ID: 1163644845

View in Genome Browser
Species Human (GRCh38)
Location 19:18483298-18483320
Sequence AACCCTGCACTGCAACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163644845_1163644851 21 Left 1163644845 19:18483298-18483320 CCTGGCAGTTGCAGTGCAGGGTT 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1163644851 19:18483342-18483364 TCTTCCAGAAGGCGCTCAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 93
1163644845_1163644847 -6 Left 1163644845 19:18483298-18483320 CCTGGCAGTTGCAGTGCAGGGTT 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1163644847 19:18483315-18483337 AGGGTTTTTGGACACTATCCAGG 0: 1
1: 0
2: 1
3: 7
4: 71
1163644845_1163644848 10 Left 1163644845 19:18483298-18483320 CCTGGCAGTTGCAGTGCAGGGTT 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1163644848 19:18483331-18483353 ATCCAGGTCCTTCTTCCAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163644845 Original CRISPR AACCCTGCACTGCAACTGCC AGG (reversed) Intronic
900154064 1:1197122-1197144 AGCCCTGCACACCAACTGCGAGG + Exonic
900598359 1:3492714-3492736 CACCCTGCACTGTGACTGCGGGG - Exonic
901459383 1:9382651-9382673 AAGCCTTCACTGCAGCTGCTTGG + Intergenic
902919308 1:19656925-19656947 GATCCTGCACTGTAGCTGCCAGG + Exonic
903140274 1:21335080-21335102 CACCCTCCACTGCCTCTGCCCGG + Intronic
903216972 1:21848711-21848733 CACCCTGGACCTCAACTGCCTGG - Exonic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
906531225 1:46525235-46525257 GACCAGGCAGTGCAACTGCCAGG + Intergenic
906794349 1:48685100-48685122 AGCCCTCCTCAGCAACTGCCAGG + Intronic
911759791 1:101601530-101601552 AACACTGAACCGCAGCTGCCAGG - Intergenic
913373976 1:118131127-118131149 AACCCAGCACTCATACTGCCTGG + Intronic
915623384 1:157099505-157099527 GACCATGCACTGCAGCTGCTTGG - Exonic
915927889 1:160038103-160038125 AACCCTGGAATCCAAATGCCAGG - Exonic
916444213 1:164856951-164856973 ATCCCAGCTCTGCTACTGCCAGG + Intronic
916920904 1:169465794-169465816 AACTCTGCACAGCAACTGCCTGG - Exonic
917337445 1:173940115-173940137 AACCCAGCACTCCATCTCCCTGG - Intronic
1062987857 10:1785948-1785970 AGCCCTGCACTGTCACTGCAGGG + Intergenic
1063331926 10:5168317-5168339 AACCCTCAAATGCAACTCCCAGG + Intergenic
1064956974 10:20922182-20922204 AACTCTGCTCTGCATCAGCCAGG + Intronic
1066383898 10:34925535-34925557 ACCACTGCACTCCAGCTGCCTGG + Intergenic
1067165985 10:43867034-43867056 CCCCCTGCACTGCATCTGGCCGG + Intergenic
1067242828 10:44510610-44510632 CACTCTGCACTGAAGCTGCCTGG + Intergenic
1067360397 10:45573427-45573449 ACACCTGAACTGCAGCTGCCAGG + Intronic
1072011283 10:91304984-91305006 ATGCCTGAACTGCAGCTGCCAGG - Intergenic
1073120991 10:101122513-101122535 GTCCCTGAACTGCAAGTGCCTGG - Intronic
1073636049 10:105200126-105200148 AAGCCAGCACTCCAACTCCCTGG - Intronic
1074870801 10:117574500-117574522 AACCCAACACTGCAACAGTCCGG + Intergenic
1075369321 10:121921604-121921626 AGGCCTGAACTGCAGCTGCCTGG + Intronic
1076993514 11:287870-287892 AACCCCCTCCTGCAACTGCCTGG - Intergenic
1077612178 11:3650150-3650172 ACGCCTGAACTGCAGCTGCCAGG + Intronic
1080227352 11:29975623-29975645 ACACCTGAACTGCAGCTGCCAGG + Intergenic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1084267219 11:68011211-68011233 CCCCCTGCTCTGCCACTGCCTGG - Intronic
1084893625 11:72249976-72249998 AACCTAGTACTGCAACTGGCAGG - Intergenic
1087688982 11:101297671-101297693 AACCCTGCTCACCCACTGCCTGG - Intergenic
1088697568 11:112381467-112381489 AACCCAGCAATCCCACTGCCAGG - Intergenic
1088921840 11:114265050-114265072 AACCCTACCCTGCAACATCCAGG - Intronic
1089060806 11:115624585-115624607 CACCATGCCCTGCAACTCCCAGG + Intergenic
1089360517 11:117883136-117883158 AAGCCTGCAGTCTAACTGCCAGG + Intergenic
1090262230 11:125330054-125330076 ACCCCTGCACTGCTGCTTCCAGG - Intronic
1090404764 11:126469974-126469996 AACCCAGGCCTGCGACTGCCTGG + Intronic
1091069611 11:132550762-132550784 AACTCTACACTCCACCTGCCTGG + Intronic
1091327930 11:134705810-134705832 ACCCCTGCTTTGCAACTGCAAGG - Intergenic
1091677548 12:2502165-2502187 CAGCCTGCACTGTAGCTGCCTGG + Intronic
1092743313 12:11650195-11650217 AACCCTGAGCTGCACCGGCCAGG + Intronic
1092782809 12:12003035-12003057 ACCACTGCACTCCAGCTGCCTGG - Intergenic
1094282635 12:28756325-28756347 ATAACTGCACTGCAACTACCAGG - Intergenic
1094316058 12:29138499-29138521 ATGCCTGAACTGCAGCTGCCGGG - Intergenic
1095638904 12:44464470-44464492 AATCCTGCCCTGCAACTTGCAGG - Intergenic
1095922365 12:47543937-47543959 TACCCTGCACTGCAACGACAAGG - Intergenic
1097454597 12:59782146-59782168 AACTGTGCAGTGCTACTGCCAGG - Exonic
1097692282 12:62744747-62744769 GTCCCTGCACTGCAGCCGCCAGG + Intronic
1100501367 12:95177201-95177223 AAGCCAGCATAGCAACTGCCAGG + Intronic
1102282169 12:111627014-111627036 ATCCCAGCCCTGCTACTGCCTGG - Intergenic
1103633510 12:122283035-122283057 AATCCTGCACTGGCACTGACAGG + Intronic
1103913862 12:124366066-124366088 AACCCAGCACTGCCACTCCTAGG + Intronic
1103961323 12:124610850-124610872 ATCCCGGCACTGCCACTTCCCGG + Intergenic
1104627076 12:130366336-130366358 AGCCCTGCACTTGCACTGCCTGG - Intronic
1108139706 13:47407530-47407552 AACCCTGCACTAGAACTGCTGGG + Intergenic
1109239396 13:59865731-59865753 AACCTTGCACTGTAACTGCAAGG - Intronic
1109484544 13:63001805-63001827 AACCCTGCTCACCAGCTGCCTGG + Intergenic
1112262001 13:97885576-97885598 AAACCTCCACAGCCACTGCCTGG + Intergenic
1112553319 13:100443378-100443400 AGCTCTCCACAGCAACTGCCTGG - Intronic
1112877462 13:104062040-104062062 GACCCTGCACTGCCTCTGCTAGG + Intergenic
1114755449 14:25254435-25254457 GACCCTACACTGTAAATGCCAGG + Intergenic
1115430067 14:33307044-33307066 AAGCCTTCACTGCAATAGCCAGG - Intronic
1115680277 14:35730497-35730519 AACCCTGCTCGCCCACTGCCTGG + Intronic
1116346664 14:43803056-43803078 AACCCTGCTTTCCCACTGCCTGG + Intergenic
1118697853 14:68402381-68402403 AACCATGCTCAGCAAGTGCCAGG + Intronic
1119586260 14:75838764-75838786 CACTCTGCACTGCAAGTGACTGG - Intronic
1121049154 14:90808891-90808913 ATCCCTGCACCCCAGCTGCCCGG - Intronic
1121177201 14:91899440-91899462 AGCCCAGCACTGCCCCTGCCAGG + Intronic
1121684975 14:95829153-95829175 AGCCCTGCACATCACCTGCCCGG + Intergenic
1122266940 14:100551016-100551038 AACCCAGCCCTGCAACAGGCAGG - Intronic
1126506173 15:49406678-49406700 CACCCTGCCCTGCCACTGCTGGG - Intronic
1127089937 15:55457170-55457192 AGCCCTGCTCACCAACTGCCTGG + Intronic
1130022989 15:80246789-80246811 ATCCCTGAACCGCAACTTCCTGG - Intergenic
1130446132 15:84003628-84003650 AACCCTTCACTTTTACTGCCTGG - Intronic
1132870720 16:2114642-2114664 AACCCTGGACTGCGGCTGCCTGG - Exonic
1133032059 16:3015824-3015846 CACCTTGCACTGCATCTGGCCGG + Exonic
1134521811 16:14922262-14922284 AACCCTGGGCTGCGGCTGCCTGG + Intronic
1134709481 16:16320913-16320935 AACCCTGGGCTGCGGCTGCCTGG + Intergenic
1134716694 16:16360942-16360964 AACCCTGGGCTGCGGCTGCCTGG + Intergenic
1134950122 16:18347732-18347754 AACCCTGGGCTGCGGCTGCCTGG - Intergenic
1134958056 16:18391217-18391239 AACCCTGGGCTGCGGCTGCCTGG - Intergenic
1138786028 16:59847647-59847669 AAACATGCACTGCAACTGTGAGG + Intergenic
1139163282 16:64536835-64536857 ACCACTGCACTGGAAATGCCTGG - Intergenic
1141023330 16:80519318-80519340 AACCCTGCCCAGGAACTTCCTGG + Intergenic
1141297662 16:82784785-82784807 CACCCTGCTGTGCATCTGCCTGG - Intronic
1141822334 16:86455169-86455191 CACCCTGCACTGTAATGGCCTGG + Intergenic
1142480401 17:215244-215266 CACCCTGCCCTGCACCTGCTGGG - Intronic
1144634742 17:16897824-16897846 AACCCGCCACTGCAAGTTCCAGG - Intergenic
1145011005 17:19367887-19367909 CACCCTCCACTGCATATGCCGGG - Intronic
1145076739 17:19861587-19861609 AAACCTACTCTGCAATTGCCAGG + Intronic
1145168824 17:20637256-20637278 AACCCGCCACTGCAAGTTCCAGG - Intergenic
1145250314 17:21293676-21293698 AGCCCTGCCCTGCCTCTGCCCGG - Intronic
1146164740 17:30578661-30578683 AACCCGCCACTGCAAGTTCCAGG - Intergenic
1147186130 17:38713907-38713929 CACCCTGCACTGCCCCTCCCGGG - Intronic
1149288135 17:55188693-55188715 ATCTCTGCACTTCAATTGCCAGG - Intergenic
1150161936 17:62905927-62905949 AAGCCTGAGCTGAAACTGCCCGG + Intergenic
1151911771 17:77088289-77088311 AACCCAGCTCTGCCACTTCCTGG + Intronic
1153284874 18:3448468-3448490 GACGCTGCCCTGCAACTGCCGGG - Intronic
1153357620 18:4155145-4155167 AACCCTGCAGTCCCTCTGCCTGG - Intronic
1157718605 18:49906435-49906457 AACCCTGCAGAGGTACTGCCGGG - Exonic
1157921903 18:51721754-51721776 TACCCTGCACTGAAGCTGGCTGG + Intergenic
1159454075 18:68638785-68638807 AGCCCTGCTCTCCCACTGCCTGG - Intergenic
1159906497 18:74097345-74097367 AGCCCTGCACAGCCACTGCCTGG + Intronic
1163417270 19:17194331-17194353 ACCCCTGCCCTGCGTCTGCCTGG - Intronic
1163644845 19:18483298-18483320 AACCCTGCACTGCAACTGCCAGG - Intronic
1165248513 19:34512422-34512444 TCGCCTGCACTGCAGCTGCCTGG - Intergenic
1165722808 19:38091607-38091629 CACCCTGCCCTGCCACTCCCTGG - Intronic
925417465 2:3680660-3680682 ATCTCTGCACTGTTACTGCCCGG + Intronic
926005789 2:9372734-9372756 CACCCTGGACTTCAGCTGCCAGG - Intronic
930364443 2:50421921-50421943 AACCCTTCAGTGGAACTGCATGG + Intronic
931220641 2:60285512-60285534 ATCCCTGGACTTCAACTGCCTGG - Intergenic
932197083 2:69794305-69794327 AAGCCTCCACTGTAACTGCTTGG + Intronic
932667668 2:73709992-73710014 CACCCTCCTCTGCAGCTGCCAGG - Intergenic
934562120 2:95318701-95318723 AACCCTTCCCAGCAAATGCCAGG - Intronic
937521745 2:122720745-122720767 AGCCCTGCTCTCCAACTGCCTGG + Intergenic
938398226 2:130965953-130965975 AACCCTGCCCTGCCATTGCCGGG - Intronic
940508798 2:154586730-154586752 ACGCCTGAACTGCAGCTGCCAGG - Intergenic
940630286 2:156229792-156229814 AGCCCTACACTCCAGCTGCCTGG + Intergenic
941219971 2:162765798-162765820 ACCACTGCACTGCAGCAGCCCGG - Intronic
943865339 2:192920276-192920298 ATGCCTGAACTGCAGCTGCCAGG + Intergenic
948486644 2:238285497-238285519 CAGCCTCCACTGCCACTGCCAGG + Intronic
948561773 2:238858728-238858750 AACCCTGCAATTCCACTGCTAGG + Intronic
948612991 2:239181314-239181336 AAGCCTGCATTGCACCTGCCTGG - Intronic
1169195724 20:3681168-3681190 AGTCCTGCACAGCAAGTGCCTGG - Intronic
1170423108 20:16211930-16211952 AACTCTGCACTGCTAATGGCAGG + Intergenic
1171857661 20:30361945-30361967 AACCCTGCGCTGGCCCTGCCGGG + Intergenic
1171955401 20:31458197-31458219 ATCACTGCACTCCAGCTGCCTGG + Intergenic
1175602440 20:60285966-60285988 TACCTTTGACTGCAACTGCCAGG + Intergenic
1178230317 21:30776227-30776249 AGACCTGCACTTCACCTGCCAGG + Intergenic
1180984782 22:19897953-19897975 ATGACTGCACTGCACCTGCCTGG + Intronic
1182064045 22:27417812-27417834 AGCCCTGAACTGCAACTGATGGG + Intergenic
1184091348 22:42294557-42294579 CACCCTGGACAGCAACAGCCTGG - Intronic
957755298 3:84477363-84477385 AAGCCTGCACTGAAACTAACTGG - Intergenic
959055432 3:101562858-101562880 AACACTGCACTGTAATTGCCTGG - Intronic
960064315 3:113354402-113354424 AGCCCTGCTCAGCAGCTGCCTGG + Intronic
962437964 3:135383812-135383834 AATGCTGCACTGCATCTGCAAGG - Intergenic
963224180 3:142844420-142844442 TACCCAGGACTGCAACTGCTGGG + Intronic
964701042 3:159566849-159566871 AACCCAGCAGTGCCACTTCCTGG - Intronic
968285174 3:197504400-197504422 GATCCTGCTCTGCAACTTCCTGG - Intergenic
968693626 4:2009327-2009349 ACACCTGCACTGCGAATGCCAGG - Exonic
969227263 4:5807191-5807213 AACCCAGCACAGCACCTGGCAGG + Intronic
969445375 4:7241917-7241939 GTCCCTGCACTCCCACTGCCAGG - Intronic
971179046 4:24310543-24310565 TACCCTGAACTACAACTGCATGG + Intergenic
971859611 4:32087437-32087459 AGGCCACCACTGCAACTGCCTGG + Intergenic
975289790 4:72664261-72664283 AATACTGCATGGCAACTGCCTGG + Intergenic
977139333 4:93347802-93347824 TACTCTGGAGTGCAACTGCCTGG - Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978491703 4:109317173-109317195 AAGCTGCCACTGCAACTGCCTGG - Intergenic
978773956 4:112486873-112486895 ACCCCTGCACTCCAGCAGCCTGG + Intergenic
986695689 5:10353217-10353239 AAACGTGCACCACAACTGCCCGG + Intergenic
991045591 5:62219077-62219099 CACCCTGCACTTCATCTGCCTGG - Intergenic
994375795 5:99014805-99014827 ATGCCTGAACTGCAGCTGCCAGG - Intergenic
994612717 5:102065251-102065273 AAACCTGCACTGAAAGTGCGTGG - Intergenic
995483165 5:112612929-112612951 AACCCAGCACTCCAGCTGCAGGG + Intergenic
995606028 5:113855991-113856013 ACACTTGCACTGCAAATGCCTGG + Intergenic
997720626 5:136075823-136075845 AACCCTGCATTGCATCTCCCTGG - Intergenic
1000075203 5:157778169-157778191 AAACCAGCACTGTATCTGCCAGG + Intergenic
1000886058 5:166749056-166749078 AACTCAGCACTGCAATTGCTTGG - Intergenic
1002760878 6:201193-201215 ACCACTGCACTCCATCTGCCTGG - Intergenic
1004753261 6:18585030-18585052 AAACCTGGACTGCAAATGCCAGG + Intergenic
1005898569 6:30198282-30198304 AACCCAGGTCTGCTACTGCCAGG + Intronic
1006297218 6:33175021-33175043 AGCCCTGCTCTGCAGCTGCCTGG - Intronic
1006714421 6:36106413-36106435 GGCCATGCACTGCAACTGACTGG - Intronic
1007080633 6:39100601-39100623 CACACTGCACTGTAACTGTCTGG + Intergenic
1011563907 6:88654080-88654102 AACCCTACACTGTAACTTTCTGG - Intronic
1013221365 6:108080531-108080553 AGCCCTGCTCTCCCACTGCCTGG - Intronic
1013480706 6:110550476-110550498 CAGCCTGGACTGCAGCTGCCAGG + Intergenic
1014612075 6:123558854-123558876 ACGCCTGAACTGCAGCTGCCAGG + Intronic
1016248854 6:142018020-142018042 AAGCCTGAACTGCAGCAGCCAGG + Intergenic
1016485166 6:144529209-144529231 AACCCTGCTCACCAGCTGCCTGG - Intronic
1016496284 6:144666297-144666319 AAGCCTGCACTGCAAAGTCCTGG - Intronic
1017754749 6:157519897-157519919 CGCCCTGCACTGCAACTGCTGGG - Intronic
1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG + Intronic
1017869919 6:158478638-158478660 CACCCCACCCTGCAACTGCCTGG + Intronic
1020702111 7:11497744-11497766 CACCTTGCACTGAAACTTCCAGG + Intronic
1023364666 7:39451811-39451833 AACCCTGCACAGGAATTTCCTGG + Intronic
1023550436 7:41364626-41364648 AACCCTGTGCTGGAACAGCCAGG + Intergenic
1025911530 7:65832548-65832570 ATCCCTGCCCAGCAACTCCCTGG - Intergenic
1026403220 7:70037732-70037754 TACCCTGCTCTGCCACTTCCTGG + Intronic
1026858447 7:73769855-73769877 CACCTTGCACTGCATCTGGCCGG + Exonic
1026867243 7:73831377-73831399 CACCTTGCACTGCATCTGGCCGG - Exonic
1031566621 7:123306125-123306147 AACCCTGCACTGCAAACCCAGGG + Intergenic
1033969545 7:147023039-147023061 AACCCTGTACTGCAAAAGGCAGG - Intronic
1034084842 7:148313548-148313570 ACGCCTGAACTGCAGCTGCCAGG - Intronic
1036220836 8:6920724-6920746 AACCCTCCTCTCCAGCTGCCAGG + Intergenic
1037504133 8:19513985-19514007 AACCCTGCTCTGAAACTTCTGGG - Intronic
1037914339 8:22763499-22763521 AATCTTGCACTGCCACTTCCCGG + Intronic
1038697602 8:29819777-29819799 AACTCGGCACTGTAAATGCCAGG + Intergenic
1039471501 8:37816081-37816103 TCCCCTGGACTGCAATTGCCTGG - Intronic
1041377066 8:57215872-57215894 AGCCCTGCACTGCACCTCTCAGG - Intergenic
1042267360 8:66923220-66923242 ATCCCTGCTCTGAAACTGCTAGG - Intergenic
1043767095 8:84149789-84149811 AACCCTCCTCTCCAACTGCCAGG - Intergenic
1044673106 8:94702845-94702867 AACCCTGCAATTCTACAGCCAGG - Intronic
1046104077 8:109645468-109645490 AGCGCTGCCCTGCAGCTGCCCGG + Exonic
1046665031 8:116991936-116991958 GACCCTGCACTGCATCTTCAGGG - Intronic
1049720256 8:144112330-144112352 CACCCTGCACTGCAAGTGGGAGG - Exonic
1052653324 9:31328627-31328649 ATGCCTGAACTGCAGCTGCCAGG + Intergenic
1052743954 9:32421482-32421504 AATCCAACCCTGCAACTGCCTGG + Intronic
1054921868 9:70551445-70551467 AACCCTGAACAGCAACTGCATGG + Intronic
1055244219 9:74220564-74220586 AACCCTGCAGACCAGCTGCCTGG + Intergenic
1056171376 9:83988235-83988257 AACCCAGCAATGCAACTGCAAGG - Intronic
1056684352 9:88747218-88747240 CACCCTGCACCCCAGCTGCCTGG + Intergenic
1059918510 9:119131407-119131429 ACCTCTTAACTGCAACTGCCTGG - Intergenic
1060101881 9:120847855-120847877 AATCCTGCACAGCTAGTGCCAGG - Intergenic
1060271180 9:122143121-122143143 GACCCTGCACCTCATCTGCCTGG + Intergenic
1060587368 9:124795016-124795038 CACCATGGACTGCAGCTGCCCGG - Exonic
1061749683 9:132769212-132769234 CACCCTGCCCTGCCACTGCCTGG + Intronic
1193503245 X:82306795-82306817 AACCCTGGACTGACACTGCCTGG - Intergenic
1194095360 X:89632457-89632479 ATCCCTGCACACCAGCTGCCTGG - Intergenic
1195841476 X:109180635-109180657 ACACCTGAACTGCAGCTGCCAGG + Intergenic
1196519418 X:116655206-116655228 AGCCCTGCTCACCAACTGCCTGG - Intergenic
1196585115 X:117419877-117419899 ATGCCTGAACTGCAGCTGCCAGG + Intergenic
1197097696 X:122614819-122614841 AAGCCACCACTGCAACTGCTTGG - Intergenic
1198083245 X:133259483-133259505 AACCTTCCACTGCAATTTCCAGG + Intergenic
1198512422 X:137365702-137365724 ACCACTGCACTCCAACAGCCTGG - Intergenic
1198575995 X:138010911-138010933 ATCCCTGCACTGCCACTTTCTGG + Intergenic
1200447990 Y:3288635-3288657 AGCCCTGCACACCAGCTGCCTGG - Intergenic