ID: 1163645844

View in Genome Browser
Species Human (GRCh38)
Location 19:18488541-18488563
Sequence AGCCCCCGCCCCGTGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163645844_1163645846 0 Left 1163645844 19:18488541-18488563 CCAGCATCCACGGGGCGGGGGCT 0: 1
1: 0
2: 1
3: 18
4: 143
Right 1163645846 19:18488564-18488586 AGAACAGAACATGCTCTGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163645844 Original CRISPR AGCCCCCGCCCCGTGGATGC TGG (reversed) Intronic
900125724 1:1068278-1068300 AGCCCCCGCCCAGTGTGTGTGGG + Intergenic
900290926 1:1923301-1923323 TGCCCCTGTCCCGTGGATGGGGG - Intronic
901050547 1:6424051-6424073 AGCCCCCTCTCTCTGGATGCCGG + Intronic
901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG + Intronic
902520328 1:17011984-17012006 AGCGCCCGCGCCGGGGCTGCCGG + Intergenic
903406015 1:23096889-23096911 AGCCTCCGTCCCGTGGGTTCAGG - Intronic
904249467 1:29212786-29212808 ACCCCTCGCACCGTGGATGCAGG + Intronic
904343373 1:29852485-29852507 AGCCCCCGCCGCGTGCTTCCTGG + Intergenic
905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG + Intronic
906199050 1:43947534-43947556 TGCCCCAGCCCCTTGGCTGCTGG - Exonic
910251113 1:85200622-85200644 AGCCCCCGCCACGTGGAGGCAGG - Exonic
913690922 1:121279138-121279160 AGCTCCTGCCCCCTGGGTGCTGG + Intronic
914146618 1:145000825-145000847 AGCTCCTGCCCCCTGGGTGCTGG - Intronic
915722265 1:157993841-157993863 AGCCCCCGCCTCGTGGCGTCCGG - Intronic
920478244 1:206297613-206297635 AGCTCCTGCCCCCTGGGTGCTGG + Intronic
922539484 1:226408123-226408145 CGGCCCCGCCCCGTGGACGCGGG - Intergenic
1062796984 10:352016-352038 AGCCCCCGCCCCGCTGAGGGAGG + Intronic
1062889603 10:1048650-1048672 CGCCCGCGCCCCGTGGAAGGCGG - Intronic
1063960946 10:11305071-11305093 AGCCCTGGCCCAGTGGATACAGG + Intronic
1064436426 10:15314872-15314894 AGCCTCCTCCCCGCGGCTGCAGG - Intronic
1067477208 10:46575050-46575072 AGCCCCCGGGCAGTGGATGGAGG + Intergenic
1067617531 10:47766731-47766753 AGCCCCCGGGCAGTGGATGGAGG - Intergenic
1071062478 10:81589317-81589339 AGCCCCCTCCCTGTGGAATCAGG + Intergenic
1075999855 10:126905754-126905776 AGCTCCAGCCCCGGGGATGCGGG + Intronic
1077293610 11:1813334-1813356 AGGACCCCCCCAGTGGATGCTGG + Intergenic
1077395633 11:2319766-2319788 GGCCCCCGGCCTGTGGATTCTGG + Intergenic
1080855323 11:36106849-36106871 TGTCCCTGCCCCGTGGATGCGGG + Intronic
1083891579 11:65598305-65598327 TGCCCAGGCCCCGTGGGTGCCGG - Exonic
1084204459 11:67583859-67583881 AGCCCCATCCCCGGGGACGCGGG - Intronic
1084564353 11:69920817-69920839 TCCCCCCGCCCCATGGCTGCAGG - Intergenic
1088800965 11:113306794-113306816 AGACCCCTCACCATGGATGCTGG - Intergenic
1091402534 12:189540-189562 ACCCCCCGCCCAGGGGCTGCAGG - Intergenic
1091830161 12:3543727-3543749 AGCCCCTGCCCTCTGGAGGCTGG - Intronic
1092849262 12:12612080-12612102 GGCCCCCGCCCCGAGGAAGAAGG - Exonic
1093711472 12:22334240-22334262 GGCCCCCGCCCCTGGGACGCCGG - Exonic
1096259718 12:50082994-50083016 AGCCCCCACCCAGGGGATGGAGG + Exonic
1096774950 12:53957941-53957963 AGCCCCAGCCCAGTAGACGCTGG + Exonic
1101023125 12:100573588-100573610 AGGCCCCGCCCCCGGGCTGCCGG - Intergenic
1101831102 12:108257271-108257293 AGCCCCCAGCCCATGGAGGCAGG + Intergenic
1104544670 12:129700146-129700168 AGCCCCCCCACGGTGGTTGCCGG - Exonic
1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG + Intronic
1105535143 13:21259169-21259191 AGCCCCCACCCCGTGAATCCAGG + Intergenic
1106078802 13:26483766-26483788 AGCCCCCACCCAGTAGATGCCGG + Intergenic
1109001038 13:56805250-56805272 AGCCTCCGCCCCCTGGGTTCAGG - Intergenic
1113284227 13:108828855-108828877 AGCCCCCTCCCCAAGGATGCAGG - Intronic
1113803420 13:113098170-113098192 AGCCCCAGCACAGTGGAGGCAGG + Intronic
1113848480 13:113405095-113405117 ACCCCCCAGCCCGGGGATGCGGG - Intergenic
1116957879 14:50943390-50943412 CGCCCCCACGCCGTGGATGGAGG + Intronic
1117420017 14:55535044-55535066 AGGCCCCGCCCCCAGGATTCTGG - Intergenic
1118244614 14:64097572-64097594 GGGCCCTGCCCCGTGGATCCTGG + Intronic
1122367318 14:101201776-101201798 AGCCCCCACCCCGTGTGAGCGGG - Intergenic
1123705953 15:22951375-22951397 AGCCCCGGCCGGGTGGGTGCAGG + Intronic
1128150646 15:65361644-65361666 AGGCCCCGCGTCCTGGATGCTGG + Intronic
1129246776 15:74283657-74283679 AACCCCCTCCCCCTGGAGGCGGG + Intronic
1130053236 15:80501618-80501640 AGCCCCTGCCTCCTGGCTGCTGG - Intronic
1132150150 15:99453295-99453317 AGCCCCCTCCCTGCGGCTGCTGG + Intergenic
1132658761 16:1052459-1052481 AGCCCCCGCCCCATGGTGGAGGG - Intergenic
1132724619 16:1333465-1333487 AGCCCCCTCCCCCGGGATGCGGG - Intergenic
1132725473 16:1336491-1336513 AGCCCCCGAGCCCTGGGTGCAGG - Intronic
1133774243 16:8885165-8885187 AGCCTCCGCTCCGGGGCTGCAGG + Intergenic
1139917615 16:70438351-70438373 AGCGCCAGTCCCGTGGAGGCTGG - Intronic
1141647975 16:85377677-85377699 AGCCCCGGCCCCCTGCCTGCAGG - Intergenic
1142711933 17:1728128-1728150 AGCCCCAGGCCCGAGGAGGCAGG - Exonic
1144219357 17:13086108-13086130 TGCCCCCTCCCCGTGCCTGCTGG + Intergenic
1144409624 17:14988040-14988062 AGCCCCTGCCCCTTGGCTACAGG - Intergenic
1144725335 17:17499060-17499082 ACCATCCGCCCCGTGGATCCCGG + Intergenic
1144849825 17:18238440-18238462 AGCCCCCGCCCGGCAGTTGCAGG + Exonic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1147931508 17:43984162-43984184 GGCGCCAGCCCCGGGGATGCGGG + Intronic
1148128164 17:45247473-45247495 AGCCTCCGCCCCCTCGAAGCGGG - Intergenic
1150128450 17:62653374-62653396 AGACCCCGCCCCGGGGGTGGGGG - Intronic
1150549043 17:66192108-66192130 AGTCCCCGCCCCCGGGCTGCTGG - Intergenic
1151653751 17:75485914-75485936 GGCCCCCGGCCAGTGGAAGCAGG - Exonic
1151704091 17:75757661-75757683 AGCCCCTGCTCTGTGCATGCGGG - Exonic
1151799708 17:76371059-76371081 AGCCTCCGCCTCCTGGATTCAGG + Intronic
1152887351 17:82860280-82860302 GGCCCCCGCCCCCTGCATGGCGG + Intronic
1153762145 18:8341681-8341703 AGCCCCCCCCCCTTTGATTCAGG + Intronic
1156267654 18:35503153-35503175 AGCTCGGGCCCAGTGGATGCTGG + Intergenic
1156388166 18:36625548-36625570 AGCCACCCCCCAGTGGGTGCCGG + Exonic
1156511118 18:37637663-37637685 AGACCCAGCCCAGTGGATGAGGG + Intergenic
1158931218 18:62325981-62326003 CGCGCGCGCCCCGGGGATGCTGG + Intronic
1159471857 18:68867464-68867486 ACCCCCAGCCCCCAGGATGCAGG - Intronic
1160544288 18:79642316-79642338 AGGCCCCGCCCCGTGGGTTCTGG - Intergenic
1160811323 19:1014138-1014160 GGCCAGCGCCCCGTAGATGCTGG - Intronic
1161563019 19:4984166-4984188 AGCCTCCGCTCGGTGGATGCTGG - Intronic
1163233021 19:16016513-16016535 ACCCCCCACCCCATGGATGGAGG - Intergenic
1163251160 19:16127139-16127161 AGCCCCCGCACCTGGGATGCTGG - Intronic
1163645844 19:18488541-18488563 AGCCCCCGCCCCGTGGATGCTGG - Intronic
1163756824 19:19111299-19111321 CGCCCCCGCACCCTGGAGGCCGG - Exonic
1164143295 19:22493500-22493522 AACCCCCGCCCCATGGAAGGAGG + Intronic
1165104718 19:33462125-33462147 AGCCCCGGCCCTGGGGGTGCTGG - Intronic
1166540462 19:43601979-43602001 AGCCTCCGCCTCCTGGATTCAGG + Intronic
1166641294 19:44497447-44497469 AGCCCCTGCTCCCAGGATGCAGG + Intronic
1167938096 19:52923548-52923570 CGCCCCCGCCCCGCGTCTGCCGG - Intergenic
927190140 2:20511853-20511875 AGCCCACCGCCTGTGGATGCAGG + Intergenic
929296737 2:40256799-40256821 ATCCCCAACCCTGTGGATGCAGG - Intronic
941934798 2:170974069-170974091 AGCCTCCGCCCCGCGGGTGTGGG - Intergenic
944290189 2:197996024-197996046 AGCCCCCTCCCTGTCGCTGCAGG - Intronic
945119294 2:206442406-206442428 AGCCCTCACCCCGTGGATGTCGG + Intergenic
947932274 2:233973885-233973907 AGCTCCCGCACCGTGGCTCCAGG - Intronic
948715091 2:239856069-239856091 AGCACCCGCCCTGTGGCTTCGGG + Intergenic
1168893247 20:1307685-1307707 CGCCCCCTCCCAGTGCATGCAGG - Exonic
1172870098 20:38130349-38130371 AGCCCAGACCCCGTGGAGGCAGG - Exonic
1172919962 20:38473029-38473051 GGCGCCCGCCCCGGCGATGCGGG + Exonic
1173838365 20:46140156-46140178 ACCCACCGCCCCCTGGGTGCAGG - Intergenic
1175415194 20:58796364-58796386 AGGCTCAGCCACGTGGATGCAGG - Intergenic
1175936704 20:62517535-62517557 ACCCCCCGCCCCGTGGCTCTCGG - Intergenic
1176039858 20:63059737-63059759 AGCCCTCGCCCCTTGGCTGCAGG - Intergenic
1176169272 20:63689695-63689717 AGCCCCCGCCCCGTGGCCAAGGG + Intronic
1176236632 20:64056562-64056584 AGCCCCCGCTCTGTGGTTGCAGG + Intronic
1176285428 21:5016689-5016711 AGCCCCCGGCCGGGGGAGGCGGG + Intergenic
1179871753 21:44246786-44246808 AGCCCCCGGCCGGGGGAGGCGGG - Intronic
1180889200 22:19273438-19273460 AGCCCCTGCCACCTGGAAGCTGG + Intronic
1181162074 22:20965211-20965233 AGCGCCCGCCCCGGGGACCCTGG + Intronic
1183486236 22:38089068-38089090 TGCCCCCGCCCCGGGGCGGCAGG - Intronic
1183746574 22:39695194-39695216 CGCCCCCTCCCTGTGGTTGCAGG - Intergenic
1184187728 22:42876100-42876122 AGCCCTCCTCCCCTGGATGCTGG + Intronic
1184418241 22:44364367-44364389 AGCCCAGGGCCCGTGGCTGCTGG + Intergenic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1185139346 22:49091709-49091731 AGCCCCCGCCACCCGGATGCTGG + Intergenic
953439533 3:42906136-42906158 AGCCCCGGCCTCCCGGATGCTGG + Intronic
954316919 3:49806323-49806345 AGCCCCCTCCCCGTCCAGGCCGG + Intronic
962551034 3:136491908-136491930 AGCCCCCGCCTCCTGGGTTCAGG - Intronic
963236652 3:142963303-142963325 TGCCCGCGCCCCGGGGCTGCAGG + Exonic
966355055 3:179071367-179071389 TGCCCCCGCCCCGTGGGAGTCGG - Intronic
969599974 4:8170553-8170575 AGTCCCGGCCCCGTGGCTGCGGG - Intergenic
973737690 4:53888773-53888795 AGCCCCTGCCCAGTGGAGGTTGG + Intronic
973915987 4:55635744-55635766 ACCCCCCGGCCCGTGGAAACGGG - Intronic
975883571 4:78939270-78939292 AGCCCCCTCCCCGGGGAGGCGGG - Exonic
978975119 4:114859684-114859706 AGCCCACCTCCAGTGGATGCAGG + Intronic
984638933 4:182142981-182143003 AGCTCCCGCCCCCTGTCTGCAGG - Intergenic
985068439 4:186144969-186144991 AGCCCCAGCCCCGGGGCCGCGGG + Exonic
985647842 5:1093483-1093505 AGTCCCCGCCCCGTGTGTCCCGG - Intronic
992269704 5:75052737-75052759 AGCCCCCGCCCCTGGGCTTCGGG - Intergenic
998799685 5:145856534-145856556 ACCCCCCGCCCCCTTGCTGCTGG - Intergenic
999273342 5:150311555-150311577 AGCCCTCGTCCCCTGGATCCAGG + Intronic
1003139315 6:3457242-3457264 CGCCCCCCTCCCGTGGATCCCGG - Intergenic
1003376019 6:5578425-5578447 AGCCCCCACCCCATGAATCCAGG - Intronic
1003911457 6:10747639-10747661 ACTCCCCGCCCCCGGGATGCAGG + Intergenic
1004409423 6:15366732-15366754 TGCCCCTGCCCAGTGGAAGCAGG + Intronic
1006860841 6:37170672-37170694 CGCCTCCGGCCCGGGGATGCGGG + Intronic
1006874707 6:37285404-37285426 AGCCCCCACCTCCTGGATTCAGG + Intronic
1007363219 6:41373204-41373226 AGCCCCCGCGCCGGAGCTGCGGG + Intergenic
1018887453 6:167951908-167951930 GTCCCCCGACCCGTGGAAGCGGG + Exonic
1019446200 7:1072763-1072785 AACCTCCGCCCCCTGGGTGCAGG + Intronic
1021231059 7:18086740-18086762 AGCCCCAGCGCCGCGGAGGCTGG - Intergenic
1021411132 7:20330977-20330999 AGCCCCCGCCCCGCGAAGCCGGG + Intronic
1023502030 7:40860831-40860853 ACCCCCCGCCCCGTCCATACAGG + Intergenic
1032197881 7:129799718-129799740 AGCCCCTGCCCACTGGATGGGGG + Intergenic
1032667040 7:134046960-134046982 AGCCCCTGCACACTGGATGCTGG + Intronic
1034814387 7:154159193-154159215 AGCCCCTGCTCCGTGGTTCCTGG + Intronic
1036707919 8:11059143-11059165 GGCCGCCACGCCGTGGATGCAGG - Intronic
1037707989 8:21331820-21331842 AGTCCCAGCCCCGTGGATTTAGG + Intergenic
1041182044 8:55259163-55259185 CGTCCCCGCGCAGTGGATGCCGG - Intronic
1045488783 8:102654640-102654662 CGCCCCCTCCCCGTGGCTTCCGG + Intronic
1049330309 8:142046940-142046962 AGCCTCCAGCCCGCGGATGCCGG - Intergenic
1050287549 9:4118470-4118492 AGCCCTCGACCCGTTGATGTAGG + Exonic
1052784329 9:32814492-32814514 AGCCTCCGCCCCGTGAGTTCAGG - Intergenic
1057420655 9:94909855-94909877 AGCTCCCACCCCATGGATGAAGG + Intronic
1060407991 9:123382135-123382157 AGCCCTGGCCCCGGGGCTGCAGG - Exonic
1060440106 9:123630447-123630469 CGCCGCAGACCCGTGGATGCAGG + Exonic
1061455323 9:130693282-130693304 TGCGGCCGCCCCGTGGGTGCTGG - Intergenic
1192274474 X:69615935-69615957 AGGCCCCGCCCCGCGGCTGGAGG + Intergenic