ID: 1163648189

View in Genome Browser
Species Human (GRCh38)
Location 19:18502130-18502152
Sequence GCCCCACAGCTCCACGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1452
Summary {0: 1, 1: 0, 2: 6, 3: 79, 4: 1366}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163648189 Original CRISPR GCCCCACAGCTCCACGGGGC AGG Intronic
900758807 1:4456514-4456536 GCCACACAGTTCCACGTGGCTGG - Intergenic
900815511 1:4840714-4840736 GACTCACAGTTCCACGTGGCTGG + Intergenic
900830466 1:4961713-4961735 GCCCCAAAGCCCCAAGGGACAGG + Intergenic
900863611 1:5251423-5251445 GACTCACAGTTCCACGTGGCTGG - Intergenic
900864462 1:5257875-5257897 GACTCACAGTTCCACGTGGCTGG - Intergenic
901067862 1:6502918-6502940 GCCCCAGCTCTCCCCGGGGCCGG - Intronic
901361932 1:8708732-8708754 GACTCACAGTTCCACGTGGCTGG - Intronic
901393672 1:8964748-8964770 GCCCCAATGCTCCACGGAGCCGG + Intronic
901401991 1:9020993-9021015 GACTCACAGTTCCACGTGGCTGG - Intronic
901511518 1:9720255-9720277 GCCCCTCAGCCTCACGCGGCGGG - Intronic
901757396 1:11449594-11449616 CCCCCAAAGCACCACGGGGGAGG + Intergenic
901880515 1:12191264-12191286 TCTTCACAGCCCCACGGGGCAGG + Intronic
902620268 1:17646744-17646766 GCCCCTCACCTCCCCAGGGCTGG - Intronic
902653188 1:17850164-17850186 GACTCACAGTTCCACGTGGCAGG - Intergenic
902672861 1:17987002-17987024 GACTCACAGTTCCACGTGGCTGG + Intergenic
902697181 1:18148061-18148083 GACTCACAGTTCCACAGGGCTGG - Intronic
903106396 1:21084272-21084294 GACTCACAGTTCCACGTGGCTGG + Intronic
903262721 1:22139995-22140017 GCCCAACAGCTGCACGCGGCGGG + Intronic
903335489 1:22621731-22621753 GCCCCACAGCCCCATGGGGCAGG + Intergenic
903362186 1:22783690-22783712 GCCTCACCGCTGCAAGGGGCTGG - Intronic
903839846 1:26231003-26231025 GACTCACAGTTCCACAGGGCTGG - Intergenic
903917999 1:26778529-26778551 TCCCCACAAGTCCAGGGGGCTGG - Intronic
904337482 1:29807491-29807513 GACTCACAGTTCCACGTGGCTGG - Intergenic
904427207 1:30436476-30436498 GACTCACAGTTCCACAGGGCTGG - Intergenic
904849281 1:33445137-33445159 GACTCACAGTTCCACGTGGCTGG - Intergenic
904856630 1:33502695-33502717 GACTCACAGTTCCACAGGGCTGG - Intergenic
905659374 1:39709726-39709748 GACTCACAGTTCCACAGGGCTGG - Intronic
905987332 1:42298216-42298238 GACTCACAGTTCCACAGGGCTGG - Intronic
906549800 1:46654968-46654990 GACTCACAGTTCCACAGGGCTGG + Intronic
906852580 1:49267736-49267758 GACTCACAGTTCCACGTGGCTGG + Intronic
907597814 1:55735865-55735887 GACTCACAGTTCCACAGGGCTGG + Intergenic
907683598 1:56588138-56588160 GACTCACAGTTCCACAGGGCTGG + Intronic
907685030 1:56602016-56602038 GACTCACAGTTCCACGTGGCTGG - Intronic
907776668 1:57522529-57522551 GACTCACAGTTCCACAGGGCTGG + Intronic
908098584 1:60766670-60766692 GACTCACAGTTCCACGTGGCTGG - Intergenic
908262141 1:62347479-62347501 GACCCAGACCTCCATGGGGCTGG + Intergenic
908328389 1:63045605-63045627 GACTCACAGTTCCACAGGGCTGG - Intergenic
908523394 1:64966129-64966151 GCCCGCCGGCTCCGCGGGGCTGG + Intronic
908638203 1:66191755-66191777 GACTCACAGTTCCACGTGGCTGG + Intronic
908881884 1:68742123-68742145 GACTCACAGTTCCACGTGGCTGG - Intergenic
909239162 1:73190841-73190863 GACTCACAGTTCCACGTGGCTGG + Intergenic
909273513 1:73654793-73654815 GACCCACAGCTCCTCATGGCTGG - Intergenic
909422871 1:75485765-75485787 GCCTCACAGTTCCACATGGCTGG + Intronic
909542823 1:76809565-76809587 GACTCACAGCTCCACATGGCTGG - Intergenic
909567990 1:77077214-77077236 GACTCACAGCTCCACATGGCTGG + Intergenic
909592051 1:77361648-77361670 GACTCACAGTTCCACGTGGCTGG + Intronic
909741710 1:79037368-79037390 TTCCCACAGCTCCACTAGGCAGG - Intergenic
909953832 1:81753197-81753219 GACTCACAGTTCCACGTGGCTGG + Intronic
910417282 1:87014227-87014249 GACCCACAGTTCCACATGGCTGG + Intronic
910815215 1:91285137-91285159 GGCTCACAGTTCCACGTGGCTGG - Intronic
910977314 1:92920419-92920441 GACTCACAGTTCCACGTGGCTGG - Intronic
911007472 1:93242253-93242275 GACTCACAGTTCCACGTGGCTGG + Intronic
911007734 1:93244098-93244120 GACTCACAGTTCCACGTGGCTGG + Intronic
911829722 1:102535699-102535721 GACCCACAGTTCCACATGGCTGG + Intergenic
911848557 1:102784860-102784882 GGCTCACAGTTCCACAGGGCTGG + Intergenic
911951071 1:104173995-104174017 GCCTCACAGTTCCATGTGGCTGG + Intergenic
912024633 1:105153361-105153383 GACTCACAGCTCCATGTGGCTGG + Intergenic
912078726 1:105910494-105910516 ACCCAACAGCTACATGGGGCAGG + Intergenic
912579270 1:110705554-110705576 GACCCACAGTTCCACAGGGGTGG + Intergenic
912974265 1:114313941-114313963 GCCTCACAGTTCCATGTGGCTGG + Intergenic
913034687 1:114952486-114952508 GACTCACAGTTCCACAGGGCTGG + Intronic
913307941 1:117451748-117451770 GCCTTACAGTTCCACGTGGCTGG - Intronic
913309097 1:117468111-117468133 GACTCACAGTTCCACAGGGCTGG + Intronic
915276964 1:154795783-154795805 GCCCCACAGGTCCACGTCTCTGG - Intronic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
915811626 1:158919558-158919580 GACTCACAGTTCCACAGGGCTGG - Intergenic
915876027 1:159612997-159613019 GACTCACAGTTCCACGTGGCTGG + Intergenic
916851394 1:168707848-168707870 GACTCACAGTTCCACAGGGCTGG - Intronic
916989178 1:170224048-170224070 GACTCACAGTTCCACGTGGCTGG + Intergenic
916993103 1:170266170-170266192 GACCCACAGTTCCACAGGGCTGG + Intergenic
917035303 1:170742090-170742112 GCCTCACAGTTCCACAGGGCTGG + Intergenic
917690723 1:177465694-177465716 GACTCACAGTTCCACAGGGCTGG + Intergenic
917894765 1:179477383-179477405 GTCTCACAGTTCCACGTGGCTGG + Intronic
918133942 1:181653459-181653481 GACTCACAGTTCCACGTGGCTGG - Intronic
918773462 1:188595170-188595192 GACTCACAGTTCCACAGGGCTGG - Intergenic
918897169 1:190362820-190362842 GACTCACAGTTCCACGTGGCTGG - Intronic
919021877 1:192116059-192116081 GACTCACAGTTCCACGTGGCTGG - Intergenic
919037954 1:192340711-192340733 GACTCACAGTTCCACGTGGCTGG + Intronic
919201813 1:194365020-194365042 GACTCACAGTTCCACAGGGCTGG + Intergenic
919727138 1:200891680-200891702 GCGCCAGAGCTCCATGGGACAGG + Intronic
920211693 1:204333131-204333153 GGCCCCCAGCTCCACCAGGCGGG + Intronic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
920900564 1:210106474-210106496 GACTCACAGTTCCACAGGGCTGG + Intronic
921676709 1:217984191-217984213 GACCCACAGTTCCACATGGCTGG + Intergenic
921700031 1:218258706-218258728 ACCCCACAGCTCCAGGGTTCAGG + Intergenic
921835846 1:219777377-219777399 GACTCACAGTTCCACAGGGCTGG - Intronic
921891614 1:220359425-220359447 GACTCACAGTTCCACGTGGCTGG - Intergenic
923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG + Intronic
923094806 1:230766751-230766773 GACTCACAGTTCCACGTGGCTGG + Intronic
923250696 1:232177251-232177273 GACTCACAGTTCCACGTGGCTGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923714341 1:236412117-236412139 ACCACACAGCTACACAGGGCTGG - Intronic
923793825 1:237134371-237134393 GACTCACAGTTCCACGTGGCTGG + Intronic
923808828 1:237289414-237289436 GACTCACAGTTCCACAGGGCTGG + Intronic
923879947 1:238092726-238092748 GACTCACAGATCCACGTGGCTGG + Intergenic
923880969 1:238103880-238103902 GACTCACAGTTCCACGTGGCTGG + Intergenic
924020510 1:239776744-239776766 GACTCACAGTTCCACAGGGCTGG + Intronic
924104553 1:240637183-240637205 GACTCACAGTTCCACGTGGCTGG - Intergenic
924178762 1:241419907-241419929 GACTCACAGTTCCACGTGGCTGG - Intergenic
1063505943 10:6599886-6599908 GACTCACAGTTCCACGTGGCTGG + Intergenic
1063544249 10:6964416-6964438 GACTCACAGTTCCACGTGGCTGG - Intergenic
1063567602 10:7184453-7184475 GACTCACAGTTCCACGTGGCTGG - Intronic
1063782973 10:9347968-9347990 GACTCACAGTTCCACGTGGCTGG - Intergenic
1064144529 10:12816943-12816965 GACTCACAGTTCCACGTGGCTGG + Intronic
1064178126 10:13093185-13093207 GACTCACAGTTCCACGTGGCTGG + Intronic
1064421379 10:15193713-15193735 GACTCACAGTTCCACGTGGCTGG - Intergenic
1064496415 10:15915170-15915192 GACCCACAGTTCCACATGGCTGG - Intergenic
1064498295 10:15939501-15939523 GACTCACAGTTCCACGTGGCTGG + Intergenic
1064534843 10:16348056-16348078 GCCTTACAGTTCCACGTGGCTGG - Intergenic
1064638830 10:17395206-17395228 GACTCACAGTTCCACGTGGCTGG - Intronic
1064690362 10:17911607-17911629 GACTCACAGTTCCACGTGGCTGG + Intergenic
1065471449 10:26086129-26086151 GACTCACAGCTCCACATGGCTGG + Intronic
1065642174 10:27794404-27794426 GACTCACAGTTCCATGGGGCTGG - Intergenic
1065749642 10:28874088-28874110 GACTCACAGCTCCACATGGCTGG + Intronic
1065879793 10:30028642-30028664 GCCCCACAGCCACCGGGGGCTGG + Exonic
1066109383 10:32182717-32182739 GCCCGACAGCCCCACAGGACTGG + Intergenic
1066288987 10:33996992-33997014 GACTCACAGTTCCACGTGGCTGG + Intergenic
1066463515 10:35633326-35633348 GGCTCACAGCTCCGCGTGGCTGG + Intergenic
1066480251 10:35788587-35788609 GACTCACAGTTCCACGTGGCTGG - Intergenic
1066488750 10:35873800-35873822 GACTCACAGCTCCACATGGCTGG - Intergenic
1066542107 10:36458597-36458619 GGCTCACAGTTCCACAGGGCTGG + Intergenic
1066756070 10:38714292-38714314 GACTCACAGCTCCACATGGCTGG + Intergenic
1067219070 10:44329422-44329444 GACTCACAGTTCCACAGGGCTGG - Intergenic
1067308826 10:45093090-45093112 GACTCATAGCTCCACGTGGCTGG - Intergenic
1068173482 10:53425873-53425895 GACTCACAGTTCCACGTGGCTGG + Intergenic
1068243690 10:54337466-54337488 GACCCACAGTTCCACGTGGCTGG - Intronic
1068288205 10:54966810-54966832 GACTCACAGTTCCACGTGGCTGG - Intronic
1068477142 10:57542421-57542443 GACTCACAGTTCCACGTGGCTGG + Intergenic
1068915645 10:62428545-62428567 GACTCACAGTTCCACAGGGCTGG - Intronic
1069055466 10:63840012-63840034 GCCTCACAGTTCCATGTGGCTGG - Intergenic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1069923133 10:71829561-71829583 GACTCACAGTTCCACGTGGCTGG - Intronic
1070303969 10:75227061-75227083 GCACCCCAGCTCCACAGGGATGG + Intronic
1070521540 10:77257868-77257890 GACTCACAGTTCCACGTGGCTGG - Intronic
1070651247 10:78238289-78238311 GACTCACAGTTCCACGTGGCTGG - Intergenic
1070922305 10:80195724-80195746 GACTCACAGTTCCACGTGGCTGG + Intronic
1071601726 10:86961805-86961827 GCCCCACTCCGCCAAGGGGCAGG + Intronic
1071873298 10:89818038-89818060 GACCCACAGTTCCACGTGGCTGG + Intergenic
1072010557 10:91299371-91299393 CCCCCACAGATCCATGGGGTGGG - Intergenic
1073689022 10:105786973-105786995 GACTCACAGTTCCACAGGGCTGG + Intergenic
1073817410 10:107223281-107223303 GACTCACAGTTCCACGTGGCTGG + Intergenic
1073967186 10:109004140-109004162 GACTCACAGTTCCACGTGGCTGG + Intergenic
1074069017 10:110048233-110048255 GACTCACAGTTCCACGTGGCTGG - Intronic
1074069351 10:110050473-110050495 GACTCACAGTTCCACGTGGCTGG - Intronic
1074291192 10:112139113-112139135 GACTCACAGTTCCACGTGGCTGG - Intergenic
1074491382 10:113942321-113942343 GACTCACAGCTCCACATGGCTGG - Intergenic
1074689586 10:115992185-115992207 GCCTCACAGTTCCACAGGGTTGG - Intergenic
1075114490 10:119614408-119614430 GACTCACAGTTCCACGTGGCTGG - Intergenic
1075456545 10:122588635-122588657 GCTCCACAGCTCCAGAGGGCAGG - Intronic
1075457101 10:122591964-122591986 GCTCCACTGCTCCAGAGGGCAGG - Intronic
1075461220 10:122617708-122617730 GCTCCACAGCTCCAGAGAGCAGG - Intronic
1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG + Intronic
1075530397 10:123224423-123224445 GACTCACAGTTCCACGTGGCTGG + Intergenic
1075620464 10:123923899-123923921 GACTCACAGTTCCACGTGGCTGG - Intronic
1075815535 10:125261812-125261834 AACTCACAGCTCCACGTGGCTGG - Intergenic
1076086897 10:127640227-127640249 GACTCACAGTTCCACGTGGCTGG - Intergenic
1076194702 10:128508955-128508977 GACTTACAGCTCCACGTGGCTGG - Intergenic
1076210927 10:128644276-128644298 GACTCACAGTTCCACAGGGCTGG - Intergenic
1076281789 10:129252600-129252622 GACTCACAGCTCCACATGGCTGG + Intergenic
1076294597 10:129374742-129374764 GCCCCAAAGCAGCACGGAGCGGG - Intergenic
1077217507 11:1401091-1401113 GTCACAGAGCTGCACGGGGCAGG + Intronic
1077395056 11:2316530-2316552 GCCCCACTGCCCCAGGGTGCGGG - Intronic
1077412859 11:2411518-2411540 GTCCTTCATCTCCACGGGGCAGG + Exonic
1077827355 11:5825605-5825627 GACTCACAGCTCCACGTGGCTGG - Intronic
1077979401 11:7285243-7285265 GACTCACAGTTCCACAGGGCTGG + Intronic
1078301579 11:10136018-10136040 GACTCACAGCTCCACATGGCTGG + Intronic
1079312534 11:19379147-19379169 GCTCCATAGATCCACGGGGCTGG + Intronic
1079405483 11:20141561-20141583 GACTCACAGTTCCACGTGGCTGG - Intergenic
1080019300 11:27543492-27543514 GACTCACAGTTCCACAGGGCTGG + Intergenic
1080243526 11:30154385-30154407 GGCCCACAGTTCCACATGGCTGG + Intergenic
1080401190 11:31937537-31937559 GACCCACAGCTCCACATAGCAGG + Intronic
1080740097 11:35055839-35055861 GACTCACAGCTCCGCAGGGCTGG - Intergenic
1081050035 11:38327340-38327362 GACTCACAGTTCCACGTGGCTGG - Intergenic
1081315400 11:41624519-41624541 GACTCACAGTTCCACGTGGCTGG + Intergenic
1081845437 11:46237806-46237828 TCCCGACAGCTCCACGCGGTTGG - Intergenic
1081963783 11:47157244-47157266 GCCCCCCAGCCCCAGGGGGTCGG + Intronic
1082203225 11:49398974-49398996 GACTCACAGCTGCACGTGGCTGG - Intergenic
1082865755 11:57898727-57898749 GACTCACAGTTCCACGTGGCTGG - Intergenic
1082887527 11:58103117-58103139 GACTCACAGTTCCACAGGGCTGG + Intronic
1082894005 11:58170795-58170817 GACACACAGTTCCACGTGGCTGG - Intronic
1083107114 11:60368802-60368824 GACCCATAGTTCCACGTGGCTGG - Intronic
1083360574 11:62104570-62104592 GACTCACAGTTCCACAGGGCTGG - Intergenic
1083506355 11:63161067-63161089 GACTCACAGCTCCATGTGGCTGG + Intronic
1084006516 11:66326280-66326302 GCACCACACTCCCACGGGGCTGG + Intergenic
1084529137 11:69716908-69716930 GCACCACAGATCAAGGGGGCTGG + Intergenic
1084546429 11:69817320-69817342 GCACCACAGCACCCCTGGGCTGG - Intronic
1084647230 11:70465555-70465577 GCTTCACAGCTGCATGGGGCTGG + Intergenic
1084658884 11:70535759-70535781 GTCCCTGTGCTCCACGGGGCAGG + Intronic
1085681647 11:78580932-78580954 GACTCACAGTTCCACGTGGCTGG + Intergenic
1085861986 11:80245253-80245275 GACTCACAGTTCCACAGGGCTGG - Intergenic
1086033505 11:82388401-82388423 GACTTACAGCTCCACGTGGCTGG - Intergenic
1086419052 11:86619688-86619710 GACTCACAGTTCCACGTGGCTGG - Intronic
1086552046 11:88063828-88063850 GACTCACAGTTCCACGTGGCTGG - Intergenic
1086609619 11:88739771-88739793 GACCCACAGTTCCACATGGCTGG - Intronic
1086651813 11:89301105-89301127 GACTCACAGCTGCACGTGGCTGG + Intergenic
1087024591 11:93637038-93637060 GACTCACAGTTCCACGTGGCTGG - Intergenic
1087511448 11:99101026-99101048 GACTCACAGCTCCACATGGCTGG + Intronic
1087574665 11:99975543-99975565 GACTCACAGATCCACGTGGCTGG + Intronic
1087603598 11:100346848-100346870 GACTCACAGTTCCACGTGGCTGG + Intronic
1087838447 11:102897915-102897937 GACCCACAGTTCCACATGGCTGG - Intergenic
1088033716 11:105285450-105285472 GACTCACAGTTCCACGTGGCTGG + Intergenic
1088088326 11:106007435-106007457 GACTCACAGTTCCACGTGGCTGG + Intronic
1088141357 11:106620758-106620780 GACTCACAGTTCCACGTGGCTGG - Intergenic
1088219954 11:107559184-107559206 AACCCACAGTTCCACGTGGCCGG - Intronic
1088377497 11:109158775-109158797 GCCTTACAGTTCCACGTGGCTGG + Intergenic
1088706194 11:112466659-112466681 GACTCACAGTTCCATGGGGCTGG + Intergenic
1088742066 11:112775298-112775320 GACTCACAGCTCCACATGGCTGG - Intergenic
1088849690 11:113694820-113694842 GGCCCACAGCTGGATGGGGCAGG - Intronic
1089161343 11:116439901-116439923 GACTCACAGTTCCACGTGGCTGG + Intergenic
1089195262 11:116690685-116690707 GACTCACAGTTCCACAGGGCTGG + Intergenic
1089578368 11:119462847-119462869 GACTCACAGTTCCACGTGGCTGG - Intergenic
1090392157 11:126395774-126395796 GACTCACAGTTCCACGTGGCTGG - Intronic
1090521860 11:127488507-127488529 GACCCACAGTTCCACATGGCTGG + Intergenic
1090583526 11:128185337-128185359 GACTCACAGTTCCACGTGGCTGG - Intergenic
1091001726 11:131915676-131915698 GACTCACAGTTCCACGTGGCTGG + Intronic
1091281207 11:134382921-134382943 GCCCCACGGGTGAACGGGGCAGG - Exonic
1091350597 11:134891050-134891072 GACTCACAGTTCCACGTGGCTGG - Intergenic
1092437283 12:8460265-8460287 GACTCACAGTTCCACGTGGCTGG + Intronic
1092625932 12:10328807-10328829 GACTCACAGTTCCACGTGGCTGG + Intergenic
1093280202 12:17184841-17184863 GACTCACAGTTCCACAGGGCTGG - Intergenic
1093337036 12:17918865-17918887 GACTCACAGTTCCACGTGGCTGG + Intergenic
1093570863 12:20664162-20664184 GACTCACAGTTCCACAGGGCTGG - Intronic
1093646160 12:21587599-21587621 GTCTCACAGTTCCACAGGGCTGG - Intronic
1093909016 12:24724975-24724997 GACTCACAGTTCCACAGGGCTGG + Intergenic
1094575767 12:31683705-31683727 GACTCACAGTTCCACGTGGCTGG - Intronic
1095122473 12:38436298-38436320 GACTCACAGCTCCATGTGGCTGG + Intergenic
1095188616 12:39230570-39230592 GACTCACAGTTCCACGTGGCTGG + Intergenic
1095315284 12:40753450-40753472 GACTCACAGTTCCACGTGGCTGG + Intronic
1095527203 12:43141160-43141182 GACTCACAGCTCCACATGGCTGG - Intergenic
1095627490 12:44333660-44333682 GACTCACAGTTCCACAGGGCTGG - Intronic
1095633226 12:44402050-44402072 GACTCACAGTTCCACGTGGCTGG + Intergenic
1095795152 12:46210802-46210824 GACTCACAGTTCCACGTGGCTGG - Intronic
1095839195 12:46673358-46673380 GACTCACAGCTCCACATGGCTGG - Intergenic
1096905079 12:54927647-54927669 GACCCACAGTTGCACGTGGCTGG - Intergenic
1096960087 12:55569042-55569064 GACTCACAGTTCCACGTGGCTGG + Intergenic
1096969069 12:55651013-55651035 GACTCACAGTTCCACGTGGCTGG - Intergenic
1097400956 12:59127201-59127223 GACTCACAGTTCCACAGGGCTGG + Intergenic
1097478369 12:60087705-60087727 GACTCACAGTTCCACAGGGCTGG - Intergenic
1097715557 12:62962394-62962416 GACTCACAGTTCCACAGGGCTGG + Intergenic
1098140203 12:67443212-67443234 GACCCACAGTTCCACATGGCTGG - Intergenic
1098317390 12:69207105-69207127 GGCCCACAGTTCCACATGGCTGG + Intergenic
1098792239 12:74837955-74837977 GACTCACAGTTCCACGTGGCTGG - Intergenic
1098976150 12:76904057-76904079 GGCTCACAGTTCCACGTGGCTGG - Intergenic
1099057778 12:77867335-77867357 GACTCACAGTTCCACGTGGCTGG - Intronic
1099217258 12:79867929-79867951 GACTCACAGTTCCACAGGGCTGG - Intronic
1099594014 12:84634614-84634636 GACTCACAGTTCCACGTGGCTGG + Intergenic
1099671961 12:85705876-85705898 GACTCACAGTTCCACGTGGCTGG - Intergenic
1099791425 12:87339822-87339844 GACCCACAGTTCCACGTGGCTGG + Intergenic
1099905249 12:88762979-88763001 GGCTCACAGCTCCACATGGCTGG + Intergenic
1100327596 12:93553942-93553964 GACTCACAGCTCCACGTGCCTGG + Intergenic
1100602957 12:96128116-96128138 GACTCACAGTTCCACGTGGCTGG + Intergenic
1100714841 12:97294758-97294780 GACTCACAGCTCCACGTGGCTGG - Intergenic
1100936584 12:99676204-99676226 GACTCACAGTTCCACAGGGCTGG - Intronic
1101005692 12:100398971-100398993 GACTCACAGTTCCACGTGGCGGG - Intronic
1101084540 12:101222357-101222379 GGCTCACAGTTCCACGTGGCTGG - Intergenic
1101190312 12:102325860-102325882 GACTCACAGTTCCACAGGGCGGG - Intergenic
1101230100 12:102732004-102732026 GACTCACAGTTCCACGTGGCTGG - Intergenic
1101270137 12:103133962-103133984 GACTCACAGTTCCACAGGGCTGG - Intergenic
1101396535 12:104353734-104353756 GACTCACAGTTCCACGTGGCGGG + Intergenic
1101527355 12:105543819-105543841 GACTTACAGCTCCACGTGGCTGG + Intergenic
1101535571 12:105613227-105613249 GACTCACAGTTCCACGTGGCTGG - Intergenic
1101592787 12:106138868-106138890 GCTCCACAGCTCGCCGCGGCCGG - Exonic
1101763333 12:107677077-107677099 GACTCACAGTTCCACGTGGCTGG + Intergenic
1101861424 12:108485458-108485480 GACTCACAGTTCCACGTGGCTGG - Intergenic
1102553944 12:113713565-113713587 GACCCACAGTTCCACATGGCTGG + Intergenic
1102748468 12:115271270-115271292 GACTCACAGTTCCACGTGGCTGG + Intergenic
1102825576 12:115945414-115945436 GACTCACAGTTCCACGTGGCTGG - Intergenic
1103008931 12:117442949-117442971 GACTCACAGTTCCACGTGGCTGG + Intronic
1103263657 12:119610723-119610745 GACTCACAGCTCCACATGGCTGG - Intronic
1103264410 12:119616946-119616968 GACTCACAGTTCCACAGGGCTGG - Intronic
1103438550 12:120945852-120945874 GACTCACAGTTCCACGCGGCTGG - Intergenic
1103466935 12:121149398-121149420 GGCCCACAGTTCCACATGGCTGG + Intronic
1103686527 12:122736363-122736385 GGCTCACAGTTCCACGTGGCTGG - Intergenic
1104140054 12:125979309-125979331 GACTCACAGTTCCACGTGGCTGG + Intergenic
1104171952 12:126290981-126291003 GCCTCACAGTTCCACCTGGCTGG + Intergenic
1104386004 12:128352202-128352224 GACTCACAGTTCCACGGGGCTGG + Intronic
1104458887 12:128937860-128937882 GACTCACAGCTCCAAAGGGCTGG - Intronic
1104525422 12:129516413-129516435 GACTCACAGTTCCACGTGGCTGG + Intronic
1104532916 12:129589346-129589368 GACCCACAGTTCCACGTGACTGG - Intronic
1104808176 12:131602903-131602925 GACTCACAGTTCCACGTGGCTGG + Intergenic
1104929236 12:132329457-132329479 CCCTCACCGCTCCCCGGGGCGGG - Intergenic
1104945908 12:132414826-132414848 GCTCCACAGCTCCCTGGGGTGGG - Intergenic
1105014974 12:132781128-132781150 GCCCCACGGCTCCAGAGGCCAGG + Intronic
1105405657 13:20130378-20130400 GACTCACAGTTCCACGTGGCTGG + Intergenic
1105650391 13:22371285-22371307 GGCTCACAGCTCCATGTGGCTGG + Intergenic
1106120865 13:26859344-26859366 GGCTCACAGTTCCACGTGGCCGG + Intergenic
1106252429 13:27992454-27992476 GCCCCCCAGCCCCAAGGTGCAGG - Intergenic
1106311860 13:28561622-28561644 GACTCACAGTTCCACGTGGCCGG - Intergenic
1106369931 13:29122334-29122356 GACTCACAGTTCCACGTGGCTGG + Intronic
1106572170 13:30936684-30936706 GTCCCAGTGCTCCACAGGGCTGG + Intronic
1106583445 13:31037075-31037097 AACTCACAGCTCCACGTGGCTGG + Intergenic
1106619056 13:31356337-31356359 GACTCACAGTTCCAAGGGGCTGG - Intergenic
1106631684 13:31480650-31480672 GACTCACAGTTCCACGTGGCTGG + Intergenic
1107964058 13:45583812-45583834 GACTCACAGTTCCACGTGGCTGG - Intronic
1108142393 13:47437390-47437412 GACTCACAGTTCCACGTGGCTGG - Intergenic
1108701008 13:52944307-52944329 GACTCACAGTTCCACGTGGCTGG + Intergenic
1108788949 13:53943085-53943107 GACCCACAGTTCCACGTGGCTGG + Intergenic
1108851009 13:54728842-54728864 GACCCACAGTTCCACGTGGCTGG - Intergenic
1108944494 13:56003885-56003907 GACACACAGTTCCACGTGGCTGG + Intergenic
1109369056 13:61397519-61397541 GACTCACAGTTCCACGTGGCTGG - Intergenic
1109416998 13:62052693-62052715 GACTCACAGTTCCACGTGGCTGG - Intergenic
1109614313 13:64809913-64809935 GACTCACAGTTCCACGTGGCTGG - Intergenic
1109679491 13:65731203-65731225 GTCTCACAGTTCCACGTGGCTGG - Intergenic
1109811343 13:67516948-67516970 GACTCACAGTTCCACGTGGCTGG + Intergenic
1110056794 13:70984538-70984560 GACTCACAGTTCCACGTGGCTGG + Intergenic
1110161658 13:72385772-72385794 GACTCACAGTTCCACGTGGCTGG + Intergenic
1110341225 13:74392937-74392959 GACTCACAGCTCCGCGTGGCTGG + Intergenic
1110370110 13:74730184-74730206 GACTCACAGTTCCACGTGGCTGG + Intergenic
1110497260 13:76183352-76183374 GACTCACAGTTTCACGGGGCTGG + Intergenic
1110732526 13:78895724-78895746 GCCTCACAGTTCCACATGGCTGG + Intergenic
1110832947 13:80052926-80052948 GACCCACAGTTCCACATGGCTGG + Intergenic
1111411248 13:87880145-87880167 GACCCACAGTTCCACATGGCTGG + Intergenic
1111440574 13:88279045-88279067 GACTCACAGTTCCACGTGGCTGG + Intergenic
1111441222 13:88284742-88284764 GACTCACAGTTCCACAGGGCTGG - Intergenic
1111459325 13:88519124-88519146 AACTCACAGCTCCACGTGGCTGG - Intergenic
1111477584 13:88773117-88773139 GACTCACAGTTCCACGTGGCTGG + Intergenic
1111601488 13:90480953-90480975 GACTCACAGTTCCACAGGGCTGG + Intergenic
1111816749 13:93163450-93163472 GACTCACAGTTCCACGTGGCTGG + Intergenic
1111897501 13:94159366-94159388 GACTCACAGCTCCACGTGGTTGG + Intronic
1111929619 13:94500270-94500292 GACTCACAGTTCCACGTGGCTGG + Intergenic
1112108499 13:96268274-96268296 GACTCACAGTTCCACAGGGCTGG + Intronic
1112120506 13:96405067-96405089 GACTCACAGCTCCACTTGGCTGG - Intronic
1112190423 13:97171979-97172001 GACTCACAGTTCCACGTGGCTGG - Intergenic
1112257864 13:97851194-97851216 GACTCACAGTTCCACAGGGCTGG + Intergenic
1112281817 13:98069383-98069405 GACTCACAGTTCCACGTGGCTGG - Intergenic
1112312889 13:98335283-98335305 GACCCACAGGTCCACATGGCTGG + Intronic
1112433458 13:99373542-99373564 GGCTCACAGCTCCTCAGGGCAGG - Intronic
1112637296 13:101228627-101228649 GACTCACAGTTCCACGTGGCTGG - Intronic
1112722178 13:102257998-102258020 GACTCACAGTTCCACGTGGCTGG + Intronic
1112769573 13:102781014-102781036 GACTCACAGTTCCACAGGGCTGG - Intergenic
1112797577 13:103072892-103072914 GACTCACAGCTCCACATGGCTGG + Intergenic
1112857362 13:103787681-103787703 GACTCACAGTTCCACGTGGCTGG + Intergenic
1112982209 13:105399405-105399427 GACTCACAGTTCCACGTGGCTGG + Intergenic
1113003122 13:105666698-105666720 GACTCACAGTTCCACGTGGCTGG + Intergenic
1113005304 13:105695019-105695041 GACGCACAGTTCCACGTGGCTGG - Intergenic
1113096953 13:106676218-106676240 GACTCACAGTTCCACGTGGCTGG + Intergenic
1113173024 13:107527834-107527856 GACTCACAGTTCCACGTGGCTGG - Intronic
1113176787 13:107573878-107573900 GACTCACAGCTCCACATGGCTGG - Intronic
1113196673 13:107816344-107816366 GACTCACAGGTCCACGTGGCTGG + Intronic
1113521206 13:110942525-110942547 GACTCACAGCTCCATGTGGCTGG - Intergenic
1113607708 13:111622252-111622274 GCCCCGCAGGTCCCAGGGGCTGG - Intronic
1113671561 13:112178968-112178990 GCCCCACAGCCTCACAGGGAGGG - Intergenic
1113903970 13:113811037-113811059 CCTCCACAGCTGCATGGGGCAGG - Intronic
1113915426 13:113868177-113868199 GACTCACAGTTCCACGTGGCTGG - Intergenic
1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG + Intronic
1115132575 14:30071895-30071917 GACTCACAGTTCCACGTGGCAGG - Intronic
1115525672 14:34278374-34278396 GACTCACAGTTCCACGTGGCTGG - Intronic
1115754204 14:36517368-36517390 GCCCTGCAGCGCCGCGGGGCTGG + Exonic
1115817522 14:37178871-37178893 GACTCACAGTTCCACGTGGCTGG + Intergenic
1116095181 14:40358767-40358789 GACTCACAGTTCCACGTGGCTGG - Intergenic
1116414610 14:44665532-44665554 GACTCACAGCTCCGCGAGGCTGG + Intergenic
1116865838 14:50030944-50030966 GACTCACAGTTCCACGTGGCTGG + Intergenic
1116969577 14:51050454-51050476 GACTCACAGTTCCACGTGGCTGG - Intronic
1117013412 14:51493569-51493591 GACTCACAGTTCCACAGGGCTGG - Intronic
1117106989 14:52407806-52407828 GACTCACAGTTCCACGTGGCTGG - Intergenic
1117173787 14:53128161-53128183 GACTCACAGTTCCACGTGGCTGG - Intronic
1117629324 14:57673367-57673389 GGCACACAGCTCCACAGTGCTGG - Intronic
1118481072 14:66166318-66166340 GACTCACAGTTCCACGTGGCCGG - Intergenic
1118538177 14:66791896-66791918 GACTCACAGTTCCACGTGGCTGG + Intronic
1119004132 14:70908321-70908343 GCCACACAGCCCCACGGGCGGGG - Intronic
1119402799 14:74375637-74375659 GACTCACAGTTCCACGTGGCTGG + Intergenic
1119862524 14:77946838-77946860 GACTCACAGTTCCACGTGGCTGG - Intergenic
1120133233 14:80832175-80832197 GACTCACAGTTCCACGTGGCTGG - Intronic
1120159202 14:81127836-81127858 GACTCACAGTTCCACGTGGCTGG - Intronic
1120244836 14:81994625-81994647 GACTCACAGTTCCACGTGGCTGG + Intergenic
1120319035 14:82935021-82935043 AACTCACAGCTCCACGTGGCAGG - Intergenic
1120476740 14:84998176-84998198 GACTCACAGTTCCACGTGGCTGG - Intergenic
1120720487 14:87885239-87885261 GACTCACAGTTCCACAGGGCAGG + Intronic
1120724432 14:87922058-87922080 GACTCACAGTTCCACGTGGCTGG - Intronic
1120739468 14:88091637-88091659 GACTCACAGTTCCACGTGGCTGG - Intergenic
1120843516 14:89107108-89107130 GACTCACAGTTCCACGTGGCTGG - Intergenic
1120863795 14:89278148-89278170 GACTCACAGTTCCACGTGGCTGG + Intronic
1121063303 14:90937620-90937642 GGCTCACAGTTCCACGTGGCTGG + Intronic
1121102741 14:91261341-91261363 TCCCCACACCTCCAGAGGGCAGG - Intergenic
1121166397 14:91806166-91806188 GACTCACAGTTCCACGTGGCTGG - Intronic
1121207336 14:92180376-92180398 GACTCACAGTTCCACAGGGCTGG - Intergenic
1121377335 14:93425115-93425137 GACTCACAGCTCCACATGGCTGG + Intronic
1121399685 14:93662668-93662690 GCCACACAGCTCCACCAGGTAGG - Exonic
1121678176 14:95771327-95771349 GACTCACAGTTCCACGTGGCTGG - Intergenic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1121813129 14:96908901-96908923 GACTCACAGTTCCACAGGGCTGG + Intronic
1121876211 14:97455892-97455914 GCCCCACAGCTTCATAGGTCAGG - Intergenic
1122352821 14:101106266-101106288 GACTCACAGTTCCACGTGGCTGG - Intergenic
1122393064 14:101403560-101403582 GCCACAGAGCTCCATGTGGCCGG + Intergenic
1122440776 14:101730472-101730494 GACTCACAGTTCCACGGGCCTGG - Exonic
1122577036 14:102749252-102749274 GCTCCAGAGCTCCAGGGGCCTGG + Intergenic
1122577623 14:102752008-102752030 TCACTACAGCCCCACGGGGCAGG - Intergenic
1122686657 14:103511447-103511469 CCCCCACAGGTCCTGGGGGCGGG - Intergenic
1122792332 14:104189264-104189286 GCCTCACAGTGCCACGGGGCTGG + Intergenic
1122805274 14:104253324-104253346 GCCCCACAGCTCCAGCTGTCTGG + Intergenic
1122815389 14:104309628-104309650 GCCCCGCATCTGCATGGGGCCGG - Intergenic
1122974557 14:105165767-105165789 GCCCAAAAGCCCCACGGGCCTGG + Intronic
1202899537 14_GL000194v1_random:27382-27404 GCCCCACCTCTCCACGGCGCGGG + Intergenic
1123440327 15:20286351-20286373 GACTCACAGCTCCACATGGCTGG + Intergenic
1123716967 15:23040376-23040398 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717058 15:23040671-23040693 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717693 15:23042788-23042810 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718030 15:23043944-23043966 GCCCCACAGCACCGCTGGCCAGG - Intergenic
1123718086 15:23044127-23044149 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718377 15:23045154-23045176 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718746 15:23046449-23046471 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718909 15:23047009-23047031 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719124 15:23047752-23047774 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719186 15:23047970-23047992 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719261 15:23048232-23048254 GCCCCACAGCACCACTGGCTAGG - Intergenic
1123719413 15:23048759-23048781 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1124550006 15:30671734-30671756 GACTCACAGTTCCACGTGGCTGG + Intronic
1124966961 15:34439987-34440009 GACTCACAGTTCCACGTGGCTGG + Intergenic
1125116622 15:36101088-36101110 GGCTCACAGTTCCACAGGGCTGG + Intergenic
1125322136 15:38499974-38499996 GACTCACAGTTCCACAGGGCTGG - Intronic
1125382618 15:39103249-39103271 GACTCACAGTTCCACAGGGCTGG - Intergenic
1125760977 15:42095073-42095095 GCCCCTCACCTCCATGCGGCGGG + Intergenic
1126941996 15:53778087-53778109 GACTCACAGCTCCACATGGCTGG + Intergenic
1127733962 15:61824805-61824827 GACTCACAGTTCCACGTGGCTGG + Intergenic
1127746925 15:61987356-61987378 GACCCACAGTTCCACACGGCTGG + Intronic
1127951864 15:63815802-63815824 GCCTCACAGTTCCACAGGGCTGG + Intronic
1128355977 15:66926879-66926901 GACTCACAGTTCCACGTGGCTGG - Intergenic
1128374700 15:67066400-67066422 GCCCCGCAGTGCCAGGGGGCTGG - Intronic
1128470886 15:67951519-67951541 GACTCACAGATCCACGTGGCTGG - Intergenic
1128660457 15:69497157-69497179 GCCCCAGAGCTCCACAGTGCTGG - Intergenic
1128749023 15:70135252-70135274 GACTCACAGTTCCACGTGGCTGG + Intergenic
1129669427 15:77598904-77598926 GCCCAGAGGCTCCACGGGGCTGG + Intergenic
1129911921 15:79234896-79234918 GACTCACAGTTCCACAGGGCTGG - Intergenic
1130027823 15:80285091-80285113 GCCACACAGCTCCACATGGTGGG - Intergenic
1130711450 15:86285589-86285611 GACTCACAGTTCCACGTGGCTGG - Intronic
1130900128 15:88200687-88200709 GACCCACAGTTCCACATGGCTGG - Intronic
1130917215 15:88314603-88314625 GACTCACAGTTCCACGTGGCTGG + Intergenic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1131410569 15:92204095-92204117 GACTCACAGTTCCACGTGGCTGG - Intergenic
1131575185 15:93582312-93582334 GACTCACAGTTCCACGTGGCTGG - Intergenic
1131649509 15:94383518-94383540 GACTCACAGTTCCACGTGGCTGG + Intronic
1131793919 15:95994011-95994033 GACTCACAGCTCCACATGGCTGG + Intergenic
1131897476 15:97049252-97049274 GACTCACAGTTCCACGTGGCTGG - Intergenic
1132030149 15:98432548-98432570 GACTCAAAGCTCCACGTGGCTGG - Intergenic
1132178330 15:99733093-99733115 GCTCCACGGCTCCACGGGCGGGG + Intronic
1132808142 16:1785209-1785231 GCCCCACTGCCCCACCCGGCAGG + Intronic
1132977436 16:2717667-2717689 GCCCCTCAACTCCAGGGGACTGG - Intronic
1133006049 16:2882543-2882565 GCCCCACAGCTCCCTGTGCCCGG + Intergenic
1133470643 16:6072052-6072074 GACTCACAGCTCCACAGGGCTGG + Intronic
1133486204 16:6221658-6221680 GACTCACAGTTCCACGTGGCTGG + Intronic
1133580231 16:7137537-7137559 GACTCACAGTTCCACGTGGCTGG - Intronic
1133728851 16:8560899-8560921 GACTCACAGTTCCACGTGGCTGG + Intergenic
1133778930 16:8921699-8921721 GCCACAGAGCTCCCCGGTGCTGG - Intronic
1133926323 16:10195814-10195836 GACTCACAGTTCCACGTGGCTGG + Intergenic
1134086243 16:11359339-11359361 ACTCCACAGCTCCATGAGGCTGG - Intergenic
1134276042 16:12776967-12776989 GCCTCACAGTTCCACGTGGCTGG - Intronic
1134294344 16:12932133-12932155 GACTCACAGCTCCACATGGCTGG - Intronic
1134326752 16:13214653-13214675 GACTCACAGTTCCACGTGGCTGG + Intronic
1134330539 16:13247037-13247059 GACTCACAGTTCCACGTGGCTGG + Intergenic
1134340162 16:13337424-13337446 GACTCACAGTTCCACGTGGCTGG - Intergenic
1134359669 16:13519650-13519672 GACTCACAGTTCCACAGGGCTGG + Intergenic
1134606171 16:15572993-15573015 GACTCACAGTTCCACGTGGCTGG - Intronic
1134801728 16:17090814-17090836 GACTCACAGCTCCACACGGCTGG - Intergenic
1134869394 16:17638218-17638240 GACTCACAGTTCCACGTGGCTGG + Intergenic
1135495334 16:22946803-22946825 GACTCACAGCTCCACGTGGCTGG + Intergenic
1135828619 16:25753421-25753443 GCCTCACAGCTCCCTGGTGCTGG + Intronic
1135919159 16:26632798-26632820 GACTCACAGTTCCACGTGGCTGG + Intergenic
1135951553 16:26918982-26919004 GACTCACAGTTCCACGTGGCTGG - Intergenic
1135964876 16:27027560-27027582 GACTCACAGTTCCACGTGGCTGG - Intergenic
1135966367 16:27039099-27039121 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1136726610 16:32362576-32362598 GACTCACAGCTCCACATGGCTGG - Intergenic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1136844843 16:33568089-33568111 GACTCACAGCTCCACATGGCTGG - Intergenic
1137340360 16:47596234-47596256 GCCTCACAGTTCCACATGGCTGG - Intronic
1137392816 16:48095338-48095360 GACTCACAGTTCCACGTGGCTGG - Intronic
1137409828 16:48218799-48218821 GACTCACAGTTCCACGTGGCTGG - Intronic
1137686831 16:50392228-50392250 GACTCACAGTTCCACGTGGCTGG + Intergenic
1137775990 16:51054750-51054772 GACTCACAGTTCCACGTGGCTGG + Intergenic
1137806333 16:51309495-51309517 GACCCACAGTGCCACAGGGCTGG - Intergenic
1137961214 16:52884082-52884104 GACTCACAGTTCCACGTGGCTGG + Intergenic
1138198331 16:55070771-55070793 GACTCACAGTTCCACAGGGCTGG + Intergenic
1138229362 16:55326072-55326094 GCCCCAGAGCCCCAGGAGGCCGG - Intronic
1138553841 16:57760989-57761011 TCCCCACAACCCCAAGGGGCAGG - Intronic
1138908991 16:61373834-61373856 GACCTACAGTTCCACGTGGCTGG - Intergenic
1139021562 16:62756189-62756211 GACTCACAGTTCCACGTGGCTGG - Intergenic
1139139190 16:64240328-64240350 GACTCACAGTTCCACGTGGCTGG - Intergenic
1139171713 16:64638224-64638246 GACTCACAGTTCCACGTGGCTGG - Intergenic
1139299532 16:65933598-65933620 GACTCACAGTTCCACGTGGCTGG - Intergenic
1139650381 16:68359309-68359331 GGCCCACCCCTCCAAGGGGCTGG - Exonic
1140154001 16:72403300-72403322 GACTCACAGTTCCACGTGGCTGG + Intergenic
1140278216 16:73530089-73530111 GTCTCACAGTTCCACGTGGCTGG + Intergenic
1140763142 16:78130130-78130152 GACTCACAGTTCCACGTGGCTGG - Intronic
1140813466 16:78599994-78600016 GACTCACAGCTCCACATGGCTGG + Intronic
1141033415 16:80608746-80608768 GCCCCACCTCTCCACAGGCCGGG - Intronic
1141133587 16:81451370-81451392 GACTCACAGTTCCACGTGGCTGG - Intronic
1141143135 16:81510240-81510262 GCCCAGGAGCTCCACGGAGCAGG + Intronic
1141214089 16:82008187-82008209 GACTCACAGTTCCACGTGGCTGG - Intronic
1141272930 16:82557340-82557362 GACTCACAGTTCCACAGGGCTGG - Intergenic
1141858076 16:86698289-86698311 CCCCCACAGCTGGAGGGGGCAGG - Intergenic
1141909553 16:87049357-87049379 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1141909560 16:87049393-87049415 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1141909567 16:87049429-87049451 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1141909574 16:87049465-87049487 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1141976094 16:87517577-87517599 GCATCTCAGCTCCACAGGGCTGG - Intergenic
1142044394 16:87915946-87915968 GACTCACAGTTCCACGTGGCTGG + Intronic
1142100551 16:88268841-88268863 GTCCCACAGCTCATGGGGGCCGG - Intergenic
1142415095 16:89936811-89936833 GCCCCTCAGCTCCAAGGGGCGGG - Intergenic
1202999824 16_KI270728v1_random:155182-155204 GACTCACAGCTCCACATGGCTGG + Intergenic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1203131422 16_KI270728v1_random:1691582-1691604 GACTCACAGCTCCACATGGCTGG + Intergenic
1203155011 16_KI270728v1_random:1868387-1868409 GACTCACAGCTCCACATGGCTGG - Intergenic
1143125337 17:4638295-4638317 GCGCCTCAGCACCACGGGGTTGG + Exonic
1143403167 17:6658814-6658836 GCGCCTCAGCACCACGGGGTTGG - Intergenic
1143558124 17:7675171-7675193 AACCCACAGCTGCACAGGGCAGG + Exonic
1143931851 17:10437557-10437579 GACTCACAGTTCCACGTGGCTGG - Intergenic
1144399779 17:14884859-14884881 GACTCACAGTTCCACAGGGCTGG + Intergenic
1144498973 17:15769236-15769258 GCCCCGGAGCTCCACGTAGCAGG + Intergenic
1144786249 17:17833490-17833512 GATCCACAGCTGCCCGGGGCTGG + Intronic
1146098518 17:29955507-29955529 GACTCACAGTTCCACGTGGCTGG - Intronic
1146448526 17:32952795-32952817 GACTCACAGCTCCACATGGCTGG - Intergenic
1146516097 17:33490677-33490699 GACTCACAGTTCCACGTGGCTGG - Intronic
1146556024 17:33824837-33824859 GACTCACAGCTCCACATGGCTGG - Intronic
1146633079 17:34484590-34484612 GCCCCACTGCAGCACGGGGCTGG - Intergenic
1146663900 17:34683855-34683877 GACCCACAGTTCCACGTGGCTGG + Intergenic
1146927446 17:36754736-36754758 GCCACAGAGCTCCACGGAGCAGG - Intergenic
1147834170 17:43318162-43318184 GACTCACAGTTCCACGTGGCTGG + Intergenic
1147948502 17:44093746-44093768 CCCCCGTAGCTCCACAGGGCTGG + Exonic
1148890492 17:50803512-50803534 GCCTCACAGGTGCAGGGGGCAGG - Intergenic
1149210487 17:54294740-54294762 GACTCACAGTTCCACGTGGCTGG - Intergenic
1149222503 17:54431833-54431855 GCCTCACAGTTCCACATGGCTGG + Intergenic
1149284976 17:55152511-55152533 GACTCACAGTTCCACGTGGCTGG + Intronic
1149308973 17:55375945-55375967 GACTCACAGTTCCACGTGGCTGG + Intergenic
1149325131 17:55522427-55522449 GACTCACAGTTCCACGTGGCTGG + Intergenic
1149342131 17:55698157-55698179 GACTCACAGTTCCACGTGGCTGG + Intergenic
1149518573 17:57300680-57300702 GACTCACAGTTCCACGTGGCTGG + Intronic
1149961878 17:61118540-61118562 GCCCAACACCTCCACAGGGGTGG - Intronic
1150159911 17:62887940-62887962 GACTCACAGTTCCACGTGGCTGG - Intergenic
1150329868 17:64286093-64286115 GACTCACAGTTCCACGTGGCTGG - Intergenic
1150474758 17:65466561-65466583 GACTCACAGTTCCACAGGGCTGG + Intergenic
1150622096 17:66815274-66815296 GACTCACAGTTCCACGTGGCTGG + Intergenic
1150649765 17:67002123-67002145 GACTCACAGTTCCACGTGGCTGG + Intronic
1150928905 17:69563455-69563477 GACTCACAGTTCCACGTGGCTGG - Intergenic
1150978164 17:70111867-70111889 GGCTCACAGTTCCACGTGGCTGG - Intronic
1151060382 17:71085174-71085196 GACTCACAGCTCCACATGGCTGG - Intergenic
1151084810 17:71367916-71367938 GGATCACAGCTCCACGTGGCTGG + Intergenic
1151092931 17:71463136-71463158 GACTCACAGTTCCACGTGGCTGG - Intergenic
1151211500 17:72547875-72547897 GACTCACAGTTCCACGTGGCTGG + Intergenic
1151433636 17:74081146-74081168 GCCCCACAGCACCTCGGGGTGGG + Intergenic
1151981671 17:77514813-77514835 GACTCACAGTTCCACGTGGCTGG + Intergenic
1152160718 17:78666988-78667010 GACTCACAGTTCCACGTGGCTGG + Intergenic
1152183533 17:78840341-78840363 GCCGCAGAGCTCAGCGGGGCGGG - Intronic
1152545404 17:80997837-80997859 GCCGCACAGCACCAGGGCGCCGG - Intronic
1153076142 18:1164332-1164354 GACTCACAGTTCCACGTGGCTGG + Intergenic
1153124577 18:1775684-1775706 GACTCACAGTTCCACGTGGCTGG + Intergenic
1153267312 18:3284060-3284082 GCCCCTCCCCTCCACAGGGCAGG - Intergenic
1153272166 18:3333587-3333609 GACTCACAGTTCCACGTGGCTGG + Intergenic
1153376144 18:4381866-4381888 GACTCACAGTTCCACGTGGCTGG + Intronic
1153756997 18:8294315-8294337 GATGCACAGCTCCACAGGGCTGG + Intronic
1153774484 18:8440670-8440692 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1154059918 18:11049799-11049821 GACTCACAGTTCCACGTGGCTGG - Intronic
1155192124 18:23439245-23439267 GACTCACAGTTCCACGGGGCTGG - Intergenic
1155523408 18:26691706-26691728 GACTCACAGTTCCACAGGGCTGG - Intergenic
1155617345 18:27737598-27737620 GACCCACAGTTCCACATGGCTGG + Intergenic
1155957431 18:31965628-31965650 GACTCACAGTTCCACAGGGCTGG + Intergenic
1156006917 18:32453064-32453086 GACTCACAGCTCCACGTGGCTGG + Intronic
1156266033 18:35489325-35489347 GACTCACAGTTCCACGTGGCTGG + Exonic
1156507324 18:37606178-37606200 GACTCACAGTTCCACGTGGCTGG - Intergenic
1156741774 18:40339486-40339508 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1156749670 18:40436288-40436310 GCCTCACAGTTCCACGTGGCTGG - Intergenic
1156883990 18:42112994-42113016 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1157142709 18:45126626-45126648 GACTCACAGTTCCACGTGGCTGG - Intergenic
1157505435 18:48222948-48222970 GCCACACAGCTCCAGGGGCAGGG - Intronic
1157815916 18:50729497-50729519 GCCCCCCACGGCCACGGGGCTGG + Exonic
1158108869 18:53917496-53917518 GACTCACAGTTCCACGTGGCTGG - Intergenic
1158123954 18:54081793-54081815 GACTCACAGTTCCACAGGGCTGG - Intergenic
1158264161 18:55641328-55641350 GACTCACAGTTCCACGTGGCTGG + Intronic
1158272805 18:55734632-55734654 GACTCACAGTTCCACGTGGCTGG - Intergenic
1158298632 18:56027790-56027812 GACTCACAGTTCCACGTGGCTGG + Intergenic
1158488721 18:57891201-57891223 GACTCACAGTTCCACGTGGCTGG - Intergenic
1158732359 18:60038068-60038090 GACTCACAGTTCCACGTGGCTGG + Intergenic
1158855577 18:61540424-61540446 GACTCACAGTTCCACGTGGCTGG + Intronic
1158879958 18:61768553-61768575 GACTCACAGCTCCACATGGCTGG - Intergenic
1159248468 18:65840715-65840737 GACTCACAGTTCCACGTGGCTGG - Intronic
1159424664 18:68269670-68269692 GACTCACAGTTCCACGTGGCTGG - Intergenic
1159618012 18:70604072-70604094 GACTCACAGTTCCACGTGGCTGG + Intergenic
1159640515 18:70858572-70858594 GACTCACAGTTCCACAGGGCTGG - Intergenic
1159643659 18:70892089-70892111 GACTCACAGTTCCACGTGGCTGG - Intergenic
1159705311 18:71678947-71678969 GACTCACAGTTCCACGTGGCTGG - Intergenic
1159718491 18:71855642-71855664 GCCTCACAGTTCCACATGGCAGG + Intergenic
1159751160 18:72303973-72303995 GACTCACAGTTCCACGTGGCTGG + Intergenic
1159939350 18:74394799-74394821 GACTCACAGCTCCACATGGCTGG + Intergenic
1160010497 18:75104093-75104115 GCCTCACAGTTCCACGTGGCAGG + Intergenic
1160187089 18:76684375-76684397 GCCCCACGGCTCCTCCTGGCAGG + Intergenic
1160294799 18:77628169-77628191 GACTCACAGCTCCACATGGCTGG + Intergenic
1160327882 18:77967453-77967475 GCCCCACAGCACCACGAGCTTGG + Intergenic
1160342033 18:78097577-78097599 GACTCACAGCTCCACATGGCTGG + Intergenic
1160581013 18:79884572-79884594 GCTCCCCAGGCCCACGGGGCAGG + Intronic
1160820003 19:1053518-1053540 GCCTCACACCTCCTCGAGGCTGG - Exonic
1161076719 19:2289515-2289537 GCCCCACAGCCCCAAGGGGAGGG - Intronic
1161326458 19:3666350-3666372 GCCACTCGGCGCCACGGGGCTGG + Intronic
1161329435 19:3679250-3679272 GCCCCCAAGCTCCAGTGGGCCGG + Intronic
1161424854 19:4198032-4198054 GCCTCGCACCTCCACGCGGCCGG - Intronic
1161450595 19:4343513-4343535 GCCCCTCCCCTCCCCGGGGCGGG + Exonic
1161507385 19:4651125-4651147 ACCCCACAGCTCCATGAGGTGGG - Intronic
1161525507 19:4752523-4752545 GCCCCACACCTGCTCAGGGCCGG + Intergenic
1161553839 19:4929305-4929327 CCCCCACAGCACCAAGGAGCGGG + Exonic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1162138555 19:8571288-8571310 GCCCCAGAGCCCCACTGAGCTGG - Intronic
1162146884 19:8617869-8617891 GCCCCAAAACTGCATGGGGCAGG - Intergenic
1162246234 19:9403940-9403962 GACTCACAGTTCCACGTGGCTGG + Intergenic
1162739273 19:12764933-12764955 GCCCATCAGCTCCACGCTGCTGG + Intronic
1163076969 19:14902232-14902254 GACTCACAGTTCCACGTGGCTGG + Intergenic
1163417482 19:17195347-17195369 CCGCCACAGTTCCACGGCGCTGG - Exonic
1163472608 19:17506052-17506074 GCCCCACCACTCCAGGGGCCAGG - Exonic
1163503306 19:17688479-17688501 GCCCCACACCTCCTCGTTGCAGG + Intergenic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1164530491 19:29044609-29044631 GACTCACAGTTCCACGTGGCTGG + Intergenic
1164892871 19:31839914-31839936 GACTCACAGTTCCATGGGGCTGG + Intergenic
1165025354 19:32957017-32957039 GTCCCACAGCTCAAAGGGGAAGG - Intronic
1165172728 19:33905655-33905677 CCCCGACAGCTCCGCGGGGTGGG - Intergenic
1165371586 19:35410687-35410709 GACTCACAGTTCCACGGGGCTGG + Intergenic
1165725365 19:38109190-38109212 GACTCACAGCTCCACATGGCTGG + Intronic
1165757916 19:38304836-38304858 GCCCCACAGTCCCACGCTGCTGG + Exonic
1166090921 19:40508357-40508379 GCCCCACAGCTCCCCATGGTGGG - Intronic
1166945184 19:46391872-46391894 TCCACACAGCTCCACGGGAGAGG - Intronic
1166967532 19:46538800-46538822 GACTCACAGTTCCACGTGGCTGG + Intronic
1166983277 19:46644435-46644457 GACTCACAGTTCCACGTGGCTGG - Intergenic
1167095928 19:47375169-47375191 GCCCCCCAGACCCAAGGGGCAGG + Intronic
1167195826 19:48027516-48027538 GCCTCACAGTTCCACGTGGCTGG - Intergenic
1167319195 19:48785465-48785487 GACTCACAGTTCCACAGGGCTGG + Intergenic
1167563677 19:50242355-50242377 GACTCACAGTTCCACGTGGCTGG + Intronic
1168121323 19:54254030-54254052 GCCCCTCACCCCCACGGGGTTGG - Exonic
1168242884 19:55096093-55096115 GCCCCCCAGCCCCACCAGGCCGG + Exonic
1168311812 19:55464492-55464514 GGCACACAGCTCCCGGGGGCCGG + Intergenic
1168372635 19:55849000-55849022 GACCCACAGTTCCATGTGGCTGG - Intronic
924991467 2:316217-316239 GACTCACAGTTCCACGTGGCTGG - Intergenic
925033525 2:670270-670292 GCTCCACAGCTGCACTGGGAAGG + Intronic
925036104 2:687021-687043 GACCCACAGTTCCACATGGCTGG - Intergenic
925151967 2:1621035-1621057 GACTCACAGTTCCACGTGGCTGG - Intergenic
925225143 2:2177577-2177599 GACTCACAGCTCCACATGGCTGG + Intronic
925295400 2:2773161-2773183 GACTCACAGTTCCACGTGGCTGG + Intergenic
925450154 2:3962253-3962275 GACTCACAGTTCCACGTGGCTGG - Intergenic
925536356 2:4922167-4922189 GACTCACAGTTCCACGTGGCTGG + Intergenic
925708719 2:6716129-6716151 GACTCACAGTTCCACAGGGCTGG - Intergenic
925718252 2:6804527-6804549 GACTCACAGTTCCACAGGGCTGG - Intergenic
925901299 2:8511155-8511177 TCCCCACAGCTGCAGGGGGCAGG - Intergenic
925963116 2:9037599-9037621 GACTCACAGCTCCACATGGCTGG + Intergenic
926295333 2:11564829-11564851 GACCCACAGTTCCACGTGGCTGG + Intronic
926304148 2:11625869-11625891 GACTCACAGTTCCACGTGGCTGG + Intronic
926340970 2:11904059-11904081 GCCTCACAGTTCCACATGGCTGG - Intergenic
926519948 2:13897887-13897909 TTCTCACAGCTCCACTGGGCAGG - Intergenic
926826528 2:16911817-16911839 GACTCACAGCTCCACATGGCTGG + Intergenic
926979231 2:18549464-18549486 GACTCACAGTTCCACGTGGCTGG - Intergenic
927063481 2:19446185-19446207 GACTCACAGCTCCATGTGGCTGG - Intergenic
927175593 2:20404670-20404692 GACTCACAGCTCCACATGGCTGG + Intergenic
927255841 2:21040211-21040233 GACTCACAGTTCCACGTGGCTGG - Intronic
927376168 2:22417259-22417281 GTCTCACAGTTCCACGTGGCTGG + Intergenic
927949887 2:27160231-27160253 GACTCACAGTTCCACAGGGCCGG + Intergenic
928324198 2:30306950-30306972 GACTCACAGTTCCACGTGGCTGG - Intronic
928387753 2:30884456-30884478 GACCCACAGCTCTGCAGGGCTGG - Intergenic
928474746 2:31615066-31615088 GACTCACAGTTCCACGTGGCTGG - Intergenic
928771724 2:34709927-34709949 GACTCACAGTTCCACGTGGCTGG - Intergenic
929070935 2:38029848-38029870 GACTCACAGTTCCACGTGGCTGG + Intronic
929337808 2:40771926-40771948 GGCTCACAGTTCCACAGGGCTGG - Intergenic
929775732 2:44929568-44929590 GCCCCGCGGCTCAGCGGGGCGGG - Intergenic
930427970 2:51235101-51235123 GACTCACAGTTCCACAGGGCTGG + Intergenic
930436963 2:51356532-51356554 GACTCACAGCTCCACATGGCTGG - Intergenic
930440802 2:51403224-51403246 GACTCACAGTTCCACGTGGCTGG + Intergenic
931153996 2:59607247-59607269 GACTCACAGTTCCACGTGGCTGG - Intergenic
931176563 2:59860690-59860712 GACTCACAGTTCCACAGGGCTGG + Intergenic
931265736 2:60658473-60658495 GACTCACAGCTCCACGTGGCTGG - Intergenic
931604136 2:64034684-64034706 GACTCACAGTTCCACAGGGCTGG - Intergenic
932337038 2:70937468-70937490 TCCCCCGAGCTCCATGGGGCAGG - Intronic
932711694 2:74070239-74070261 GACTCACAGTTCCACGTGGCTGG + Intronic
933051775 2:77610513-77610535 GACTCACAGTTCCACGTGGCTGG + Intergenic
933723684 2:85414030-85414052 GCCGCGCACCTCCAGGGGGCGGG - Intronic
933751047 2:85602369-85602391 TCGCCACCGCTCCACTGGGCCGG - Exonic
934054866 2:88243081-88243103 GACCTACAGTTCCACGTGGCTGG - Intergenic
934081920 2:88475903-88475925 GACTCACAGTTCCACGTGGCTGG - Intergenic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
934992066 2:98928950-98928972 GCCACACCTCTCCATGGGGCTGG - Intronic
935474918 2:103507225-103507247 GACTCACAGTTCCACAGGGCTGG - Intergenic
935497706 2:103802257-103802279 GACTCACAGTTCCACGTGGCTGG - Intergenic
936383884 2:112011868-112011890 GCAGCTCAGCTCCATGGGGCAGG - Intronic
936429557 2:112450413-112450435 GACTCACAGTTCCACAGGGCTGG - Intergenic
937702790 2:124882775-124882797 GACTCACAGTTCCACGTGGCTGG + Intronic
938380979 2:130836661-130836683 GCCCAAGAGCTCGACTGGGCGGG + Intergenic
939098377 2:137863673-137863695 GACTCACAGTTCCACGTGGCTGG - Intergenic
939131029 2:138236437-138236459 GACTCACAGTTCCACAGGGCTGG - Intergenic
939187329 2:138876762-138876784 GACTCACAGTTCCACGTGGCTGG + Intergenic
939629403 2:144515909-144515931 GCCCCAGAGCTGCGCGGCGCGGG - Intronic
939740591 2:145901387-145901409 GACCCACAGTTCCACACGGCTGG - Intergenic
939757856 2:146136640-146136662 GACTCACAGCTCCATGTGGCTGG + Intergenic
939760126 2:146165471-146165493 GGCTCACAGTTCCACAGGGCTGG + Intergenic
940082969 2:149825577-149825599 GACTCACAGTTCCACAGGGCTGG - Intergenic
940148349 2:150572156-150572178 GACTCACAGTTCCACGTGGCTGG + Intergenic
940699394 2:157022776-157022798 GCCTCACAGTTCCACATGGCTGG - Intergenic
940965625 2:159833937-159833959 GCCTCACAGTTCCACATGGCTGG - Intronic
941121032 2:161530439-161530461 GACTCACAGCTCCACATGGCTGG - Intronic
941452112 2:165672342-165672364 GACTCACAGTTCCACGTGGCTGG + Intronic
941509614 2:166389502-166389524 GACACACAGTTCCACGTGGCTGG + Intergenic
942395448 2:175542824-175542846 GACTCACAGTTCCACGTGGCTGG + Intergenic
942684975 2:178521874-178521896 GACTCACAGTTCCACGTGGCTGG + Intergenic
942817328 2:180067294-180067316 GACTTACAGCTCCACGTGGCTGG + Intergenic
942885376 2:180916892-180916914 GGCTCACAGTTCCACGTGGCTGG - Intergenic
943158191 2:184212133-184212155 GACTCACAGTTCCACAGGGCTGG - Intergenic
943237918 2:185346786-185346808 GCATCACAGTTCCACGTGGCTGG - Intergenic
943488682 2:188521462-188521484 GACTCACAGTTCCACGGGGCTGG + Intronic
943559872 2:189448112-189448134 GACTCACAGTTCCACGTGGCTGG - Intronic
943571799 2:189582052-189582074 GCCCCAAAGGTCTACGGGGTGGG + Intronic
943576817 2:189639825-189639847 GACTCACAGTTCCACGTGGCTGG + Intergenic
944475134 2:200095776-200095798 GACTCACAGTTCCACAGGGCTGG - Intergenic
944880318 2:204006776-204006798 GACTCACAGTTCCACGTGGCTGG + Intergenic
944957895 2:204833726-204833748 GACTCACAGTTCCACGTGGCTGG - Intronic
945114221 2:206394845-206394867 GACTCACAGTTCCACGTGGCTGG - Intergenic
945237033 2:207640573-207640595 GACTCACAGTTCCACAGGGCTGG + Intergenic
945480193 2:210336403-210336425 GACCTACAGTTCCACGTGGCTGG - Intergenic
945739351 2:213641810-213641832 GCCTCACAGTTCCACATGGCTGG + Intronic
946031500 2:216708582-216708604 GCCCCACACCTCCCAGGAGCTGG - Intergenic
946120428 2:217508120-217508142 GACTCACAGTTCCACAGGGCTGG + Intronic
946169903 2:217888762-217888784 GACTCACAGTTCCACGTGGCTGG - Intronic
946228376 2:218276906-218276928 GCCCCAAAGGTCCCCGGGGCAGG - Intronic
946373828 2:219296637-219296659 GCCCCACCACTCCAGGGGGTTGG + Intronic
946558545 2:220887106-220887128 GACTCACAGCTCCACCTGGCTGG + Intergenic
946600461 2:221354969-221354991 GACTCACAGTTCCACGTGGCTGG + Intergenic
946910670 2:224457514-224457536 GACTCACAGTTCCACGTGGCCGG + Intergenic
946965600 2:225034191-225034213 GCCTCCCAGCTCCACCAGGCAGG - Intronic
947161230 2:227217064-227217086 GACTCACAGCTCCACATGGCTGG + Intronic
947376990 2:229506170-229506192 GACTCACAGTTCCACAGGGCTGG + Intronic
947564694 2:231186254-231186276 GACACACAGATCCACAGGGCCGG - Intergenic
947819321 2:233059514-233059536 ACCCCAAAGCCCCACAGGGCAGG - Intergenic
947825007 2:233099869-233099891 GACTCACAGTTCCACGTGGCTGG + Intronic
947934023 2:233987939-233987961 GACTCACAGTTCCACGTGGCTGG - Intronic
948009285 2:234637682-234637704 GACTCACAGTTCCACAGGGCTGG - Intergenic
948066107 2:235081574-235081596 GACTCACAGTTCCACGTGGCTGG - Intergenic
948111167 2:235456992-235457014 GACTCACAGTTCCACGTGGCTGG - Intergenic
948219946 2:236261751-236261773 GACTCACAGTTCCACGTGGCTGG + Intronic
948310697 2:236983732-236983754 GACTCACAGTTCCACGTGGCTGG - Intergenic
948791232 2:240377915-240377937 GCCCGACCGCTCCCCAGGGCTGG - Intergenic
948903786 2:240968406-240968428 GCCCCAGGGCCCCACCGGGCTGG - Intronic
1169162764 20:3396116-3396138 GACTCACAGTTCCACGTGGCTGG - Intronic
1169399122 20:5264914-5264936 ACCCCAGAGCACCACAGGGCAGG + Intergenic
1169704370 20:8485946-8485968 GACTCACAGTTCCACAGGGCTGG + Intronic
1169985061 20:11435111-11435133 GACTCACAGTTCCACGTGGCTGG + Intergenic
1170018124 20:11806059-11806081 GACCCACAGTGCCACGTGGCTGG + Intergenic
1170079156 20:12451756-12451778 GACCTACAGTTCCACGTGGCTGG - Intergenic
1170100236 20:12691155-12691177 GACTCACAGTTCCACGTGGCTGG + Intergenic
1170138804 20:13104486-13104508 GACTTACAGCTCCACGTGGCTGG - Intronic
1170153984 20:13253021-13253043 GCCACACAGGTCCATGGGGAAGG - Intronic
1170449393 20:16466632-16466654 GACTCACAGTTCCACGTGGCTGG - Intronic
1170578134 20:17680256-17680278 GCCCCCCAGCTGCACAGGGCGGG + Intronic
1172061522 20:32190155-32190177 GCCCCCCAGCTTCTCGGGCCCGG + Intergenic
1173008825 20:39162318-39162340 GACTCACAGCTCCACATGGCTGG - Intergenic
1173075719 20:39817588-39817610 GACTCACAGCTCCACATGGCTGG + Intergenic
1173254412 20:41383731-41383753 GACTCACAGTTCCACGTGGCTGG - Intergenic
1173392710 20:42649137-42649159 GACTCACAGTTCCACGTGGCTGG + Intronic
1173566462 20:44042085-44042107 GACTCACAGTTCCACAGGGCTGG + Intronic
1173577222 20:44120294-44120316 GCCCCACAGTTGCACGTGACAGG + Intronic
1173674909 20:44825237-44825259 GACTCACAGTTCCACGTGGCTGG + Intergenic
1174108437 20:48179986-48180008 GACCCACAGTTCCACATGGCTGG - Intergenic
1174116985 20:48232973-48232995 GACTCACAGTTCCACGTGGCTGG - Intergenic
1174685757 20:52453301-52453323 GACTCACAGTTCCACAGGGCTGG - Intergenic
1174709135 20:52686634-52686656 GACCCACAGTTCCACGTGGCTGG + Intergenic
1174873549 20:54205420-54205442 GACTCACAGTTCCACGTGGCTGG + Intergenic
1174896442 20:54454309-54454331 GGCTCACAGCTCCATGTGGCTGG - Intergenic
1175050757 20:56153114-56153136 GACTCACAGTTCCACGTGGCTGG + Intergenic
1175268244 20:57715305-57715327 CCTCCACTGCTCCAGGGGGCAGG + Intergenic
1175691989 20:61072140-61072162 GACCCACAGTTCAACGTGGCTGG - Intergenic
1175745481 20:61454012-61454034 GACTCACAGTTCCACAGGGCTGG - Intronic
1175906209 20:62380847-62380869 TCCCCACACCTCCTGGGGGCTGG - Intergenic
1175926521 20:62474167-62474189 GCCTCACAGCCCCCTGGGGCCGG + Intronic
1175966891 20:62664358-62664380 GCCCCACTTCTCCCAGGGGCTGG + Intronic
1176030418 20:63008740-63008762 GCTCCACAGGTCCCCGGAGCTGG + Intergenic
1176109627 20:63405467-63405489 GGCCATCAGCTCCAGGGGGCAGG + Intergenic
1176201402 20:63862389-63862411 GCCCCACAGTTGGAAGGGGCTGG + Exonic
1176603930 21:8814477-8814499 GCCCCACCTCTCCGCGGCGCGGG + Intergenic
1176618913 21:9042154-9042176 GCCCCACCTCTCCACGGCGCGGG + Intergenic
1177059579 21:16353979-16354001 GACTCACAGTTCCACGTGGCTGG - Intergenic
1177084116 21:16680871-16680893 GACTCACAGTTCCACAGGGCTGG - Intergenic
1177114589 21:17070865-17070887 GACTCACAGTTCCACGTGGCTGG + Intergenic
1177208773 21:18043792-18043814 GACCCACAGTTCCACAGGGCTGG + Intronic
1177217289 21:18146603-18146625 GACCCACAGTTCCACATGGCTGG - Intronic
1177223125 21:18219197-18219219 GACTCACAGTTCCACAGGGCTGG + Intronic
1177450786 21:21262788-21262810 GACTCACAGTTCCACGTGGCTGG + Intronic
1177587381 21:23116058-23116080 GACTCACAGTTCCACGTGGCTGG + Intergenic
1177627234 21:23678481-23678503 GACTCACAGCTCCACATGGCTGG + Intergenic
1177632684 21:23747407-23747429 GACTCACAGCTCCACATGGCAGG + Intergenic
1177918569 21:27123106-27123128 GACTCACAGTTCCACGTGGCTGG + Intergenic
1178041397 21:28644134-28644156 GACCCACAGTTCCACATGGCTGG + Intergenic
1178052189 21:28759835-28759857 GACTCACAGTTCCACGTGGCTGG - Intergenic
1178056020 21:28799199-28799221 GACTCACAGTTCCACGTGGCTGG + Intergenic
1178082214 21:29077366-29077388 GCCCCTCAACTGCCCGGGGCCGG + Intergenic
1178098525 21:29240930-29240952 GACTCACAGTTCCACGTGGCTGG - Intronic
1178260348 21:31093954-31093976 GACTCACAGTTCCACGTGGCTGG - Intergenic
1178280723 21:31280435-31280457 GACTCACAGTTCCACGTGGCTGG - Intronic
1178338490 21:31765385-31765407 GACTCACAGTTCCACAGGGCTGG - Intergenic
1178379706 21:32097528-32097550 GACTCACAGTTCCACGTGGCTGG + Intergenic
1178404991 21:32316616-32316638 GCCCCTCAGCCCCACAGAGCCGG + Exonic
1179016442 21:37597799-37597821 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1179126989 21:38599354-38599376 GCCCCACAGCTCTCCATGGCAGG - Intronic
1179131427 21:38640666-38640688 GACTCACAGTTCCACGTGGCTGG - Intronic
1179161129 21:38900301-38900323 GACTCACAGTTCCACGTGGCTGG - Intergenic
1179176774 21:39013641-39013663 GACCCACGGTTCCACGTGGCTGG + Intergenic
1179237197 21:39558326-39558348 GACTCACAGTTCCACGTGGCTGG - Intronic
1179258488 21:39738178-39738200 GACTCACAGTTCCAGGGGGCTGG + Intergenic
1179350664 21:40607769-40607791 GACTCACAGTTCCACGTGGCTGG - Intronic
1179582230 21:42351239-42351261 GCCCCAGACCTGCACGTGGCCGG - Intergenic
1179944647 21:44664854-44664876 GGGCCACAGCTCCAGAGGGCGGG + Intronic
1180083676 21:45497977-45497999 CCCCCTCCCCTCCACGGGGCCGG + Intronic
1180218199 21:46340059-46340081 GACTCACAGTTCCACGTGGCTGG + Intronic
1180307558 22:11142178-11142200 GACTCACAGCTCCACATGGCTGG + Intergenic
1180346214 22:11706054-11706076 GCCCCACCTCTCCGCGGCGCGGG + Intergenic
1180546078 22:16504401-16504423 GACTCACAGCTCCACATGGCTGG + Intergenic
1180848386 22:18997205-18997227 CCCCTACAGTTCCATGGGGCAGG - Intergenic
1180942435 22:19668089-19668111 GCCTCACAGTTCCACGAGGCAGG + Intergenic
1181129485 22:20722119-20722141 GACTCACAGTTCCACGTGGCTGG - Intronic
1181456574 22:23063399-23063421 GCCTCAAAGCTGCAGGGGGCAGG - Intronic
1181876053 22:25941733-25941755 GCCCAAGACCTCCACGGGGCAGG - Intronic
1182277047 22:29196193-29196215 CCCTCACAGCTTCCCGGGGCTGG + Intergenic
1182505236 22:30777480-30777502 GACTTACAGCTCCACGTGGCTGG - Intronic
1182661627 22:31929210-31929232 GCACCACAGCAGCAAGGGGCAGG + Intergenic
1182838763 22:33366705-33366727 GACTCACAGTTCCACAGGGCTGG - Intronic
1183047381 22:35230955-35230977 GACTCACAGTTCCACGTGGCTGG + Intergenic
1183081693 22:35460829-35460851 GCCCTACAGCTGCTCGGGGAAGG + Intergenic
1184233737 22:43172062-43172084 GCCCCACAGCCCCACTGAGCTGG + Intronic
1184503203 22:44886107-44886129 GCTACACAGCTCCACGAGGCTGG + Intronic
1184653153 22:45928383-45928405 GCCCCACAGGTGCACAGGGTCGG + Intronic
1184697285 22:46147182-46147204 GCCCCACAGCTCCAGGGGGGTGG - Intergenic
1184862226 22:47179041-47179063 GACTCACAGTTCCACGTGGCTGG - Intergenic
1184936949 22:47731585-47731607 GACTCACAGTTCCACGTGGCTGG - Intergenic
1185003656 22:48262665-48262687 GCCCCACAGCTCCACCGTGGAGG + Intergenic
1185124420 22:48999390-48999412 GACTCACAGTTCCACGTGGCTGG + Intergenic
1185152424 22:49171938-49171960 GACTCACAGTTCCACGTGGCTGG + Intergenic
1185257728 22:49845370-49845392 GCACCCCAGCTCCCCAGGGCTGG - Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
1185333606 22:50262032-50262054 TCCCCACGGCTCCAGGGCGCAGG + Intergenic
949385861 3:3501690-3501712 GACTCACAGTTCCACGTGGCTGG - Intergenic
949413616 3:3793602-3793624 GACTCACAGTTCCACGTGGCTGG - Intronic
949796733 3:7859809-7859831 GACTCACAGCTCCACATGGCTGG + Intergenic
949828162 3:8184916-8184938 GACTCACAGTTCCACGTGGCTGG - Intergenic
949881169 3:8662030-8662052 GATCCACAGTTCCACGTGGCTGG - Intronic
950177191 3:10883032-10883054 GCCCCACAGCCCAAGGGGGCGGG + Intronic
950315088 3:11995101-11995123 GCCCCAGAGCTCCACAGAGCTGG - Intergenic
950589199 3:13923879-13923901 GGCTCACAGTTCCACAGGGCTGG - Intergenic
950673203 3:14539512-14539534 GCACCACAGCTCCAAGGGCAAGG - Intronic
950967646 3:17156978-17157000 GCCTCACATCACCACTGGGCAGG - Intergenic
951134957 3:19094540-19094562 GACTCACAGCTCCACATGGCTGG - Intergenic
951454329 3:22873654-22873676 GACTCACAGCTCCACATGGCTGG + Intergenic
951495292 3:23318531-23318553 GACTCACAGTTCCACGTGGCTGG + Intronic
952171510 3:30812375-30812397 GACTCACAGTTCCACGTGGCTGG + Intronic
953162079 3:40430250-40430272 GCCCTACAGCTGCAAGGAGCTGG + Intergenic
953436783 3:42883552-42883574 GACTCACAGTTCCACGTGGCTGG - Intronic
953459771 3:43073035-43073057 GCCCCACAGCTTCCCAGGGTGGG - Intergenic
953607183 3:44419681-44419703 GCCCATCAGCTCCACAGGGTGGG - Intergenic
954475275 3:50738344-50738366 GGCCCACAGTTTCATGGGGCAGG + Intronic
954498725 3:50989325-50989347 GCCCCAGAGCTACAGCGGGCAGG + Intronic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
954754050 3:52829493-52829515 ACCCTACAGCACCACAGGGCAGG + Intronic
955154333 3:56401906-56401928 GACCCACAGTTCCACATGGCTGG + Intronic
955466412 3:59242253-59242275 GACTCACAGTTCCACAGGGCTGG + Intergenic
955570173 3:60296113-60296135 GACTCACAGTTCCACGTGGCTGG - Intronic
956143283 3:66167070-66167092 GAGTCACAGCTCCACGTGGCTGG - Intronic
956169381 3:66420894-66420916 GACTCACAGTTCCACGTGGCTGG + Intronic
956388593 3:68747542-68747564 GACTCACAGTTCCACGTGGCTGG - Intronic
956714544 3:72067115-72067137 GACCCACAGTTCCACGTGGCTGG + Intergenic
957212416 3:77276776-77276798 GACCCACAGTTCCACATGGCTGG + Intronic
957261331 3:77905618-77905640 GACTCACAGTTCCACGTGGCTGG - Intergenic
957292149 3:78291967-78291989 GACTCACAGTTCCACGTGGCTGG + Intergenic
957442723 3:80271187-80271209 GACTCACAGTTCCACGTGGCTGG - Intergenic
957454753 3:80427005-80427027 GACTCACAGTTCCACGTGGCTGG - Intergenic
957476898 3:80737399-80737421 GACTCACAGTTCCACGTGGCTGG + Intergenic
957646404 3:82935857-82935879 GACCCACAGTTCCATGTGGCCGG + Intergenic
958018556 3:87970025-87970047 GACTCACAGTTCCACGTGGCCGG - Intergenic
958174235 3:89974775-89974797 GGCTCACAGTTCCACGTGGCTGG - Intergenic
958487088 3:94726468-94726490 GCCTCACAGTTCCACATGGCTGG - Intergenic
958507940 3:95005565-95005587 GACTCACAGCTCCACATGGCTGG + Intergenic
958557875 3:95703658-95703680 GACCCACAGTTCCACATGGCTGG + Intergenic
958604258 3:96338032-96338054 GACTCACAGTTCCACGTGGCTGG - Intergenic
958620905 3:96558468-96558490 GACTCACAGTTCCACGTGGCTGG + Intergenic
959095305 3:101949228-101949250 GACTCACAGTTCCACGTGGCTGG - Intergenic
959832094 3:110876054-110876076 GACTCACAGTTCCACGTGGCTGG - Intergenic
960398467 3:117166364-117166386 GACTCACAGTTCCACGTGGCTGG - Intergenic
960608625 3:119533712-119533734 GACTCACAGTTCCACGTGGCTGG - Intronic
961812133 3:129528002-129528024 GCCCCTGAGCTCCTCTGGGCAGG + Intergenic
961839289 3:129695453-129695475 GACTCACAGTTCCACAGGGCTGG + Intronic
961847503 3:129778848-129778870 GACTCACAGATCCACAGGGCTGG - Intronic
962281241 3:134053543-134053565 GACTCACAGCTCCACATGGCTGG - Intergenic
962411202 3:135143215-135143237 GGCCCACAACTCCATGGGGCTGG + Intronic
962460797 3:135610818-135610840 GACTCACAGGTCCACAGGGCTGG - Intergenic
962853525 3:139325351-139325373 GACTCACAGTTCCACGTGGCTGG + Intronic
963089005 3:141464474-141464496 GACTCACAGTTCCACAGGGCTGG + Intergenic
963306569 3:143660046-143660068 GACTCACAGCTCCACATGGCTGG - Intronic
963351743 3:144160186-144160208 GACCCACAGTTCCACATGGCTGG + Intergenic
963581695 3:147134318-147134340 GACTCACAGTTCCACGTGGCTGG + Intergenic
963671490 3:148257599-148257621 GGCTCACAGTTCCACAGGGCTGG - Intergenic
963914950 3:150850515-150850537 GACTCACAGTTCCGCGGGGCTGG - Intergenic
964025949 3:152074608-152074630 GACCCACAGTTCCACATGGCTGG + Intergenic
964358519 3:155871168-155871190 GCCCCACAGCGGCGCGGGGGAGG - Intronic
964588223 3:158330913-158330935 GACTCACAGCTCCATGTGGCTGG + Intronic
964687453 3:159412967-159412989 GGCTCACAGCTCCACATGGCTGG + Intronic
965045282 3:163570438-163570460 GACTCACAGTTCTACGGGGCTGG - Intergenic
965316049 3:167191653-167191675 GACTCACAGTTCCACGTGGCTGG - Intergenic
965394372 3:168143906-168143928 GACTCACAGTTCCACAGGGCTGG + Intergenic
966270255 3:178096397-178096419 GACTCACAGCTCCATGTGGCTGG - Intergenic
966341915 3:178934714-178934736 GACTCACAGTTCCACGTGGCTGG + Intergenic
967457103 3:189701128-189701150 GACTCACAGCTCCATGTGGCTGG - Intronic
967564921 3:190961786-190961808 GGCTCACAGTTCCACGTGGCTGG - Intergenic
967586542 3:191221193-191221215 GACTCACAGTTCCACAGGGCTGG - Intronic
967615543 3:191560956-191560978 GACTCACAGCTCCACATGGCTGG + Intergenic
967789064 3:193527727-193527749 GACTCACAGCTCCACATGGCTGG - Intronic
968078454 3:195830026-195830048 GCCCTCCAGCTCCTCTGGGCCGG + Intergenic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968531827 4:1096101-1096123 CCCCCACAGCTCCACGGTCTCGG + Intronic
968531840 4:1096160-1096182 CCCCCACAGCTCCACGGTCTCGG + Intronic
968531853 4:1096219-1096241 CCCCCACAGCTCCACGGTCTCGG + Intronic
968531866 4:1096278-1096300 CCCCCACAGCTCCACGGTCTCGG + Intronic
968531880 4:1096337-1096359 CCCCCACAGCTCCACGGTCTCGG + Intronic
968531893 4:1096396-1096418 CCCCCACAGCTCCACGGTCTCGG + Intronic
968531906 4:1096455-1096477 CCCCCACAGCTCCACGGTCTCGG + Intronic
969037426 4:4265951-4265973 GACTCACAGTTCCACGTGGCTGG - Intergenic
969073027 4:4555020-4555042 GACTCACAGTTCCACGTGGCTGG + Intergenic
969081764 4:4624621-4624643 GACTCATAGCTCCACGTGGCTGG + Intergenic
969222303 4:5769139-5769161 GACTCACAGTTCCACGTGGCTGG + Intronic
969498614 4:7540091-7540113 GCCCCACAGCACAAAGGGGGCGG - Intronic
969564158 4:7967811-7967833 TCCCCACAGCTCCAGGGTGTGGG - Intronic
969950656 4:10831733-10831755 GACTCACAGTTCCACAGGGCTGG - Intergenic
970026284 4:11627440-11627462 GACTCACAGTTCCACGTGGCTGG + Intergenic
970100866 4:12521066-12521088 GACTCACAACTCCACGTGGCTGG + Intergenic
970157107 4:13152691-13152713 GACTCACAGTTCCACGTGGCTGG + Intergenic
970157351 4:13154414-13154436 GACTCACAGTTCCACGTGGCTGG + Intergenic
970343191 4:15128223-15128245 GACTCACAGCTCCACATGGCTGG + Intergenic
970761696 4:19497192-19497214 GACTCATAGCTCCACGTGGCTGG - Intergenic
970991682 4:22220326-22220348 GACTCACAGTTCCACGTGGCTGG - Intergenic
971008080 4:22397826-22397848 GACCCACAGTTCCACATGGCTGG - Intronic
971262936 4:25073540-25073562 GACTCACAGTTCCACGTGGCTGG - Intergenic
971390518 4:26181080-26181102 GACTCACAGTTCCACGTGGCTGG - Intronic
971661905 4:29429503-29429525 GACTCACAGTTCCACGTGGCTGG + Intergenic
971833633 4:31732766-31732788 GACTCACAGTTCCACGTGGCTGG - Intergenic
972011057 4:34182778-34182800 GACCCACAGTTCCATGTGGCTGG + Intergenic
972275547 4:37554225-37554247 GACTCACAGTTCCACGTGGCTGG - Intronic
972434185 4:39015942-39015964 GACTCACAGTTCCACGTGGCTGG - Intronic
972744783 4:41922405-41922427 GACCCACAGTTCCATAGGGCTGG - Intergenic
972890630 4:43552661-43552683 GACTCACAGTTCCACAGGGCTGG - Intergenic
972910507 4:43810616-43810638 GACCCACAGCTCCACATGGCTGG + Intergenic
973294901 4:48507666-48507688 GCCCTACAGTTTCACTGGGCTGG + Intronic
973346642 4:49063248-49063270 GACTCACAGTTCCACAGGGCTGG + Intergenic
973374186 4:49276438-49276460 GCCCCACCTCTCCGCGGTGCGGG - Intergenic
973383226 4:49333801-49333823 GCCCCACCTCTCCGCGGTGCGGG + Intergenic
974062422 4:57047345-57047367 GACTCACAGCTCCATGAGGCTGG - Intronic
974074998 4:57160435-57160457 GACTCACAGTTCCACGCGGCTGG - Intergenic
974202113 4:58655810-58655832 GACTCACAGTTCCACGTGGCTGG - Intergenic
974219335 4:58946888-58946910 GACTCACAGTTCCACGTGGCTGG + Intergenic
974748300 4:66103838-66103860 GACTCACAGTTCCACGTGGCTGG - Intergenic
974845870 4:67350854-67350876 GACTCACAGTTCCACGTGGCTGG + Intergenic
974902215 4:68014540-68014562 GACTCACAGTTCCACGTGGCTGG - Intergenic
974960279 4:68691319-68691341 GACTCACAGTTCCACGTGGCTGG + Intergenic
975046372 4:69808733-69808755 GACTCACAGTTCCACGTGGCTGG - Intergenic
975419041 4:74140670-74140692 GACCCACAGTTCCACAGGGCCGG + Intronic
975525840 4:75350050-75350072 GACTCACAGTTCCACGAGGCTGG - Intergenic
975543472 4:75537553-75537575 GACTCACAGTTCCACGTGGCGGG - Intronic
976335364 4:83879144-83879166 GACTCACAGTTCCACGTGGCTGG - Intergenic
976395606 4:84551767-84551789 GACTCACAGTTCCACGTGGCTGG + Intergenic
976443059 4:85098843-85098865 GACTCACAGTTCCACGTGGCTGG + Intergenic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
976668565 4:87626985-87627007 GACTCACAGTTCCACGTGGCTGG + Intergenic
976726896 4:88223566-88223588 GACTCACAGTTCCACAGGGCTGG - Intronic
976853368 4:89575185-89575207 GACTCACAGTTCCACGTGGCTGG - Intergenic
976906620 4:90244534-90244556 GACTCACAGCTCCACATGGCTGG + Intronic
977039278 4:91994842-91994864 GACTCACAGCTCCACGTGGCTGG + Intergenic
977093752 4:92713629-92713651 GACCTACAGCTCCATGTGGCTGG + Intronic
977503788 4:97877461-97877483 GACTCACAGTTCCACGTGGCTGG + Intronic
977675709 4:99744619-99744641 GACTCACAGTTCCACGTGGCTGG + Intergenic
978571296 4:110140933-110140955 GACTCACAGTTCCACGTGGCTGG + Intronic
978735177 4:112076933-112076955 GCCCCACAGCATCTCAGGGCAGG - Intergenic
978948694 4:114529659-114529681 GACTCACAGTTCCACAGGGCTGG - Intergenic
978990693 4:115078516-115078538 GTTCCACAGATCCACAGGGCAGG - Intronic
979304710 4:119129276-119129298 GACTCACAGTTCCACGTGGCTGG - Intergenic
979368124 4:119849202-119849224 GACTCACAGTTCCACGTGGCTGG + Intergenic
979387640 4:120088185-120088207 GACTCACAGTTCCACGTGGCTGG + Intergenic
979548490 4:121964014-121964036 GACTCACAGTTCCACGTGGCTGG + Intergenic
980203801 4:129691625-129691647 GGCTCACAGTTCCACGTGGCTGG + Intergenic
980388434 4:132115733-132115755 GACTCACAGTTCCACGCGGCTGG - Intergenic
980553079 4:134365811-134365833 GACTTACAGTTCCACGGGGCTGG - Intergenic
980824523 4:138057493-138057515 GACTCACAGTTCCACGTGGCTGG - Intergenic
980955747 4:139427647-139427669 GACTCACAGTTCCACGTGGCTGG + Intergenic
981044412 4:140252707-140252729 GCCCCGCGGCTCCACCGGGAAGG + Intergenic
981679469 4:147379553-147379575 GACTCACAGTTCCACGTGGCTGG + Intergenic
981822136 4:148898709-148898731 GCTCCACAGATCTACAGGGCAGG + Intergenic
982320630 4:154073294-154073316 GACTCACAGTTCCACGTGGCTGG + Intergenic
982384121 4:154781570-154781592 CTCCCACTGCTCGACGGGGCTGG - Intronic
982795097 4:159635027-159635049 GACTCACAGCTCCACATGGCTGG + Intergenic
983786050 4:171730268-171730290 GACTCACAGCTCCACATGGCTGG - Intergenic
984565795 4:181328646-181328668 GACTCACAGCTCCACAGGGCTGG - Intergenic
984720539 4:182969091-182969113 GACTCACAGTTCCACGTGGCTGG + Intergenic
984756065 4:183326644-183326666 GACTTACAGCTCCACGTGGCTGG - Intergenic
985023342 4:185714617-185714639 GACTCACAGCTCCACATGGCTGG + Intronic
985100434 4:186452927-186452949 GACTCACAGTTCCACAGGGCTGG + Intronic
985220149 4:187695730-187695752 GACTCACAGCTCCACATGGCTGG - Intergenic
985308706 4:188573798-188573820 GACTCACAGTTCCACGTGGCTGG - Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985842794 5:2321232-2321254 GACACACAGCTCCACATGGCTGG - Intergenic
985844208 5:2332161-2332183 GACTCACAGTTCCACGTGGCTGG + Intergenic
986029653 5:3882409-3882431 GACTCACAGCTCCACATGGCTGG - Intergenic
986183482 5:5415853-5415875 GACTCACAGTTCCACAGGGCTGG - Intergenic
986223260 5:5789381-5789403 GACTCACAGTTCCACGTGGCTGG - Intergenic
986240079 5:5952771-5952793 GACTCACAGCTCCACGTGGCTGG - Intergenic
986310659 5:6548416-6548438 GACTCACAGTTCCACGTGGCTGG - Intergenic
986805402 5:11304063-11304085 GACTCACAGTTCCACGTGGCTGG - Intronic
986885933 5:12235823-12235845 GACCCACAGTTCCACATGGCTGG - Intergenic
987025805 5:13925491-13925513 GCCTTACAGTTCCACGTGGCTGG + Intronic
987035314 5:14013293-14013315 GCCCCAGATCTCCATGAGGCGGG + Intergenic
987056982 5:14202821-14202843 GACTCACAGCTCCACGTAGCTGG - Intronic
987207159 5:15639541-15639563 GACTCACAGTTCCACGTGGCTGG - Intronic
987236690 5:15950043-15950065 GACTCACAGTTCCACAGGGCTGG + Intergenic
987500023 5:18697824-18697846 GACTCACAGTTCCACGTGGCTGG + Intergenic
987794507 5:22608861-22608883 GACTCACAGTTCCACGTGGCTGG - Intronic
987896994 5:23959755-23959777 GACTCACAGTTCCACGTGGCTGG + Intronic
987940644 5:24531496-24531518 GACTCACAGCTCCACATGGCTGG + Intronic
988034067 5:25803253-25803275 GGCTCACAGTTCCACGTGGCTGG + Intergenic
988133331 5:27136132-27136154 GACTCACAGTTCCACGTGGCTGG + Intergenic
988204240 5:28114408-28114430 GACACACAGTTCCACGTGGCTGG + Intergenic
988307244 5:29507982-29508004 GCCTCACAGTTCCACATGGCTGG - Intergenic
988386002 5:30566096-30566118 GACTCACAGTTCCACGTGGCTGG + Intergenic
988507900 5:31839955-31839977 GGCTCACAGTTCCACGTGGCTGG - Intronic
988673461 5:33406888-33406910 GACTCACAGTTCCACGTGGCTGG - Intergenic
988953990 5:36295475-36295497 GACACACAGTTCCACAGGGCTGG - Intronic
989224727 5:39012367-39012389 GACTCACAGTTCCACAGGGCTGG - Intronic
989782868 5:45290211-45290233 GACTCACAGCTCCACATGGCTGG - Intronic
990080445 5:51906420-51906442 GACTCACAGTTCCACAGGGCTGG - Intergenic
990132866 5:52609238-52609260 GACTCACAGTTCCACGTGGCTGG - Intergenic
990336366 5:54776635-54776657 GACTCACAGCTCCACATGGCTGG + Intergenic
990393068 5:55347799-55347821 GACTCACAGTTCCACGTGGCTGG + Intronic
990448048 5:55911121-55911143 GACTCACAGTTCCACGTGGCTGG + Intronic
990594504 5:57299576-57299598 GACTCACAGTTCCACGTGGCTGG + Intergenic
990947803 5:61267345-61267367 GACTCACAGCTCCACGTGGCTGG - Intergenic
990999969 5:61772707-61772729 GACTCACAGCTCCACATGGCTGG - Intergenic
991006911 5:61836901-61836923 GACTCACAGTTCCACGTGGCTGG - Intergenic
991039344 5:62159747-62159769 GACTCACAGTTCCACGTGGCTGG - Intergenic
991126921 5:63080094-63080116 GACTCACAGTTCCACAGGGCTGG + Intergenic
991187656 5:63828991-63829013 GACTCACAGTTCCACAGGGCTGG - Intergenic
991189485 5:63852763-63852785 GACTCACAGTTCCACAGGGCTGG - Intergenic
991643197 5:68774840-68774862 GACTCACAGCTCCACGTGGCTGG - Intergenic
992778387 5:80107292-80107314 GACTCACAGTTCCACGTGGCTGG - Intergenic
992826414 5:80554083-80554105 GATTCACAGCTCCACGTGGCTGG - Intergenic
993090256 5:83416822-83416844 GACTCACAGTTCCACGTGGCTGG - Intergenic
993262800 5:85681919-85681941 GACCCACAGTTCCACATGGCTGG + Intergenic
993314286 5:86379832-86379854 GACTCACAGCTCCATGTGGCTGG - Intergenic
993741062 5:91540077-91540099 GACTCACAGTTCCACAGGGCTGG - Intergenic
994417004 5:99484769-99484791 GACTCACAGTTCCACGTGGCGGG - Intergenic
994462970 5:100090405-100090427 GACTCACAGTTCCACGTGGCTGG + Intergenic
994464646 5:100111510-100111532 GACTCACAGTTCCACGTGGCTGG + Intergenic
994831008 5:104784220-104784242 GACTCACAGTTCCACGTGGCTGG + Intergenic
995405150 5:111786302-111786324 GACTCACAGCTCCACATGGCTGG - Intronic
995996266 5:118304250-118304272 GACTCACAGTTCCACAGGGCTGG - Intergenic
996024751 5:118632316-118632338 GACTCACAGTTCCACGTGGCTGG - Intergenic
996082883 5:119274697-119274719 GCACCACAGGTACACAGGGCAGG - Intronic
996098015 5:119419710-119419732 GACTCACAGTTCCACGTGGCTGG - Intergenic
996774598 5:127120190-127120212 GACTCACAGTTCCACGTGGCTGG + Intergenic
996820255 5:127618981-127619003 GACTCACAGTTCCACGTGGCTGG + Intergenic
996861517 5:128072248-128072270 GACTCACAGTTCCACGTGGCTGG - Intergenic
996871552 5:128198660-128198682 GACCCACAGTTCCACATGGCTGG - Intergenic
997014731 5:129919472-129919494 GACTCACAGTTCCACGTGGCTGG + Intronic
997109392 5:131058338-131058360 GCCCCACAGCTCTCCTGGTCTGG + Intergenic
997712933 5:136021405-136021427 GACTCACAGTTCCACGTGGCTGG + Intergenic
998489772 5:142536472-142536494 GCACCCCAGCTCCACAGGGAGGG + Intergenic
999028600 5:148263880-148263902 GACTCACAGTTCCACGTGGCTGG + Intergenic
999540906 5:152571692-152571714 GACTCACAGTTCCACGTGGCTGG - Intergenic
1000238952 5:159391161-159391183 GACTCACAGTTCCACGTGGCTGG + Intergenic
1001642244 5:173252705-173252727 GACTCACAGTTCCACAGGGCTGG + Intergenic
1001795381 5:174498051-174498073 GACTCACAGTTCCACGTGGCTGG - Intergenic
1002961886 6:1923107-1923129 GACTCACAGTTCCACGTGGCTGG - Intronic
1003001047 6:2334101-2334123 GACTCACAGTTCCACGTGGCTGG + Intergenic
1003649214 6:7943150-7943172 GACTCACAGTTCCACGTGGCTGG - Intronic
1004249490 6:14011899-14011921 GACTCACAGTTCCACGTGGCTGG + Intergenic
1004467978 6:15903556-15903578 GACTCACAGTTCCACAGGGCTGG + Intergenic
1004522345 6:16373774-16373796 GACTCACAGTTCCACGTGGCTGG - Intronic
1004676198 6:17845040-17845062 GACTCACAGTTCCACGTGGCTGG + Intronic
1004895864 6:20147148-20147170 GACTCACAGTTCCACGTGGCTGG - Intronic
1006405800 6:33844070-33844092 GACTCACAGTTCCACGTGGCCGG - Intergenic
1006632134 6:35437116-35437138 ACCACACAGCTCCATGCGGCTGG + Intergenic
1007658505 6:43467603-43467625 GACTCACAGTTCCACGTGGCTGG - Intergenic
1007856742 6:44865483-44865505 GACTCACAGTTCCACGTGGCTGG + Intronic
1007915755 6:45560312-45560334 GACTCACAGTTCCACGTGGCTGG + Intronic
1007976988 6:46111972-46111994 GACCCACAATTCCACGTGGCTGG - Intergenic
1008060956 6:46996497-46996519 GGCCCACAGTTCCACATGGCTGG - Intergenic
1008242124 6:49126672-49126694 GACTCACAACTCCACGTGGCTGG - Intergenic
1008323655 6:50149629-50149651 GACTCACAGTTCCACAGGGCTGG - Intergenic
1009474772 6:64076686-64076708 GACTCACAGTTCCACGGGGCTGG - Intronic
1009577381 6:65483768-65483790 GACCTACAGTTCCACGTGGCTGG + Intronic
1009929483 6:70160169-70160191 GACCCACAGCTCCACGTGGCTGG + Intronic
1010032018 6:71281284-71281306 GACTCACAGTTCCACGTGGCTGG - Intergenic
1010347629 6:74830727-74830749 GGCCCACAGTTCCACGTGGCTGG + Intergenic
1010630051 6:78188722-78188744 GACTCACAGCTCCACATGGCTGG + Intergenic
1011347840 6:86390832-86390854 GACTCACAGCTCCACATGGCTGG - Intergenic
1013014993 6:106152778-106152800 GACTCACAGTTCCACGTGGCTGG - Intergenic
1013197851 6:107861454-107861476 GACTCACAGTTCCACGTGGCTGG + Intergenic
1013396771 6:109748685-109748707 GACTCACAGTTCCACGTGGCTGG + Intronic
1013819405 6:114136428-114136450 GACTCACAGCTCCACATGGCTGG - Intronic
1014022074 6:116602914-116602936 GACTCACAGTTCCACGTGGCTGG + Intergenic
1014249161 6:119098275-119098297 GACTCACAGTTCCACGTGGCTGG - Intronic
1014255505 6:119157082-119157104 GACCCTCAGCCCCAAGGGGCTGG - Intergenic
1014346074 6:120270929-120270951 GACTCACAGTTCCACGTGGCTGG - Intergenic
1014958221 6:127648570-127648592 GACTCACAGTTCCACAGGGCTGG - Intergenic
1014983860 6:127978496-127978518 GACTCACAGTTCCACAGGGCTGG - Intronic
1015516408 6:134086748-134086770 GACTCACAGTTCCACGTGGCTGG - Intergenic
1015549635 6:134398714-134398736 GACTCACAGTTCCACGTGGCTGG - Intergenic
1015694530 6:135965515-135965537 GGCCCACAGTTCCACATGGCTGG + Intronic
1015880791 6:137867994-137868016 GCCCCCCACCTCCGCCGGGCTGG - Intronic
1016001814 6:139049302-139049324 GACTCACAGTTCCACGTGGCAGG - Intergenic
1016134311 6:140520125-140520147 GACTTACAGCTCCACGTGGCTGG - Intergenic
1016150664 6:140738026-140738048 GACTCACAGTTCCACGTGGCTGG + Intergenic
1016285133 6:142463970-142463992 GACTCACAGTTCCACAGGGCTGG + Intergenic
1016337281 6:143020929-143020951 GACTCACAGTTCCACGTGGCTGG + Intergenic
1016439623 6:144069583-144069605 GACTCACAGCTCCACGTGGCTGG + Intergenic
1016474593 6:144413380-144413402 GACCCACAGTTCCACATGGCTGG + Intronic
1016510658 6:144839263-144839285 GGCCCACAGTTCCACCAGGCAGG + Exonic
1016683085 6:146852918-146852940 GACCCACAGTTCCACATGGCTGG - Intergenic
1016799018 6:148149803-148149825 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1016876191 6:148867719-148867741 GACTCACAGTTCCACGTGGCTGG - Intronic
1017278564 6:152598356-152598378 GGCTCACAGTTCCACGTGGCTGG - Intronic
1017316969 6:153042530-153042552 GACTCACAGTTCCACAGGGCTGG - Intronic
1017346639 6:153390894-153390916 GACTCACAGTTCCACGTGGCTGG - Intergenic
1017408961 6:154149161-154149183 GACTCACAGTTCCACGTGGCTGG + Intronic
1017500340 6:155017898-155017920 GCTTCACAGCCCCATGGGGCCGG - Intronic
1017724544 6:157267879-157267901 GCTGCCCAGCTCCACGGTGCTGG - Intergenic
1017790552 6:157794313-157794335 GACTCACAGTTCCACGTGGCTGG - Intronic
1018197679 6:161369018-161369040 GCCCCCCAGGTCCCTGGGGCTGG - Intronic
1018396751 6:163383683-163383705 GACTCACAGTTCCACGTGGCTGG - Intergenic
1018449771 6:163896789-163896811 GACTCACAGTTCCACGTGGCTGG - Intergenic
1018452468 6:163922030-163922052 GACTCACAGTTCCACGTGGCTGG + Intergenic
1018473896 6:164121847-164121869 GGCTCACAGTTCCACGGGGCTGG + Intergenic
1018527897 6:164734495-164734517 GACTCACAGTTCCACGTGGCTGG - Intergenic
1019148586 6:169989214-169989236 GCTGCAGAGGTCCACGGGGCAGG - Intergenic
1019539729 7:1546264-1546286 TTCCCACAGCCCCACGGTGCTGG + Exonic
1019628061 7:2031329-2031351 CCCCCACAGCTACACGTGGGTGG - Intronic
1019806541 7:3130549-3130571 GACTCACAGTTCCACGTGGCTGG + Intergenic
1019810685 7:3163048-3163070 GACTCACAGTTCCACGTGGCTGG - Intronic
1019952615 7:4385751-4385773 GACTCACAGTTCCACGTGGCTGG + Intergenic
1019970089 7:4533807-4533829 GACTCACAGTTCCACGTGGCTGG - Intergenic
1020389863 7:7646570-7646592 GACTCACAGTTCCACGTGGCTGG - Intronic
1020932600 7:14416700-14416722 GACTCACAGTTCCACGGGGCTGG - Intronic
1021612139 7:22467733-22467755 GACTCACAGTTCCACGTGGCTGG - Intronic
1021798801 7:24284349-24284371 GCCCCAGGGCTCCACAGAGCGGG - Intronic
1021883028 7:25112161-25112183 GACTCACAGTTCCACAGGGCTGG - Intergenic
1022217008 7:28273499-28273521 GACTCACAGTTCCACAGGGCTGG + Intergenic
1022580346 7:31547343-31547365 GACTCACAGTTCCACAGGGCTGG + Intronic
1022605627 7:31811279-31811301 GACTCACAGTTCCACGTGGCTGG - Intronic
1022820837 7:33959082-33959104 GACTCACAGTTCCACAGGGCTGG - Intronic
1022855735 7:34311572-34311594 GACTCACAGTTCCACAGGGCTGG - Intergenic
1022862671 7:34383898-34383920 GACTCACAGTTCCACGTGGCCGG - Intergenic
1022978105 7:35576901-35576923 GACTCACAGTTCCACGTGGCTGG + Intergenic
1023139930 7:37091744-37091766 GACTCACAGCACCACGTGGCTGG + Intronic
1023521910 7:41057808-41057830 GACTCACAGTTCCACAGGGCTGG - Intergenic
1023623770 7:42096792-42096814 GCCACAGAGCTCCAAGGGCCTGG + Intronic
1024184564 7:46936942-46936964 GACACACAGTTCCACGTGGCTGG - Intergenic
1024232646 7:47374378-47374400 CCCACACAGCTCCAAGTGGCAGG + Intronic
1024373268 7:48610375-48610397 GCCCCACAGAACCACAGGGGCGG - Intronic
1024415880 7:49106864-49106886 GACTCACAGTTCCACGTGGCTGG - Intergenic
1024449901 7:49527770-49527792 GTCCCACAGTTCCACAGGGCTGG + Intergenic
1024591808 7:50892924-50892946 GACTCACAGTTCCACAGGGCTGG + Intergenic
1026120696 7:67534404-67534426 GACTCACAGTTCCACGTGGCTGG - Intergenic
1026165133 7:67902925-67902947 GACTCACAGTTCCACGTGGCTGG + Intergenic
1026171111 7:67954747-67954769 GACCCACAGTTCCACGTGGCTGG + Intergenic
1026190766 7:68124208-68124230 GACTCACAGTTCCACGTGGCTGG - Intergenic
1026225647 7:68437700-68437722 GACTCACAGTTCCACGTGGCTGG - Intergenic
1026288992 7:68988826-68988848 GACTCACAGTTCCACGTGGCTGG - Intergenic
1026307410 7:69154097-69154119 GACTCACAGTTCCACGTGGCTGG + Intergenic
1026330792 7:69350976-69350998 GACTCACAGTTCCATGGGGCTGG + Intergenic
1026536566 7:71243258-71243280 GACTCACAGCTCCACATGGCTGG - Intronic
1026549155 7:71352275-71352297 GACTCACAGCTCCACATGGCTGG - Intronic
1026590808 7:71694035-71694057 GACTCACAGTTCCACGTGGCTGG + Intronic
1026671160 7:72391794-72391816 GACCCACAGTTCCATGTGGCTGG - Intronic
1026677002 7:72436420-72436442 GACTCACAGTTCCACGTGGCTGG - Intronic
1026800091 7:73394772-73394794 GACTCACAGTTCCACGTGGCTGG - Intergenic
1027279103 7:76592751-76592773 GCCTCAGAGTTCCACAGGGCTGG + Intergenic
1027581412 7:80001050-80001072 GACTCACAGTTCCACGTGGCTGG + Intergenic
1027604407 7:80283161-80283183 GACTCACAGCTCCACATGGCTGG - Intergenic
1028544173 7:91979234-91979256 GACTCACAGTTCCACGTGGCTGG + Intronic
1028613997 7:92744228-92744250 GACTCACAGCTCCACATGGCTGG + Intronic
1029036934 7:97532420-97532442 GCCTTACAGTTCCACGTGGCTGG + Intergenic
1029592628 7:101517395-101517417 GACTTACAGCTCCACGTGGCTGG + Intronic
1029610882 7:101625958-101625980 GTCCCAGAGCTCCACGAGGGAGG + Intronic
1029611302 7:101627909-101627931 GTCCCACAGCTCCAGAGGTCCGG - Intronic
1029984808 7:104913592-104913614 GACTCACAGTTCCACGTGGCTGG + Intergenic
1030329791 7:108259037-108259059 GCCCAACAGCCACATGGGGCTGG + Intronic
1030415641 7:109239252-109239274 GACTCACAGTTCCATGGGGCTGG - Intergenic
1030563403 7:111120280-111120302 GACTCACAGCTCCACATGGCTGG + Intronic
1031230042 7:119094931-119094953 GACTCACAGCTCCACATGGCTGG + Intergenic
1031240893 7:119238070-119238092 GACTCACAGTTCCACGTGGCTGG + Intergenic
1031379125 7:121062935-121062957 GACTCACAGTTCCACGTGGCTGG - Intronic
1031567821 7:123321682-123321704 GACTCACAGTTCCACGTGGCTGG + Intergenic
1031573255 7:123384485-123384507 GACTCACAGTTCCACGTGGCTGG - Intergenic
1031645770 7:124222952-124222974 GACTCACAGTTCCACGTGGCTGG - Intergenic
1031708998 7:125021618-125021640 GACGCACAGTTCCACGTGGCTGG - Intergenic
1032161650 7:129515507-129515529 GACTCACAGTTCCACGTGGCTGG - Intergenic
1032440241 7:131937188-131937210 GACCCACAGTTCCACATGGCTGG - Intergenic
1032459670 7:132101394-132101416 GACTCACAGTTCCACGTGGCTGG + Intergenic
1032594583 7:133226736-133226758 GACTCACAGTTCCACGTGGCTGG + Intergenic
1032892047 7:136207396-136207418 GACTCACAGCTCCACATGGCTGG - Intergenic
1033048398 7:137982660-137982682 GACTCACAGTTCCACGTGGCTGG - Intronic
1033224855 7:139553401-139553423 GACTCACAGTTCCACGTGGCTGG - Intergenic
1033270824 7:139931514-139931536 GACTCACAGTTCCACGTGGCTGG + Intronic
1033429996 7:141280554-141280576 GACTCACAGTTCCACGTGGCTGG - Intronic
1033803362 7:144926956-144926978 GACTCACAGTTCCACGTGGCTGG + Intergenic
1033948819 7:146758524-146758546 GACTCACAGTTCCACGTGGCTGG + Intronic
1033949218 7:146762708-146762730 GGCTCACAGTTCCACGTGGCTGG + Intronic
1033958284 7:146879866-146879888 GGCTCACAGTTCCACGTGGCTGG + Intronic
1034134865 7:148757744-148757766 GCTCAACAGTTCCACGTGGCTGG + Intronic
1034679904 7:152920722-152920744 GACTCACAGTTCCACGTGGCTGG + Intergenic
1034925211 7:155115788-155115810 GACTCACAGTTCCACGTGGCTGG + Intergenic
1034988821 7:155534693-155534715 CCCCCACAGCAGCAAGGGGCTGG + Intergenic
1035117605 7:156537600-156537622 GACTCACAGCTCCACGTGGCTGG - Intergenic
1035348141 7:158221543-158221565 GACCCACAGTTCCATGTGGCTGG + Intronic
1035365348 7:158345775-158345797 GACTCACAGTTCCACAGGGCTGG + Intronic
1035770843 8:2145614-2145636 GCCCCTCCGACCCACGGGGCTGG + Intronic
1035841646 8:2818130-2818152 GACTCACAGTTCCACGTGGCTGG - Intergenic
1035844155 8:2845084-2845106 GACTCACAGTTCCACGTGGCTGG - Intergenic
1035966966 8:4203294-4203316 GCCCCTCAACACCACGGGGTCGG + Intronic
1036087364 8:5626814-5626836 GACTCACAGTTCCACAGGGCTGG - Intergenic
1036380889 8:8235860-8235882 CTCCCACAGCACCACGGGTCTGG + Intergenic
1036753009 8:11455089-11455111 GCCCCAGTGCTGCACGTGGCAGG + Intronic
1036771475 8:11581376-11581398 GACTCACAGTTCCACGTGGCTGG + Intergenic
1037036047 8:14168613-14168635 GACTCACAGTTCCACGTGGCTGG - Intronic
1037107845 8:15131407-15131429 GACTCACAGTTCCACGTGGCTGG - Intronic
1037167801 8:15852042-15852064 GACTCACAGTTCCACGTGGCTGG - Intergenic
1037238470 8:16749731-16749753 GACTCACAGTTCCACGCGGCAGG - Intergenic
1037246128 8:16836983-16837005 GACTCACAGTTCCACGTGGCTGG - Intergenic
1037252151 8:16908361-16908383 GACTCACAGCTCCACAAGGCTGG + Intergenic
1037272159 8:17142113-17142135 GACTCACAGTTCCACGTGGCTGG + Intergenic
1037311257 8:17559292-17559314 GACTCACAGTTCCACAGGGCTGG + Intronic
1037452134 8:19025948-19025970 GACTCACAGTTCCACGTGGCTGG + Intronic
1037477900 8:19275724-19275746 GACTCACAGCTCCACATGGCTGG + Intergenic
1037494795 8:19428297-19428319 GCCTCACAGTTCCATGTGGCTGG + Intronic
1037503259 8:19505672-19505694 GGCCAACAGCCCCACGGGGAAGG - Exonic
1037595009 8:20347750-20347772 GCCTCACAGTTCCACGTGGCTGG + Intergenic
1037733400 8:21548182-21548204 GACTCACAGTTCCACGGGGCGGG + Intergenic
1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG + Intronic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1038018755 8:23535697-23535719 GACCCACAGTTCCACGTGGCTGG + Intronic
1038274423 8:26108515-26108537 GACTCACAGTTCCACGTGGCTGG - Intergenic
1038989134 8:32846919-32846941 GACTCACAGTTCCACAGGGCTGG + Intergenic
1039392520 8:37192903-37192925 GACTCACAGTTCCACGTGGCTGG - Intergenic
1039438885 8:37580903-37580925 GACTCACAGCTCCACATGGCTGG - Intergenic
1039547248 8:38419088-38419110 GACTCACAGTTCCACGTGGCTGG - Intronic
1039584379 8:38693698-38693720 GACTCACAGCTCCACCTGGCTGG - Intergenic
1039681020 8:39736495-39736517 GACTCACAGTTCCACGTGGCTGG - Intergenic
1039858685 8:41437919-41437941 GACCCACAGTTCCACGTGGCTGG - Intergenic
1040478178 8:47799293-47799315 GGCCCACAGCTCCAGGAGGGAGG + Exonic
1040982141 8:53254855-53254877 GCCCCACACCACCACGTGTCAGG - Intergenic
1041338730 8:56818159-56818181 GACTCACAGCTCCACATGGCTGG - Intergenic
1041593637 8:59620720-59620742 GACTCACAGCTCCACATGGCTGG + Intergenic
1042020575 8:64369409-64369431 GGCCCGCAGCTCCTCGCGGCCGG + Intergenic
1042489919 8:69385397-69385419 GACTCACAGTTCCATGGGGCTGG - Intergenic
1042606485 8:70551758-70551780 GACTCACAGTTCCACGTGGCTGG + Intergenic
1042650424 8:71034394-71034416 GACTCACAGCTCCACATGGCTGG - Intergenic
1043088089 8:75862063-75862085 GACTCACAGTTCCACGTGGCTGG - Intergenic
1043237120 8:77881924-77881946 GACTCACAGTTCCACAGGGCTGG + Intergenic
1043355979 8:79413194-79413216 GACTCACAGTTCCACGTGGCTGG - Intergenic
1043379599 8:79688557-79688579 GACTCACAGTTCCACGTGGCTGG + Intergenic
1043714577 8:83466238-83466260 GACTCACAGTTCCACAGGGCTGG - Intergenic
1043801030 8:84609829-84609851 GACTCACAGTTCCACGTGGCTGG + Intronic
1044045874 8:87431196-87431218 GACTCACAGTTCCACGTGGCTGG - Intronic
1044155143 8:88837195-88837217 GACTCACAGTTCCACGTGGCTGG + Intergenic
1044365673 8:91342365-91342387 CCACCACAGCTCTATGGGGCAGG + Intronic
1044514528 8:93122880-93122902 GACTCACAGTTCCACAGGGCTGG - Intergenic
1044565830 8:93660473-93660495 GACTCACAGTTCCACGTGGCAGG - Intergenic
1045194104 8:99912363-99912385 GACTCACAGTTCCACGTGGCTGG - Intergenic
1045849314 8:106674048-106674070 TTCTCACAGCTCCACTGGGCAGG - Intronic
1045864017 8:106844514-106844536 GACTCACAGTTCCACGTGGCTGG - Intergenic
1046391367 8:113577046-113577068 GACTCACAGTTCCACAGGGCTGG - Intergenic
1046717892 8:117587056-117587078 GGCTCACAGTTCCACGTGGCTGG - Intergenic
1046779490 8:118200154-118200176 GACTCACAGTTCCACGTGGCTGG - Intronic
1047080811 8:121458252-121458274 GACTCACAGTTCCACAGGGCTGG - Intergenic
1047239029 8:123068812-123068834 GACTCACAGTTCCACAGGGCTGG + Intronic
1047389207 8:124436532-124436554 GACTCACAGTTCCACGTGGCTGG - Intergenic
1047487851 8:125348763-125348785 GACTCACAGTTCCACGTGGCTGG - Intronic
1047535224 8:125713262-125713284 GACTCACAGTTCCACGTGGCTGG - Intergenic
1047650278 8:126913005-126913027 GACTCACAGTTCCACGTGGCTGG - Intergenic
1048030606 8:130628090-130628112 GACACACAGTTCCACGTGGCTGG - Intergenic
1048210607 8:132451276-132451298 GACTCACAGTTCCACGTGGCTGG - Intronic
1048266143 8:132988977-132988999 GACTCACAGCTCCATGTGGCTGG + Intronic
1048542610 8:135355985-135356007 GACTCACAGTTCCACGTGGCTGG - Intergenic
1048642282 8:136377202-136377224 GACCCACAGTTCCACCTGGCTGG + Intergenic
1048700428 8:137082432-137082454 GACTCACAGCTCCACATGGCTGG - Intergenic
1048776668 8:137954274-137954296 GGCTCACAGCTCCACAGGGCTGG + Intergenic
1048781426 8:138006317-138006339 GACTCACAGTTCCACAGGGCTGG - Intergenic
1048806694 8:138247541-138247563 GACTCACAGTTCCACAGGGCTGG - Intronic
1048864439 8:138749173-138749195 GACTCACAGTTCCATGGGGCTGG - Intronic
1048905291 8:139081970-139081992 GACTCACAGTTCCACGTGGCTGG + Intergenic
1048988163 8:139746475-139746497 GACCAACAGGTCCACGGGGTAGG + Intronic
1049223166 8:141437016-141437038 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223181 8:141437053-141437075 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223196 8:141437090-141437112 GACCCACAGCTCCCCATGGCGGG - Intergenic
1049223211 8:141437127-141437149 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223226 8:141437164-141437186 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223241 8:141437201-141437223 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223256 8:141437238-141437260 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049223271 8:141437275-141437297 GACCCACAGCTCCCCACGGCGGG - Intergenic
1049296261 8:141841291-141841313 GCCTCACAGTTCCACATGGCTGG - Intergenic
1050644499 9:7704229-7704251 GACTCACAGTTCCACGTGGCTGG + Intergenic
1050691884 9:8236581-8236603 GACTCACAGTTCCACGTGGCTGG - Intergenic
1051195554 9:14559693-14559715 GACTCACAGTTCCACAGGGCTGG - Intergenic
1051333575 9:16046788-16046810 GACTCACAGCTCCACGTGGCTGG - Intronic
1051658095 9:19401684-19401706 GACCCACAGTTCCACATGGCTGG - Intergenic
1051979623 9:22998234-22998256 GACCCACAGTTCCACATGGCTGG + Intergenic
1051990501 9:23146463-23146485 GGCTCACAGCTCCACATGGCTGG + Intergenic
1052179327 9:25505280-25505302 GCCCCACAGAACCACAGGGGTGG - Intergenic
1052217916 9:25989395-25989417 GACTCACAGCTCCACGTGGCTGG + Intergenic
1052271673 9:26634176-26634198 GACTCACAGTTCCACGTGGCTGG + Intergenic
1052387606 9:27840048-27840070 GACTCACAGCTCCACATGGCTGG - Intergenic
1052608724 9:30740477-30740499 GACTCACAGTTCCACGTGGCTGG - Intergenic
1052716683 9:32126562-32126584 GACTCACAGTTCCACGTGGCTGG + Intergenic
1052940140 9:34126451-34126473 GCCCCGCAGCCACATGGGGCGGG + Exonic
1052969546 9:34368937-34368959 AACTCACAGCTCCACGTGGCTGG + Exonic
1053149297 9:35732546-35732568 GTCCCACAGTGCCACGGGGTGGG + Exonic
1053486967 9:38466105-38466127 GACTCACAGTTCCACAGGGCTGG + Intergenic
1053811612 9:41858482-41858504 GACACACAGTTCCACGTGGCTGG - Intergenic
1054117420 9:61178813-61178835 GACTCACAGCTCCATGAGGCTGG - Intergenic
1054350746 9:64015634-64015656 GCCCCACCTCTCCACGGCGCGGG + Intergenic
1054461031 9:65462661-65462683 GACCCACAGCTCCGCGTCGCAGG - Intergenic
1054590335 9:67003753-67003775 GACTCACAGCTCCATGAGGCTGG + Intergenic
1054618982 9:67328957-67328979 GACACACAGTTCCACGTGGCTGG + Intergenic
1054745030 9:68845372-68845394 CCCCCACGGCTCCACGGCTCTGG - Intronic
1055006028 9:71507789-71507811 GACTCACAGTTCCACGTGGCTGG - Intergenic
1055252166 9:74320726-74320748 GACTCACAGTTCCACGTGGCTGG - Intergenic
1055335231 9:75226918-75226940 GTTCCACAGCTCCCCAGGGCAGG + Intergenic
1055534741 9:77228764-77228786 GACCAACAGCTCCACATGGCTGG + Intronic
1055814106 9:80185312-80185334 GCCCTCCTGCTCCACGGCGCCGG - Intergenic
1055910161 9:81341519-81341541 GACTCACAGTTCCACGTGGCTGG + Intergenic
1055931200 9:81561295-81561317 GACTCACAGTTCCACGTGGCTGG - Intergenic
1055950402 9:81724801-81724823 GGCACACAGCTGCACAGGGCAGG + Intergenic
1056092400 9:83217665-83217687 GACTCACAGTTCCACGTGGCTGG - Intergenic
1056238663 9:84621377-84621399 GACCTACAGTTCCACGTGGCTGG - Intergenic
1056822184 9:89851073-89851095 GCCCCACAGACCCCAGGGGCAGG + Intergenic
1057975836 9:99605183-99605205 GCCCCAGAGGTCCACGTGCCTGG - Intergenic
1058047972 9:100377274-100377296 GACTCACAGTTCCACGTGGCTGG - Intergenic
1058194794 9:101959273-101959295 GCTTCACAGTTCCACGTGGCTGG + Intergenic
1058568297 9:106310865-106310887 GACTCACAGCTCCACATGGCTGG - Intergenic
1058583832 9:106485851-106485873 GACTCACAGTTCCACGTGGCTGG - Intergenic
1059363513 9:113767019-113767041 GACTCACAGTTCCACGTGGCTGG - Intergenic
1059462637 9:114443856-114443878 GACTCACAGTTCCACGTGGCTGG + Intronic
1059549736 9:115216910-115216932 GACTCACAGTTCCACGTGGCTGG - Intronic
1059601305 9:115782397-115782419 GGCTCACAGCTCCACATGGCTGG - Intergenic
1059826066 9:118030314-118030336 GACCCACAGTTCCACATGGCTGG + Intergenic
1060187386 9:121572016-121572038 TTCACACAGCTCCAAGGGGCTGG - Intronic
1060476115 9:123988073-123988095 ACACCACAGCTGCCCGGGGCTGG - Intergenic
1060932602 9:127498181-127498203 GCCCCGGGGCTCCAGGGGGCTGG + Intronic
1060967221 9:127718005-127718027 GCTCAACAGTTCCACGTGGCTGG - Intronic
1060995271 9:127872222-127872244 GCCCCTGAGCTCCCCAGGGCAGG - Intronic
1061227268 9:129288024-129288046 ACACAACAGCTCCACGGGGAAGG + Intergenic
1061500162 9:130997416-130997438 GCCCCAAAGCTCCAGGCTGCAGG + Intergenic
1061538956 9:131267037-131267059 GCACCACACCTCCCTGGGGCCGG + Intronic
1061786399 9:133031049-133031071 CCGCCTCAGCTCCACGGGGACGG - Exonic
1061841292 9:133359836-133359858 GCCCCACAGCCCCACCGCCCTGG - Intronic
1061867491 9:133500487-133500509 GACTCACAGTTCCACAGGGCTGG - Intergenic
1061943039 9:133893254-133893276 GCCCCACAGCTGCAGGGTGGAGG + Intronic
1062030248 9:134358923-134358945 GGCCAACAGCCCCACGTGGCAGG + Intronic
1062127676 9:134872542-134872564 GACTCACAGTTCCACGTGGCTGG + Intergenic
1062223293 9:135432515-135432537 GACTCACAGTTCCACGTGGCTGG + Intergenic
1062251507 9:135598020-135598042 GACTCACAGTTCCACGTGGCTGG - Intergenic
1062430124 9:136523220-136523242 GCCTCACTGCTCCCCGAGGCCGG + Intronic
1062529789 9:136994789-136994811 GCCGCGCAGCTCCGCGGGGATGG + Exonic
1062566904 9:137167609-137167631 GCCCCGGAGCACCACGGGGTCGG + Intronic
1062632730 9:137472981-137473003 GACTCACAGTTCCACGTGGCTGG + Intronic
1203772988 EBV:58868-58890 GCCCCTCAGGACCACGGAGCTGG + Intergenic
1203551345 Un_KI270743v1:166637-166659 GCCCCACCTCTCCGCGGTGCGGG + Intergenic
1185674337 X:1836776-1836798 GACTCACAGTTCCACGTGGCTGG + Intergenic
1185719873 X:2373036-2373058 GACTCACAGTTCCACGGGGTTGG + Intronic
1185973653 X:4693910-4693932 GACTCACAGTTCCACGTGGCTGG + Intergenic
1185974277 X:4701598-4701620 GACTCACAGTTCCACGTGGCTGG - Intergenic
1186006381 X:5076877-5076899 GACTCACAGTTCCACGTGGCTGG - Intergenic
1186021802 X:5264560-5264582 GACTCACAGATCCACGTGGCTGG + Intergenic
1186146421 X:6628983-6629005 GACTCACAGCTCCACGTGGCTGG + Intergenic
1186167299 X:6840259-6840281 GACTCACAGTTCCACGTGGCTGG - Intergenic
1186172520 X:6892384-6892406 GACTCACAGTTCCACGTGGCTGG + Intergenic
1186196062 X:7111191-7111213 GACCCACAGTTCCACATGGCTGG - Intronic
1186197628 X:7125682-7125704 GACTCACAGTTCCACGTGGCTGG + Intronic
1186233691 X:7484192-7484214 GACTCACAGTTCCACGTGGCTGG + Intergenic
1186241896 X:7577168-7577190 GACGCACAGTTCCACGTGGCTGG - Intergenic
1186364103 X:8873673-8873695 GACTCACAGTTCCACGTGGCTGG - Intergenic
1186714124 X:12232288-12232310 GACTCACAGTTCCACAGGGCTGG + Intronic
1186751778 X:12628888-12628910 GCCTCACAGTTCCACATGGCTGG + Intronic
1186894949 X:13996393-13996415 GACCTACAGTTCCACGTGGCTGG + Intergenic
1187052477 X:15708293-15708315 GACTCACAGTTCCACGTGGCTGG - Intronic
1187110130 X:16289688-16289710 GACTCACAGTTCCACGTGGCTGG + Intergenic
1187388634 X:18871461-18871483 GACTCACAGTTCCACGTGGCTGG - Intergenic
1187484760 X:19693097-19693119 GCCCCACATCCCCATGGGACTGG + Intronic
1187615888 X:20992676-20992698 GACTCACAGTTCCACAGGGCTGG + Intergenic
1187768717 X:22671361-22671383 GACTCACAGTTCCACAGGGCTGG - Intergenic
1187836497 X:23437077-23437099 CCCCCACAGCCCCAGGGGCCTGG + Intergenic
1188041572 X:25375615-25375637 GACTCACAGTTCCACAGGGCTGG - Intergenic
1188048905 X:25460507-25460529 GACTCACAGCTCCACATGGCTGG + Intergenic
1188051852 X:25497411-25497433 GACTCACAGCTCCACATGGCTGG - Intergenic
1188103904 X:26125171-26125193 GACTCACAGTTCCACGTGGCTGG + Intergenic
1188171401 X:26932218-26932240 GACTCACAGCTCCATGTGGCTGG + Intergenic
1188261094 X:28024981-28025003 GACTCACAGTTCCACGTGGCTGG - Intergenic
1188520494 X:31033017-31033039 GACTCACAGTTCCACGTGGCTGG + Intergenic
1188761778 X:34041356-34041378 GACTCACAGCTCCACAGGACTGG - Intergenic
1188941099 X:36238350-36238372 GACACACAGCTCCATGTGGCTGG - Intronic
1189123920 X:38425453-38425475 GCCCCAGAACTCCACGTGGGTGG + Intronic
1189228529 X:39433779-39433801 GACTCACAGTTCCACGTGGCTGG + Intergenic
1189306376 X:39989811-39989833 GACTCACAGTTCCACAGGGCTGG - Intergenic
1189423600 X:40879257-40879279 GACCCACAGTTCCACATGGCTGG + Intergenic
1189671926 X:43420313-43420335 GACTCACAGTTCCACAGGGCTGG + Intergenic
1190164519 X:48061830-48061852 GACTCACAGTTCCACGGGGGTGG - Intronic
1190167709 X:48086792-48086814 GACTCACAGCTCCATGTGGCTGG - Intergenic
1190614843 X:52219951-52219973 GACTCACAGTTCCACAGGGCTGG + Intergenic
1191095227 X:56666271-56666293 GACTCACAGTTCCACAGGGCTGG - Intergenic
1191688076 X:63913098-63913120 GACTCACAGTTCCACGTGGCTGG - Intergenic
1192417193 X:70992368-70992390 GACTCACAGTTCCACGTGGCTGG + Intergenic
1193183392 X:78484390-78484412 GACTCACAGTTCCACGTGGCTGG + Intergenic
1193460148 X:81781390-81781412 GCCTCACAGTTCCACATGGCTGG + Intergenic
1193686375 X:84581167-84581189 GACTCACAGCTCCACCTGGCTGG - Intergenic
1193765368 X:85522106-85522128 GACTCACAGCTCCTCGTGGCTGG - Intergenic
1193845754 X:86467730-86467752 GACTCACAGTTCCACAGGGCTGG + Intronic
1193889445 X:87026837-87026859 GACTCACAGCTCCACATGGCTGG + Intergenic
1193938347 X:87650799-87650821 GACTCACAGTTCCACGTGGCTGG + Intronic
1194036284 X:88876267-88876289 GACTCACAGTTCCACGTGGCTGG - Intergenic
1194127211 X:90034393-90034415 GACCCACAGTTCCACATGGCTGG - Intergenic
1194503597 X:94707000-94707022 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1194744515 X:97613753-97613775 GCTCCATAGCTGCACGTGGCTGG + Intergenic
1194745949 X:97628372-97628394 GACCCACAGTTCCACACGGCTGG - Intergenic
1194755202 X:97731333-97731355 GACTCACAGTTCCACGTGGCTGG + Intergenic
1194838828 X:98714346-98714368 GACCCACAGTTCCATGTGGCTGG - Intergenic
1194952790 X:100146136-100146158 GACTCACAGTTCCACAGGGCTGG - Intergenic
1195121006 X:101752385-101752407 GACTCACAGTTCCACAGGGCTGG + Intergenic
1195353455 X:104015885-104015907 GACTCACAGTTCCACAGGGCTGG + Intergenic
1195629745 X:107042690-107042712 GACTCACAGTTCCACGTGGCTGG + Intergenic
1195816649 X:108895833-108895855 GACTCACAGCTCCACATGGCTGG - Intergenic
1196025385 X:111036394-111036416 GACTCACAGTTCCACGTGGCTGG + Intronic
1196207486 X:112957279-112957301 GACTCACAGTTCCACGTGGCTGG - Intergenic
1196930545 X:120677074-120677096 GACTCACAGTTCCACAGGGCTGG + Intergenic
1196995343 X:121376886-121376908 GACTCACAGCTCCACATGGCTGG + Intergenic
1197128279 X:122973099-122973121 GACTCACAGTTCCACAGGGCTGG - Intergenic
1197314033 X:124941839-124941861 GACTCACAGTTCCACGTGGCTGG + Intronic
1197341190 X:125267519-125267541 GACTCACAGCTCCACGTGGCTGG - Intergenic
1197442699 X:126511012-126511034 GACTCACAGTTCCACGTGGCTGG + Intergenic
1197484852 X:127036399-127036421 GACTCACAGCTCCACATGGCTGG + Intergenic
1198083646 X:133263100-133263122 GACTCACAGTTCCACGTGGCTGG + Intergenic
1198662915 X:138990501-138990523 GACTCACAGTTCCACGTGGCTGG + Intronic
1198836200 X:140807156-140807178 GACTCACAGTTCCACAGGGCAGG + Intergenic
1198852663 X:140982117-140982139 GCCTCACAGTTCCACATGGCTGG + Intergenic
1198860180 X:141060636-141060658 GACTCACAGCTCCACATGGCTGG - Intergenic
1198902511 X:141526754-141526776 GACTCACAGCTCCACATGGCTGG + Intergenic
1198941595 X:141963145-141963167 GACTCACAGTTCCACAGGGCTGG + Intergenic
1198948283 X:142039960-142039982 GACTCACAGCTCCACACGGCTGG - Intergenic
1199071060 X:143476149-143476171 GACTCACAGTTCCACGTGGCTGG - Intergenic
1199147582 X:144387538-144387560 GACTTACAGTTCCACGGGGCTGG + Intergenic
1199176209 X:144790790-144790812 GACTCACAGTTCCACGTGGCTGG + Intergenic
1199207049 X:145160956-145160978 GACTCACAGTTCCACAGGGCTGG + Intergenic
1199277984 X:145969025-145969047 GACCTACAGTTCCACGTGGCTGG - Intergenic
1199301570 X:146220157-146220179 GCCTCACAGTTCCACATGGCTGG + Intergenic
1199307556 X:146284714-146284736 GACTCACAGTTCCACGTGGCTGG - Intergenic
1200212780 X:154354286-154354308 GCCCCACTGCCCCACAGGGGAGG - Exonic
1200258277 X:154597457-154597479 GACTCACAGTTCCACGTGGCTGG - Intergenic
1200319795 X:155175730-155175752 GACTCACAGTTCCACGTGGCTGG - Intergenic
1200332137 X:155309565-155309587 GACTCACAGTTCCACGTGGCTGG + Intronic
1200778112 Y:7188115-7188137 GCCTCACAGCTCTATGTGGCTGG - Intergenic
1201186901 Y:11413645-11413667 GACTCACAGCTCCACATGGCTGG + Intergenic
1201471167 Y:14336332-14336354 GACCCACAGTCCCACGTGGCTGG - Intergenic
1201509022 Y:14736817-14736839 AACCCACAGTTCCACAGGGCTGG - Intronic