ID: 1163648189

View in Genome Browser
Species Human (GRCh38)
Location 19:18502130-18502152
Sequence GCCCCACAGCTCCACGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163648189 Original CRISPR GCCCCACAGCTCCACGGGGC AGG Intronic