042 CCCCAGCTAGAGAAAGCGCATGG + Intronic
1073704725 10:105970260-105970282 CCCCAGGTGTGGAAGGAGGGAGG - Intergenic
1078008794 11:7553829-7553851 GCCCAGGAATAAAAGGAGCCTGG - Intronic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1079284019 11:19112964-19112986 CCACAGGTATGGAAGAAGCGAGG + Intergenic
1081674134 11:44958538-44958560 CCCAGGGGACAGAAGGAGCACGG - Intergenic
1081815380 11:45936789-45936811 GCCCAGGCTTAGAAGGAGCTGGG + Intronic
1084120893 11:67068366-67068388 CCCCAGGGAGAGGAGGAGGAGGG + Intronic
1085247889 11:75119059-75119081 TAACAGGTATGGAAGGAGCAAGG + Intronic
1088723731 11:112616804-112616826 CCTGAGGAATAGAAGCAGCATGG + Intergenic
1089049916 11:115537078-115537100 GACCAGGTACAGAAGCAGCAAGG - Intergenic
1091812867 12:3414599-3414621 ACCCAGATATTGAGGGAGCAGGG - Intronic
1096323967 12:50641640-50641662 CCACAGGAAGGGAAGGAGCAAGG + Intronic
1097363247 12:58680839-58680861 ACCAAAGTATAGAAGGAGAAGGG - Intronic
1100342962 12:93699008-93699030 CCCCTGGTATAGAGTGAGAAAGG + Intronic
1104530180 12:129562762-129562784 ACCCAGGAATAGCATGAGCAAGG - Intronic
1112191224 13:97179772-97179794 CCCCAAGGAGAAAAGGAGCATGG + Intergenic
1118419095 14:65579814-65579836 CTCCAGGTATAAAAGGATTACGG - Intronic
1121236779 14:92397473-92397495 CCCCTGTTACAGAAGGAGGAAGG + Intronic
1122158356 14:99764698-99764720 GCCCAGGCACAGAAGCAGCAGGG + Intronic
1123475835 15:20592231-20592253 CCCCAGGGAAGGCAGGAGCAAGG - Intergenic
1123642176 15:22408132-22408154 CCCCAGGGAAGGCAGGAGCAAGG + Intergenic
1125187886 15:36953051-36953073 CCCCATGTATAAAAGGGGCATGG - Intronic
1126925274 15:53578417-53578439 CCCCAGGGATACAATGAGAAGGG - Intronic
1127310976 15:57752197-57752219 CCCCAGGTATGATAGGAGCAAGG + Intronic
1128477853 15:68012725-68012747 CCCCAGGTATAGAAAGAGGGAGG + Intergenic
1130147198 15:81283057-81283079 CCCCAGGGCTAGCAGGAGCGGGG + Intronic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1131817155 15:96233730-96233752 ACCCAGGAAGAGAAGGAGCCAGG - Intergenic
1132877476 16:2146836-2146858 CCCCAGGAAGAGAAGGAGGCAGG - Intronic
1132908392 16:2296005-2296027 CCCCAGCTATACAAGCACCAGGG + Intronic
1132977537 16:2718049-2718071 CCTCAGGCTTGGAAGGAGCAAGG - Intronic
1133701472 16:8313326-8313348 ACCCAGGATTGGAAGGAGCAAGG + Intergenic
1134297473 16:12959769-12959791 CCCCAGGAATAGAAGGTTGAAGG - Intronic
1135520087 16:23169817-23169839 CCCCATGCTTAGAAGGAGCTTGG - Intergenic
1141801750 16:86314525-86314547 CCCCAGATAAAGAGGGATCAAGG - Intergenic
1141878349 16:86841753-86841775 CCCCAGGGAAAGAAAGAGGATGG - Intergenic
1141992747 16:87619949-87619971 CACCAGGGACAGAAGGAACAGGG + Intronic
1142122288 16:88392870-88392892 CCACAGATCTACAAGGAGCAAGG - Intergenic
1142199782 16:88755637-88755659 CCCCAGATACTGAAGGAGCCGGG - Intronic
1143917676 17:10305807-10305829 TCCCAGATAAAGAAAGAGCAGGG + Intronic
1144662803 17:17082162-17082184 CTCCAGGTCTAGAAGGAGAGTGG + Intronic
1148243027 17:46012587-46012609 TCCCAGGTAGAGAAGGAGCAGGG - Intronic
1148790885 17:50172015-50172037 CCCCAGGGAGAGAAGCAGAAAGG - Intronic
1151461216 17:74255255-74255277 CCCCATCTATAGAATGAGTATGG + Intronic
1151684348 17:75637956-75637978 CCCCACGTATAGAAGGAAGGAGG + Exonic
1152176848 17:78793467-78793489 GTCCAGATATGGAAGGAGCAGGG + Intronic
1155517393 18:26637266-26637288 CCCGGGGTTCAGAAGGAGCATGG - Intronic
1155829272 18:30492638-30492660 AGCCAGGTATAGAATAAGCAAGG + Intergenic
1156501679 18:37564182-37564204 CGCCAGGCAGGGAAGGAGCACGG - Intronic
1157202628 18:45672006-45672028 CCCCAGAGATAGATGGAGCACGG + Intronic
1159375632 18:67588890-67588912 CCCCAGGTATTTAAGGAGCTAGG - Intergenic
1159873860 18:73788571-73788593 TCTCAGGTATAGAAGGCACATGG + Intergenic
1160511677 18:79456540-79456562 CCCTAGGAAAACAAGGAGCAGGG - Intronic
1160954185 19:1682556-1682578 CCCCAGGGAGTGAAGGAGCCGGG - Intergenic
1161069416 19:2252846-2252868 CCCCAAGGAAAGAAGGAGCCCGG - Intronic
1161291640 19:3496846-3496868 CCCCAGGTTTAGCCTGAGCAGGG - Exonic
1162844535 19:13382169-13382191 CCCCAGGGATAGAGGAGGCAGGG + Intronic
1163643091 19:18472957-18472979 CCCCAGGTATAGAAGGAGCAGGG + Intronic
1165921115 19:39298304-39298326 ACCCAGGAAGAGAAGGACCAGGG + Intronic
1166511270 19:43410482-43410504 CCCCAGGAATACAGGAAGCATGG + Intronic
1167995035 19:53395237-53395259 CCCCAGGTACAGAAGCGCCAGGG - Intronic
1168003531 19:53467833-53467855 CCCCAGGTACAGAAGCGCCAGGG - Intronic
925205547 2:2002908-2002930 CAGAAGGTAAAGAAGGAGCAAGG - Intronic
925581195 2:5413370-5413392 CTCCAGGTATAGAGGGTACAGGG - Intergenic
929032514 2:37662440-37662462 CCCAAGGTCTAAAAGGAGTAAGG - Intronic
930162042 2:48168374-48168396 TCCCTGGTAGAGAAGGAGCCAGG - Intergenic
930977995 2:57488136-57488158 CCCCAAGTATAAAAAGAACAAGG + Intergenic
931786319 2:65622356-65622378 CCCCAGGTTGAGCAGGAGCTCGG + Intergenic
933704517 2:85279777-85279799 CCCCAGGCATGGCTGGAGCAGGG + Intronic
935579320 2:104743089-104743111 TCCCAGGGATAGAGTGAGCATGG + Intergenic
937244788 2:120485656-120485678 CACCAGGAAAAGAATGAGCAGGG - Intergenic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
937542529 2:122976047-122976069 GCCCAGGTGTATATGGAGCAAGG + Intergenic
942145635 2:173023768-173023790 CTCAAGGAAAAGAAGGAGCAAGG + Intronic
943302734 2:186223783-186223805 CCCAAGCTATAGAGGGAACAAGG - Intergenic
943772842 2:191737340-191737362 TCCCAGGTATACAAGATGCATGG - Intergenic
944879784 2:204001132-204001154 TCTCAGGGATAGCAGGAGCAAGG + Intergenic
946156098 2:217807825-217807847 TCCCAGGGTTAGAAGCAGCAGGG - Intronic
948244703 2:236470325-236470347 CCAAAGGTGAAGAAGGAGCAGGG + Intronic
948801175 2:240434351-240434373 CCCCAGGCACAGAAGGGGTAGGG + Intergenic
1168914774 20:1476727-1476749 CCCCATGAATGGCAGGAGCAGGG + Intronic
1169400952 20:5279719-5279741 ACCCAGGTATACAAGGGGAAGGG - Intergenic
1171489763 20:25508641-25508663 CCCCTGTTGTAGAAGGACCAGGG - Intronic
1172894915 20:38293719-38293741 CCCCAGGTAGAGTGGGGGCAGGG + Intronic
1173414485 20:42843657-42843679 CCTCAGGTATACAAAGAACAGGG + Intronic
1173984497 20:47250554-47250576 CCTGAGGTATGGAGGGAGCAGGG - Intronic
1174280811 20:49437767-49437789 CCCAAGGGACAGAAGAAGCAAGG - Intronic
1175170911 20:57080971-57080993 TCCAAGGAATAGAAGGATCATGG + Intergenic
1176423576 21:6534106-6534128 CCCCAGGTGTTGAAGGAGGGAGG + Intergenic
1179699070 21:43142422-43142444 CCCCAGGTGTTGAAGGAGGGAGG + Intergenic
1179788079 21:43741053-43741075 TCCCAGGTACAGGAGGAGCGTGG - Intronic
1181493785 22:23276679-23276701 CCCCAGGAATGGCAGGGGCAGGG - Intronic
1183642560 22:39101336-39101358 TCCCAGGCACAGGAGGAGCAGGG - Exonic
1183818402 22:40323187-40323209 CACCAGGTAGTAAAGGAGCAGGG - Exonic
1183933717 22:41250054-41250076 CCTCAGGTATAAAATGGGCATGG + Intronic
1184895328 22:47403311-47403333 CACCAGGTATGGCAGGAGAATGG + Intergenic
1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG + Intronic
949465897 3:4343328-4343350 CCACAGGGATAAAAAGAGCATGG + Intronic
950354061 3:12388694-12388716 CCCCAGGTAGGGGAAGAGCAGGG - Intronic
952630803 3:35464176-35464198 CCCCATGTATTGAGGGAGGAAGG - Intergenic
953587129 3:44212511-44212533 CCCCAGTTCTACAAGAAGCAAGG - Intergenic
954631009 3:52047576-52047598 CCCCTGGCACAGAAGGAACAGGG + Intergenic
956386404 3:68724663-68724685 CTCCAGGTATGGGAGGAACAAGG - Intergenic
960525163 3:118701489-118701511 CCCCCGGTATGGCTGGAGCAGGG - Intergenic
961253150 3:125523382-125523404 CCCCATGAAGAGAAGCAGCATGG - Intergenic
961655707 3:128440525-128440547 CCCCAGGTACGGAAGGACCAGGG + Intergenic
961751103 3:129095380-129095402 CCCCAGGGAAAGATGGAGGAAGG + Intronic
962338438 3:134559919-134559941 GCCCAGCAATGGAAGGAGCAAGG - Intronic
962635301 3:137325397-137325419 CCCCTGGTTTTGAAGGGGCAGGG - Intergenic
965948861 3:174279106-174279128 CCCCAGATATTGATGGAGCAAGG + Exonic
967075988 3:186002647-186002669 CCCCATGTGTTGAAGGAGGAAGG + Intergenic
968291697 3:197544180-197544202 ACCCAGGTACAGAAGGAGGCTGG - Intronic
968691457 4:1992386-1992408 TCCCAGGTATTGAGGGAGCACGG - Intronic
969366288 4:6696317-6696339 CCCCAGGTGTGGAGCGAGCATGG - Intronic
971372588 4:26030209-26030231 TCCCAGGTACAGAAAAAGCACGG + Intergenic
971930394 4:33074243-33074265 CCCGAGGTAGAAATGGAGCATGG + Intergenic
977129685 4:93219894-93219916 CCACTGGTTCAGAAGGAGCAGGG + Intronic
979940911 4:126761813-126761835 AACAAGGTATAGAAGGAGCTCGG - Intergenic
985928129 5:3033847-3033869 CCCCAGGTGTAGAAAGATAATGG - Intergenic
985948697 5:3206321-3206343 CCCTGGGGATGGAAGGAGCAGGG - Intergenic
987257242 5:16168655-16168677 CCCCATGGAAAGAAGGAGAAGGG - Intronic
987749097 5:22016867-22016889 CCCCAGTTATTGAAGGAAAATGG - Intronic
988413266 5:30913737-30913759 CCCCAATTATAGAAGGAGAGAGG + Intergenic
989793629 5:45438900-45438922 CCCTAGCTATAGAAAGAGTATGG + Intronic
993847045 5:92957098-92957120 CCCCAGGCACAGAGGAAGCAGGG - Intergenic
995646721 5:114321010-114321032 CCACAGGGACAGCAGGAGCATGG - Intergenic
998359706 5:141574079-141574101 CACCAGGTAAAGGAGGGGCAGGG + Exonic
1001483703 5:172105254-172105276 CCACAGGAAGGGAAGGAGCAAGG - Intronic
1003430776 6:6035503-6035525 TTCCAGGGATAGAAGGATCAGGG + Intergenic
1005146194 6:22692815-22692837 CCACAGGTATGGAAGGATAAGGG - Intergenic
1006627306 6:35406438-35406460 CCTCAGCTGTAGATGGAGCAAGG + Intronic
1007787722 6:44290830-44290852 CCCCAGGAGAAGAAGGAGAAGGG - Intronic
1011914304 6:92483940-92483962 AACTAGGTATAGAAGGAACATGG - Intergenic
1016583218 6:145653198-145653220 CCCCACGTATTGATGGAGGAAGG + Intronic
1018366263 6:163123060-163123082 TCCCCGGTACAGAAGGAGCTGGG + Intronic
1018512487 6:164540452-164540474 CCCCTGCTCTAGAGGGAGCATGG - Intergenic
1019538280 7:1539935-1539957 CCCCAGGTCAAGAAGGAGGCGGG + Exonic
1019541723 7:1554669-1554691 CCCCAGGTAGAGAAGCGGCCAGG - Intronic
1022170623 7:27825665-27825687 CTCCAGGTATTTAACGAGCAGGG + Intronic
1022645737 7:32227244-32227266 GCCCAGCTGGAGAAGGAGCAGGG + Intronic
1023197526 7:37657521-37657543 CACTAGGTATACAAGGATCATGG - Intergenic
1024006159 7:45226036-45226058 CCTCAGGCAAGGAAGGAGCAGGG - Intergenic
1029679701 7:102099821-102099843 CACCAGTGATAGAAGGAGAAGGG - Intronic
1034259611 7:149746569-149746591 CCCCAGGTATTTAAATAGCAGGG - Intergenic
1034393701 7:150804279-150804301 TCCCAGGTCAATAAGGAGCATGG + Intronic
1034909797 7:154986359-154986381 CACCAGGTACAGAAGCAGGAGGG - Intronic
1037584981 8:20270016-20270038 CCTCAGGCATAGATGGAGTAAGG - Intronic
1037768450 8:21785709-21785731 ACCCAGGGAGAGAAGGAGAAGGG - Intronic
1037780976 8:21868896-21868918 CCCCAGGAATAGAAGGAGGGAGG + Intergenic
1037973619 8:23192612-23192634 CCACAGGGATAGAAGGGGCCAGG + Intronic
1038459222 8:27702484-27702506 CCCCAGGGAGAAAAGGAGCCAGG - Intergenic
1040599593 8:48870535-48870557 CCCCAGGTAAATAAAGAGCTCGG + Intergenic
1048114378 8:131505287-131505309 CCTCAGGTATAGAAAGATCATGG + Intergenic
1049852673 8:144841609-144841631 CCCCAGGGATGTAAGGAGCTGGG + Exonic
1051950258 9:22622276-22622298 CACCATGTGTAGAAGAAGCAAGG + Intergenic
1052823550 9:33158909-33158931 CCCCAGGAAGAGAATGAACAGGG - Intronic
1053291658 9:36883344-36883366 ACCCAGGGAAAGAAGGAGGAAGG + Intronic
1054162230 9:61681779-61681801 CCCCAGGTTCACAAGGAACATGG + Intergenic
1059414599 9:114155344-114155366 CCCCATCTATACAAGGAGGAGGG + Intergenic
1060056344 9:120417203-120417225 CGCCAGGAATTTAAGGAGCACGG - Intronic
1060177227 9:121505914-121505936 CCCCATGCTTAGAAGGATCACGG + Intergenic
1061986246 9:134131897-134131919 TCCCTGGTACAGAAAGAGCAGGG - Intergenic
1062723486 9:138057926-138057948 GCCCAGGGATAGAGGGAGGAAGG - Intronic
1186659446 X:11654183-11654205 GCCCAGATATAGATGGAGTAGGG - Intronic
1189100971 X:38189310-38189332 TGCCAGGTGTAGAAGGAGGAGGG - Intronic
1189429868 X:40936882-40936904 TCCCAGTTATAGATGGTGCAGGG + Intergenic
1192751284 X:73994683-73994705 ACCAAGGTAAAGAATGAGCAAGG - Intergenic
1193503197 X:82305977-82305999 CCCTAGGAAAAGATGGAGCAGGG - Intergenic
1193647652 X:84088877-84088899 TCCCAGTTATAGAAGCAGTATGG + Intronic
1197557681 X:127976120-127976142 CCCCAGCTATGTAAGGAGAAAGG - Intergenic
1197916826 X:131544543-131544565 CCTCAGGGATAGGATGAGCATGG - Exonic
1199852672 X:151736716-151736738 TTCCTGGTACAGAAGGAGCAGGG + Intergenic
1201634057 Y:16102490-16102512 ACCAAGATATATAAGGAGCATGG - Intergenic