ID: 1163644125

View in Genome Browser
Species Human (GRCh38)
Location 19:18478721-18478743
Sequence TCTGAAGTCCAGTTGGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163644125_1163644132 11 Left 1163644125 19:18478721-18478743 CCCAGACCCAACTGGACTTCAGA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1163644132 19:18478755-18478777 AGAACAGACCTCAACACAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 150
1163644125_1163644133 12 Left 1163644125 19:18478721-18478743 CCCAGACCCAACTGGACTTCAGA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1163644133 19:18478756-18478778 GAACAGACCTCAACACAGCAGGG 0: 1
1: 0
2: 5
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163644125 Original CRISPR TCTGAAGTCCAGTTGGGTCT GGG (reversed) Intronic
900877736 1:5357430-5357452 TCTGTAGTTCAGGTGGGTCTGGG + Intergenic
901050490 1:6423799-6423821 TCTGGAGTCCCGTGGGGGCTTGG - Intronic
902847903 1:19126706-19126728 TGTGAAATCCAGGTGGGTGTTGG + Intronic
905532334 1:38691137-38691159 TTTGAACTGCAGTTGGCTCTAGG + Intergenic
908248035 1:62243262-62243284 ACTGAAATCCAGGTGGGTTTAGG - Intronic
908368406 1:63452807-63452829 TCTAAAGGCCAGCTGGGTCATGG - Intronic
908488291 1:64617094-64617116 TCTGATGTTCAGTTTGGTTTGGG - Intronic
908580045 1:65505520-65505542 TCTGATTTCCAGTTAGGTTTAGG + Intronic
910997456 1:93122513-93122535 TCAGAAGTTCAGTTGGAGCTGGG - Intronic
913044176 1:115059434-115059456 GCTGAAGCCCAGTTGGGCTTGGG - Intronic
913090490 1:115473567-115473589 TCTGCAGTCCGGTATGGTCTTGG + Intergenic
916616245 1:166444075-166444097 TGTGAAATCCAGTAGGGTCATGG - Intergenic
1062877173 10:952433-952455 TCTGTTATGCAGTTGGGTCTGGG - Intergenic
1064032408 10:11891272-11891294 TCTGTTGTCCAGCTGGGTCTGGG - Intergenic
1067152742 10:43749875-43749897 GGTGAAGTGCAGTAGGGTCTAGG + Intergenic
1067532495 10:47084579-47084601 TCTAAAGCCCAGGTGGGGCTAGG + Intergenic
1068750094 10:60582544-60582566 CCTGAAGTCCCATTGGGCCTTGG - Intronic
1070649649 10:78225698-78225720 GCTGAAGTCGAGTGGGGTTTGGG - Intergenic
1071858061 10:89645364-89645386 TGTGAAAACCAGATGGGTCTGGG + Exonic
1072168104 10:92833206-92833228 TCTGTGGTTCAGTTGGGGCTTGG + Intergenic
1072332301 10:94365607-94365629 TCTGGAGTCCAAATGGGGCTTGG - Intergenic
1079339172 11:19597942-19597964 TCTCAAGGGCAGGTGGGTCTGGG + Intronic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1083062069 11:59884254-59884276 TTTGAAGTTCAGTTGGATCCTGG - Intergenic
1086980201 11:93188285-93188307 GCTGAATTCCAGTTGGCACTGGG - Intronic
1091407131 12:216029-216051 TCTGAATACCAAGTGGGTCTTGG - Intergenic
1091407144 12:216124-216146 TCTGAATACCAAGTGGGTCTTGG - Intergenic
1091407157 12:216219-216241 TCTGAATACCAAGTGGGTCTTGG - Intergenic
1091407170 12:216314-216336 TCTGAACACCAAGTGGGTCTTGG - Intergenic
1091407187 12:216409-216431 TCTGAATACCAAGTGGGTCTTGG - Intergenic
1091407200 12:216504-216526 TCTGAACACCAAGTGGGTCTTGG - Intergenic
1091407216 12:216599-216621 TCTGAATACCAAGTGGGTCTTGG - Intergenic
1092038407 12:5361873-5361895 TCTGAGGTCCTGTTGGGGATAGG + Intergenic
1095088370 12:38082914-38082936 TCTGAAGCACACGTGGGTCTTGG - Intergenic
1095285788 12:40408676-40408698 TCTGTAGTACATTTGGGTCCAGG - Intronic
1096180894 12:49549816-49549838 TCTGAACCGCAGTTAGGTCTGGG + Intronic
1097755400 12:63401799-63401821 TCTGAAGGCCAGCTGAGCCTTGG + Intergenic
1102328042 12:112005948-112005970 TCTGGAGGACAGTTGGGACTTGG - Intronic
1102832966 12:116024165-116024187 TCTGATGCACAGTTGGGACTCGG - Intronic
1106783852 13:33087635-33087657 TCTGAAATCCACTTGGGCCTGGG - Intergenic
1109404674 13:61881204-61881226 TCTGAAGGACAGTTGTGGCTTGG + Intergenic
1112218217 13:97458528-97458550 TCTGAAGTTCAGCAGGGTTTAGG - Intronic
1112683806 13:101799167-101799189 CCTGAAGTCCATTTGGGAATGGG + Intronic
1117449554 14:55837653-55837675 TCTGATGTTCAGTTGGACCTAGG + Intergenic
1118593695 14:67420029-67420051 TCTGAAGGTGAGTTGGCTCTGGG + Intergenic
1118751598 14:68811741-68811763 TCTGAACACCAGTTGAATCTTGG + Intergenic
1118795287 14:69138197-69138219 TCTAAATTCCAGTTGTATCTTGG - Intronic
1119350535 14:73961241-73961263 TCTGAAGCCCACTAAGGTCTCGG + Exonic
1123020382 14:105395267-105395289 TCTGAAGTCCCCCTGGGGCTGGG + Exonic
1123114950 14:105890418-105890440 ACTGAGGTCCAGTGGGGTCCCGG + Intergenic
1124381579 15:29172198-29172220 CCTGAAGTCCAGTTGGTCCCTGG - Intronic
1125719128 15:41836726-41836748 CCTGAAGTCCTGGGGGGTCTGGG + Intronic
1126665377 15:51071388-51071410 TCTGTAGTGCAGTTTGATCTGGG - Intronic
1130648663 15:85749899-85749921 CCTTAAGTCCAGCTGGGCCTTGG + Intergenic
1131407375 15:92176419-92176441 TCTGGAGCCCAGTTGGGGCAGGG - Intergenic
1132638521 16:966077-966099 TCTGAAGGCCAGAAGGGTGTCGG + Intronic
1134019422 16:10911086-10911108 TAGGGAGTCCAGTTGTGTCTGGG + Intronic
1135708063 16:24692167-24692189 TCTGAAATCTAGTTGAGTCGTGG + Intergenic
1138714421 16:59004866-59004888 TATGAAGTTCAGATGGGGCTTGG - Intergenic
1140986579 16:80163568-80163590 TCTGAAGTCCCCTAGGGTATGGG + Intergenic
1142847397 17:2688901-2688923 GCTCAAGTCCACCTGGGTCTTGG + Intergenic
1143073143 17:4315402-4315424 AATGACGTCTAGTTGGGTCTTGG - Intronic
1143220171 17:5255039-5255061 CCTGAAGGCCAGTTGGGTGCAGG - Intergenic
1150467012 17:65402698-65402720 TCTGCAGTCCAGCCGGGACTCGG + Intergenic
1150485885 17:65543481-65543503 TCTGACGTACAGTAGGGACTCGG - Intronic
1151551041 17:74822730-74822752 TCTGAAGCGCAGCTGGGTCTAGG + Intronic
1152010514 17:77710504-77710526 TCTCAGGTACAGTTGAGTCTGGG + Intergenic
1155533228 18:26789251-26789273 TCTGAAATCCAGGTGGATATAGG - Intergenic
1156220504 18:35046397-35046419 TCTGAAGTCCAGTGTGCTGTAGG + Intronic
1158440883 18:57473194-57473216 TCTGATGTGCAGTTGGGTATGGG + Intronic
1158677149 18:59530239-59530261 TCTGGAGTCAAGGTGGGTGTTGG + Intronic
1159854000 18:73562673-73562695 TCTGAAGTCTAGTTGGCTAAAGG - Intergenic
1161106165 19:2445138-2445160 TCTCAGGCCCAGTGGGGTCTGGG - Intronic
1163644125 19:18478721-18478743 TCTGAAGTCCAGTTGGGTCTGGG - Intronic
1165380363 19:35475080-35475102 TCTGAAGTCCAGTAAGGTTTTGG + Intergenic
1165712136 19:38019384-38019406 TCTGGAGTCCAGGTGGGAATAGG + Intronic
1165912485 19:39237785-39237807 TCTGATTTCCAGCTCGGTCTGGG + Intergenic
925656550 2:6156069-6156091 TCTGATGTCTAGCTGGGTCTGGG - Intergenic
926889081 2:17624026-17624048 ACAGAATTCCAGTTGGTTCTTGG - Intronic
929007014 2:37405618-37405640 ACTGATCTCCAATTGGGTCTGGG - Intergenic
931099635 2:58982018-58982040 TCTGGTTTCCAGTTGGGTTTAGG + Intergenic
933239813 2:79907830-79907852 TCTGAAGTCCACTGGAATCTTGG - Intronic
936236417 2:110746405-110746427 TCTGAATTGTAGTTGGATCTTGG - Intronic
936771131 2:115914912-115914934 TCTGAATTTCAGATGGGTGTAGG + Intergenic
938650180 2:133374963-133374985 TTTGAAATCCAGTTGGCTTTGGG - Intronic
941919678 2:170837474-170837496 TCTGAGGTCCTGTAGGGTATGGG + Intronic
946127064 2:217572264-217572286 TCTGAAATCCAGTGGTGGCTGGG - Intronic
947655165 2:231820587-231820609 TAAGAAGTCCAGTTGGGTTGGGG + Intergenic
948096501 2:235338332-235338354 TCAGAAGTTCAGCTGGGTTTGGG - Intergenic
948205376 2:236160361-236160383 TCTGAGGTCCAGGTGGGGGTGGG + Intergenic
948581271 2:238988698-238988720 TCTAAAATCCAGGTGTGTCTGGG - Intergenic
1172792748 20:37517377-37517399 GCTGCAGTCCATTTGGGTCGTGG - Intronic
1173923972 20:46767101-46767123 TCTGAAATCCAGTAGAGTATTGG - Intergenic
1174858611 20:54069509-54069531 ACTGGAGTCCAGTCGGGCCTGGG - Intronic
1176247900 20:64105944-64105966 ACTGATGACCAGTGGGGTCTGGG + Exonic
1176707511 21:10126783-10126805 TCCGAAGTCCACTTAGGGCTTGG + Intergenic
1180875870 22:19175082-19175104 TCTGAACTCCAGGTGGGGGTGGG - Intergenic
1181973260 22:26709862-26709884 TCTGCATCCCAGTGGGGTCTTGG - Intergenic
950203683 3:11061833-11061855 TCTTAAGTCTAGTGGGGACTTGG + Intergenic
951681934 3:25304028-25304050 ACTGAAGTCAAGATGGGTCTAGG - Intronic
954797574 3:53169278-53169300 CCTGAAGTTCAGGAGGGTCTGGG + Intronic
955696726 3:61644460-61644482 TCTGAAGCCCAGTGGGTTTTTGG + Intronic
956301292 3:67775260-67775282 TCTGAAGTCCAGCTGTCTCCCGG + Intergenic
958785060 3:98588994-98589016 TCTGAAGACCAGTAAGGCCTAGG + Intronic
962235403 3:133702302-133702324 TCTGGAGTCCAGTTAGCTCAGGG + Intergenic
962429423 3:135305939-135305961 TATGAAGGCCAGTTGGGTATAGG - Intergenic
963867803 3:150381370-150381392 TCTGAAGACCAGTTTGGGCAAGG - Intergenic
965620653 3:170639487-170639509 TCGGAAGACCAGTTGGTTCTGGG - Intronic
966186083 3:177228558-177228580 TCTTGAGTCCAGTGGGGACTTGG - Intergenic
967100347 3:186210708-186210730 ACTGCAGTCCAGTGGGGCCTGGG - Intronic
967882776 3:194313701-194313723 TCTGATTTCCAGTTGGGCCCTGG + Intergenic
969476015 4:7422797-7422819 TCTGAAGTTCACTTTGGTGTTGG - Intronic
971298810 4:25425024-25425046 TCCCAGGTCCAGCTGGGTCTAGG - Intergenic
972969756 4:44558931-44558953 TCTGATTTCCAGTTGGGTTTGGG + Intergenic
973166726 4:47087203-47087225 TCTGAAGTTCAGGTATGTCTGGG - Intronic
976491532 4:85676462-85676484 TCTGCAGCTCAGTTGGGGCTTGG + Intronic
978500147 4:109400680-109400702 TCTGCAGTCTATGTGGGTCTTGG + Intergenic
979076900 4:116282535-116282557 TCTGGAGGCCAGTTGCCTCTAGG - Intergenic
988623933 5:32851071-32851093 TTTGAAGTCCAGCTGAATCTGGG + Intergenic
990883386 5:60565096-60565118 TGTGAAGTCCTGTTATGTCTGGG - Intergenic
997171117 5:131721985-131722007 TTTGAAGTCCAGTTTGTTTTAGG + Intronic
997414243 5:133712745-133712767 ACTGAAGTCCAGTTGGCTTAAGG + Intergenic
998172563 5:139881121-139881143 TCTGGAGTCCAGGTGGGGCACGG + Intronic
1001783466 5:174391014-174391036 TCTGAAGTGCTGTGGGGTGTAGG - Intergenic
1003527661 6:6911420-6911442 TCTTGACCCCAGTTGGGTCTTGG + Intergenic
1006102321 6:31693211-31693233 TCTGGAGAACAGTGGGGTCTAGG + Intronic
1006479974 6:34284294-34284316 TCTGAAATGCAGATGGGACTAGG + Exonic
1008892657 6:56513148-56513170 TCTGGAGTTCCTTTGGGTCTAGG + Intronic
1011672936 6:89701489-89701511 TCTGAAGTCCTTTTGGAACTTGG - Intronic
1013097766 6:106961438-106961460 TGAGAAGCCCAGTTGGGTGTGGG - Intergenic
1013663801 6:112326119-112326141 TTTGCATTCCACTTGGGTCTTGG + Intergenic
1015490302 6:133817584-133817606 TCTAAATTCCCTTTGGGTCTGGG - Intergenic
1016322039 6:142856882-142856904 ACGGAAGTCCAGGTTGGTCTCGG - Intronic
1016376538 6:143426777-143426799 TCTTATGTCCAGTAGGTTCTTGG - Intronic
1017167390 6:151422406-151422428 TCTGGTATCCAGTGGGGTCTTGG + Intronic
1018773557 6:166993610-166993632 TGTTAATTGCAGTTGGGTCTAGG + Intergenic
1018874829 6:167812559-167812581 TCTGACGTCCATTTTGGTTTCGG + Intergenic
1019004993 6:168789437-168789459 TCAGAAGTCCAGGTGAGTCTGGG - Intergenic
1020153478 7:5702114-5702136 TCTGAAATGCAGGTGGGTGTGGG + Intronic
1022320656 7:29284730-29284752 TCAGAAGTCCAGGTGTGGCTTGG - Intronic
1022579534 7:31536669-31536691 TCTGTAGTCTTGCTGGGTCTTGG + Intronic
1023108989 7:36791451-36791473 TCTAATGGCCAGTTTGGTCTTGG - Intergenic
1024228049 7:47343293-47343315 TCTAAACTCCAGAAGGGTCTAGG - Intronic
1027355813 7:77354014-77354036 TGTGAATTCCAGCTGGGTCCTGG + Intronic
1027396243 7:77757678-77757700 TTGGCAGACCAGTTGGGTCTTGG + Intronic
1030477536 7:110055629-110055651 TCTGAGGTTGATTTGGGTCTAGG - Intergenic
1033314526 7:140286606-140286628 ACTGAAGTCCTGTTGGGTCAGGG - Intergenic
1034861078 7:154595292-154595314 TCTAAAGCACAGTTGGGTTTGGG - Intronic
1037805006 8:22054208-22054230 TCTGCAGTCCCCTTGGGTCCAGG + Intronic
1038524078 8:28258265-28258287 TCTGAAATTCAGATGCGTCTGGG - Intergenic
1038888994 8:31697337-31697359 TCTGTAGTCTAGTTGTGTGTGGG + Intronic
1039575420 8:38619977-38619999 TCTGGCTTCCAGTTGGGTCTGGG + Intergenic
1041816372 8:61976489-61976511 TCTGAAGTCTAGTTGGAGATGGG - Intergenic
1047596440 8:126382325-126382347 TGTGCAGTACAGCTGGGTCTTGG - Intergenic
1053464264 9:38293699-38293721 TCTGAAGTTCAGCTGGGAATTGG - Intergenic
1056223414 9:84471719-84471741 TCTGAAATTCAGTAGGGTATAGG + Intergenic
1056944607 9:90983695-90983717 TCTGAAGTCAAGTTGGCCATAGG + Intergenic
1059245529 9:112846642-112846664 CATGAATTCCACTTGGGTCTTGG + Intronic
1059349919 9:113657115-113657137 TCTGAAGCCCACCTGGGTCCTGG - Intergenic
1061436748 9:130568092-130568114 TCAGAATTCCAGATGGGTCTGGG - Intergenic
1062635215 9:137487028-137487050 GCTGCAGTCGAGTTGGGTCAGGG - Intronic
1202792259 9_KI270719v1_random:95663-95685 TCCGAAGTCCACTTAGGGCTTGG + Intergenic
1185770294 X:2760793-2760815 TCTGCAGTCCTGTTGGATCAGGG - Intronic
1191744154 X:64467434-64467456 TCTGAAGTCTAGTTTAGGCTTGG - Intergenic
1191898295 X:66016272-66016294 TCTGTAGCACAGCTGGGTCTGGG + Intergenic
1193407655 X:81122059-81122081 TTTTAAGACCAGTTGAGTCTGGG + Intronic
1194020897 X:88691121-88691143 TTTGAAGATCAGTTGGGTGTAGG - Intergenic
1196715717 X:118809187-118809209 TCTGAAGCTCAGGTGGGTTTTGG - Intergenic
1196883812 X:120224044-120224066 TCTGCAGCCCAGTAGGGTCGGGG + Intergenic
1198000730 X:132433162-132433184 TCTGAGGTGCAGATGGGTCCTGG + Intronic
1199303261 X:146237493-146237515 TCTGAAGGCTTGTTGGGTCCAGG + Intergenic