ID: 1163649956

View in Genome Browser
Species Human (GRCh38)
Location 19:18511575-18511597
Sequence CAGACTGATGTCCTGTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 372}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163649956_1163649974 29 Left 1163649956 19:18511575-18511597 CCACACCACAGGACATCAGTCTG 0: 1
1: 0
2: 1
3: 11
4: 372
Right 1163649974 19:18511627-18511649 TACCACCGGAGGGGGCCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 76
1163649956_1163649969 20 Left 1163649956 19:18511575-18511597 CCACACCACAGGACATCAGTCTG 0: 1
1: 0
2: 1
3: 11
4: 372
Right 1163649969 19:18511618-18511640 CACCCACCATACCACCGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1163649956_1163649968 19 Left 1163649956 19:18511575-18511597 CCACACCACAGGACATCAGTCTG 0: 1
1: 0
2: 1
3: 11
4: 372
Right 1163649968 19:18511617-18511639 CCACCCACCATACCACCGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1163649956_1163649964 15 Left 1163649956 19:18511575-18511597 CCACACCACAGGACATCAGTCTG 0: 1
1: 0
2: 1
3: 11
4: 372
Right 1163649964 19:18511613-18511635 CCCACCACCCACCATACCACCGG 0: 1
1: 0
2: 3
3: 39
4: 478
1163649956_1163649970 21 Left 1163649956 19:18511575-18511597 CCACACCACAGGACATCAGTCTG 0: 1
1: 0
2: 1
3: 11
4: 372
Right 1163649970 19:18511619-18511641 ACCCACCATACCACCGGAGGGGG No data
1163649956_1163649966 18 Left 1163649956 19:18511575-18511597 CCACACCACAGGACATCAGTCTG 0: 1
1: 0
2: 1
3: 11
4: 372
Right 1163649966 19:18511616-18511638 ACCACCCACCATACCACCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163649956 Original CRISPR CAGACTGATGTCCTGTGGTG TGG (reversed) Intronic
900373042 1:2340725-2340747 CAGTCTGGTGTCCTGTGTGGTGG - Intronic
900556122 1:3281629-3281651 CAGACTGATGTTCTGTGATCAGG + Intronic
900564337 1:3324940-3324962 AATACTGATGTCCTGGGGGGAGG + Intronic
900749693 1:4387569-4387591 CAGACAGATGGCATGTGATGAGG - Intergenic
902190239 1:14757705-14757727 CACTGTGATGTCATGTGGTGGGG + Intronic
902425467 1:16317872-16317894 CAGGCTGGAGTCCAGTGGTGTGG - Intronic
903320686 1:22541468-22541490 CAGACTGTGGGCCTGTGGAGGGG - Intergenic
904098906 1:28005668-28005690 CAGACTGGAGTGCAGTGGTGTGG - Intronic
906396142 1:45466603-45466625 CAGACTGGAGTGCAGTGGTGTGG - Intronic
907812183 1:57882245-57882267 TAGACTCATGTCCTGTGGACAGG - Intronic
908522750 1:64960181-64960203 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG + Intronic
911453325 1:98093546-98093568 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
914806670 1:150996998-150997020 CAGACTGAGGCTCTGGGGTGAGG - Intronic
915507764 1:156368285-156368307 CAGCCTGCTTCCCTGTGGTGTGG + Intergenic
915681492 1:157585978-157586000 CAGAGTAAGGTCCTGTAGTGAGG - Intronic
917363152 1:174199334-174199356 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
917429840 1:174954670-174954692 CAGCCTGGTGTCCAGTGGTATGG + Intronic
917467655 1:175296519-175296541 CAGGCTGAAGTGCAGTGGTGCGG + Intergenic
917620663 1:176792425-176792447 CACAGTGATGTCTTGTGGTCAGG + Intronic
919750339 1:201033992-201034014 CAGGAGGATGACCTGTGGTGAGG + Intergenic
921016244 1:211194183-211194205 CAGACAGATGACCTGAGGTTAGG - Intergenic
922115099 1:222605780-222605802 CAGTCTGAAGTGCAGTGGTGTGG + Intergenic
922781459 1:228256327-228256349 AAGACTGGGGTTCTGTGGTGAGG + Intronic
922914594 1:229246058-229246080 CAGGCTGAAGTGCAGTGGTGTGG - Intergenic
923198371 1:231689374-231689396 CAGACTGGAGTGCAGTGGTGTGG + Intronic
923240002 1:232074601-232074623 GAGAATGATGTGCTTTGGTGTGG + Intergenic
924351210 1:243116162-243116184 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1062831314 10:607918-607940 CACACTGAGGGGCTGTGGTGTGG - Intronic
1062895688 10:1101502-1101524 CATTCTGAGGTCCTGGGGTGAGG + Intronic
1064543580 10:16429375-16429397 CAGACTGGAGTGCAGTGGTGAGG + Intergenic
1065905315 10:30245685-30245707 CAGACTGGAGTGCAGTGGTGCGG - Intergenic
1067021450 10:42803064-42803086 CAGACTGGAGTGCTATGGTGTGG + Intronic
1067343356 10:45421388-45421410 CAGAAAGAGGTCCTGTGCTGGGG - Intronic
1067393401 10:45887275-45887297 CAGACAGATGGCCTGAGGTCAGG - Intergenic
1067472898 10:46549205-46549227 CAGGCTGCAGTCCTGTGGTCTGG + Exonic
1067861725 10:49856405-49856427 CAGACAGATGGCCTGAGGTCAGG - Intronic
1069398637 10:68017714-68017736 CAGACTGATCACCTGAGGTCAGG - Intronic
1069473001 10:68709522-68709544 CAGACAGATGACCTGAGGTCAGG - Intergenic
1069892807 10:71662470-71662492 CAGACTTATGACTTGTGGTGGGG + Intronic
1070760326 10:79020279-79020301 CAGCCTGAACTCCTGTGGGGAGG - Intergenic
1071490739 10:86134824-86134846 CAGAGTGATGTCCTCTGGCCAGG - Intronic
1072772862 10:98157208-98157230 CACAGTGATGTGCTTTGGTGTGG + Intronic
1073087860 10:100906207-100906229 CAGGCTGGTGTGCAGTGGTGTGG - Intergenic
1075886927 10:125908221-125908243 CAGACAGATCACCTGAGGTGAGG - Intronic
1077941914 11:6851897-6851919 AAGTCTGAAGTCCAGTGGTGGGG + Intergenic
1078222956 11:9366560-9366582 CAGGCTGAAGTGCAGTGGTGCGG + Intergenic
1078752310 11:14176622-14176644 CAGACAGATATCCTGTGATGGGG + Intronic
1081331015 11:41800201-41800223 CAAACTGATGTTCTGTGCTCAGG + Intergenic
1081923111 11:46797946-46797968 CTCACTGATGTTCTGTAGTGTGG + Exonic
1083654786 11:64224399-64224421 CAGACTGGGGTCCTGGGCTGGGG + Intronic
1083780108 11:64913382-64913404 CAGACTGGAGTACTGTGATGAGG - Exonic
1083792949 11:64997572-64997594 AAGATTGATGTCCAGTGGTTAGG + Intergenic
1084233518 11:67770558-67770580 CAGACAGATGACCTGAGGTCAGG + Intergenic
1084711432 11:70846306-70846328 CAGGCTGATATGCAGTGGTGCGG + Intronic
1084748559 11:71188986-71189008 CTGGCTGTTGCCCTGTGGTGGGG - Intronic
1085071096 11:73546503-73546525 CAGACAGATGACCTGAGGTCAGG + Intronic
1086662498 11:89437509-89437531 CAGACTGATGACCTGGGAAGTGG + Intronic
1086829527 11:91542880-91542902 CAGGCTGATGTGCGGTGGTATGG - Intergenic
1087024003 11:93631981-93632003 CAGACAGATGCAGTGTGGTGAGG - Intergenic
1089100969 11:115962053-115962075 CAAAGAGATGTGCTGTGGTGGGG - Intergenic
1089293460 11:117452973-117452995 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1089834753 11:121360100-121360122 CAGACTGCAGTGCAGTGGTGTGG + Intergenic
1090044879 11:123322282-123322304 CAGACAGATCACCTGAGGTGAGG - Intergenic
1090334639 11:125954346-125954368 CAGAGGGATGTCCTGCAGTGTGG - Intergenic
1091970043 12:4779459-4779481 CAGACTGCTGTCCTGGGGACTGG + Intronic
1092090379 12:5798970-5798992 CAGAATGATGTCCTGTTTTCTGG - Intronic
1092257466 12:6935432-6935454 CACACTGTTGTACTGTGATGTGG - Intronic
1092801319 12:12170285-12170307 CAGACTGAAGTGCAGTGGTGCGG - Intronic
1093161757 12:15755027-15755049 CAGAATGCTGTCCAGTGGTCAGG + Intronic
1093562288 12:20555239-20555261 CGGGCGGATTTCCTGTGGTGAGG - Intronic
1093627540 12:21367033-21367055 CAGGCTGATATGCTTTGGTGTGG - Intronic
1096007922 12:48186922-48186944 CAGGCTGATCACCTGTGGTTGGG + Intergenic
1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG + Exonic
1096882061 12:54681154-54681176 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1098655810 12:73028041-73028063 GAGACTGATTTCCTGCTGTGTGG - Intergenic
1099253943 12:80292213-80292235 CAGGCTGATCTCCTGAGGTCAGG - Intronic
1101673450 12:106897369-106897391 CAGACTGGGGTCCTGTGGCTCGG + Intergenic
1101734064 12:107449693-107449715 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1102477630 12:113199162-113199184 CAGACGGATCTCCTGAGGTCAGG - Intronic
1102560399 12:113758010-113758032 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1104801528 12:131558204-131558226 CTGACTGGGGTGCTGTGGTGGGG - Intergenic
1105377386 13:19858150-19858172 CAGACTTTAGTGCTGTGGTGTGG - Intronic
1106464939 13:30005140-30005162 CACCCTGAAGTCCTGAGGTGTGG + Intergenic
1106509124 13:30397978-30398000 CAGACTGATCACCTGAGGTCAGG + Intergenic
1106592124 13:31106872-31106894 CAGGCTGAAGTACAGTGGTGTGG - Intergenic
1107186075 13:37522627-37522649 CAGACTGGTGTCTTCTGGGGAGG - Intergenic
1107867567 13:44717655-44717677 CAGACGGATGACCTGAGGTCAGG - Intergenic
1108940674 13:55948626-55948648 CAGGCTGATGACCTTTGGAGGGG - Intergenic
1109808498 13:67476193-67476215 CAGACTGAAGTACAGTGGAGCGG + Intergenic
1109913996 13:68955855-68955877 CAGACTGGTGTGCAGTGGTGTGG + Intergenic
1111983099 13:95037908-95037930 CAGACTGGAGTGCAGTGGTGTGG + Intronic
1112585739 13:100716868-100716890 CACACTGATGCCCTGGAGTGGGG + Intergenic
1112770243 13:102787272-102787294 CAGACAGATCACCTGAGGTGAGG - Intronic
1115159288 14:30375087-30375109 CAGACTGAAGTGCAGTGGCGTGG - Intergenic
1116875531 14:50107539-50107561 CAGACGGATCTCCTGAGGTCGGG - Intergenic
1117089004 14:52230833-52230855 CATAATGATGTGCTCTGGTGTGG + Intergenic
1120549248 14:85849004-85849026 CAGACTGAAGCCCTGTACTGGGG + Intergenic
1121365048 14:93301416-93301438 CAGACGGATCACCTGTGGTCAGG - Intronic
1121446860 14:93984216-93984238 CAGCCTGACCTCCTGTGGTTGGG - Intergenic
1121815669 14:96926240-96926262 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1121910823 14:97790836-97790858 CAGACGGATGCCCTGAGGTCAGG - Intergenic
1124201864 15:27685633-27685655 AACACTGATGGCCTGTGGAGTGG - Intergenic
1124892102 15:33742962-33742984 CAGCCTGACCTCATGTGGTGAGG - Intronic
1125836453 15:42755966-42755988 CAGGCTGATCTCCTGAGGTCAGG + Intronic
1126641450 15:50831077-50831099 CAGACTGATCACCTGAGGTCAGG - Intergenic
1128030193 15:64473241-64473263 CAGGCTGGAGTCCAGTGGTGTGG + Intronic
1128188518 15:65666732-65666754 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1129029298 15:72606951-72606973 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1129365642 15:75052299-75052321 CAGACTGGAGTGCAGTGGTGCGG + Intronic
1129753513 15:78082327-78082349 AACAGTGATGTCCTGTGGTCAGG + Intronic
1129941430 15:79500468-79500490 CAGAGTGATGTCCTTTCCTGAGG + Intergenic
1130541405 15:84822969-84822991 CAGGCTGGTGTGCTGTGGGGTGG + Intronic
1130962553 15:88672527-88672549 CATAGTGATGTCCCTTGGTGTGG - Intergenic
1131522832 15:93129285-93129307 CAGACTGATCACCTGCGGTCAGG + Intergenic
1131654172 15:94437076-94437098 CACACTGATTTCCTCTAGTGTGG - Intronic
1132125039 15:99215700-99215722 CAGACTGGAGTACAGTGGTGGGG - Intronic
1132346102 15:101109944-101109966 CAGGCTGATGTGCAGTAGTGTGG - Intergenic
1132876632 16:2142498-2142520 CAGACTGAAGTGCAGTGGTGCGG - Intronic
1133193286 16:4150423-4150445 CAGACTGATCACCTGAGGTCAGG - Intergenic
1133764737 16:8830032-8830054 CAGACAGATACCCTGTGATGGGG + Intronic
1134132571 16:11659474-11659496 CAGACTGAGCACCTCTGGTGGGG - Intergenic
1134660766 16:15982759-15982781 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1134776604 16:16858943-16858965 CAGGCTGGAGTCCAGTGGTGTGG + Intergenic
1135038684 16:19100357-19100379 AAGACAGCTGTCCTGTTGTGAGG - Intergenic
1135317473 16:21461963-21461985 CAGGCTGATCACCTGTGGTCAGG - Intergenic
1135370371 16:21893772-21893794 CAGGCTGATCACCTGTGGTCAGG - Intergenic
1135441418 16:22476927-22476949 CAGGCTGATCACCTGTGGTCAGG + Intergenic
1136467819 16:30457203-30457225 CAGACTGGAGTGCAGTGGTGCGG - Intergenic
1136784932 16:32928613-32928635 CAGGCTGAAGTGCAGTGGTGTGG - Intergenic
1136884851 16:33925193-33925215 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
1137647491 16:50088683-50088705 CAGCAAGATGTCCTGTGGGGTGG + Intronic
1138392627 16:56681817-56681839 CAAACTGTCATCCTGTGGTGGGG + Intronic
1139595121 16:67953051-67953073 CAGACTGGAGTGCCGTGGTGTGG - Intronic
1139870492 16:70104622-70104644 CAGGCTGAAGTGCAGTGGTGCGG - Intergenic
1140605221 16:76528303-76528325 CAGACTGGAGTACAGTGGTGTGG + Intronic
1140999473 16:80295074-80295096 CAGACAGAGGTCGTGGGGTGAGG - Intergenic
1142550438 17:735065-735087 CAGACTGGAGTGCAGTGGTGAGG + Intronic
1143176997 17:4961227-4961249 CAGACAGATCTCCTGGGGTCAGG + Intronic
1143335053 17:6165831-6165853 CAGACTGGAGTTCAGTGGTGTGG - Intergenic
1146715129 17:35079501-35079523 CATGTTGATGTGCTGTGGTGAGG + Intronic
1148083061 17:44978023-44978045 CAGCCTGATGTTCTGTGCTCTGG - Intergenic
1148202004 17:45755659-45755681 CCTCCTGATTTCCTGTGGTGTGG - Intergenic
1149406642 17:56358670-56358692 CAGACTGATGTGCTGAGCTTAGG + Intronic
1149796289 17:59523595-59523617 CAGACTGATCACCTGAGGTCAGG + Intergenic
1151692198 17:75693560-75693582 CAGACAGAAGCCCTGTGGGGCGG - Intronic
1153046200 18:857517-857539 CAGGCTGATGACCTGAGGTCAGG + Intergenic
1154322258 18:13364380-13364402 CAGGCTGAAGTGCGGTGGTGTGG + Intronic
1155285532 18:24285013-24285035 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1156876649 18:42022293-42022315 CACACTGATGTCATGGGGTTGGG - Intronic
1157170576 18:45401211-45401233 AAGAGAGATGTACTGTGGTGAGG - Intronic
1158472262 18:57747406-57747428 CAGACTGGAGTGCAGTGGTGGGG - Intronic
1158598958 18:58840638-58840660 CAGACGGATCACCTGTGGTCAGG + Intergenic
1159004073 18:62997578-62997600 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
1160902710 19:1436686-1436708 CACCATGATGACCTGTGGTGTGG - Intergenic
1161023056 19:2020508-2020530 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1161523561 19:4739169-4739191 CAGGCTGGTGTGCAGTGGTGTGG + Intergenic
1163649956 19:18511575-18511597 CAGACTGATGTCCTGTGGTGTGG - Intronic
1164158759 19:22612686-22612708 CAGAATGATGGCCTCTGCTGAGG - Intergenic
1165160148 19:33811236-33811258 CAGACTGAAGTCCTGGGGACAGG - Exonic
1165223335 19:34336033-34336055 CAGACTGCAGTGCAGTGGTGTGG + Intronic
1165387168 19:35517342-35517364 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1166791577 19:45401985-45402007 GAGACTGAGGTACTGTGGTCAGG - Intronic
1166906204 19:46110067-46110089 CAAACTTATGTCCTTTGCTGTGG - Intergenic
925227236 2:2194122-2194144 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
925560880 2:5193564-5193586 CAGGCTGGAGTCCAGTGGTGTGG - Intergenic
926082994 2:10003956-10003978 CTGACTGATGCCCTGTGGGCTGG - Intergenic
926778486 2:16445673-16445695 CAGACTGGTGCTTTGTGGTGAGG + Intergenic
928161648 2:28932206-28932228 CAGGCTGGTGTGCAGTGGTGCGG + Intronic
928236363 2:29545039-29545061 CAGTCAGATGCCCTGTGGTTTGG + Intronic
929155910 2:38788386-38788408 CAGGCTGATCACCTGAGGTGAGG - Intergenic
930599226 2:53424526-53424548 CTGACTGATGTGCTCAGGTGGGG + Intergenic
930634356 2:53787769-53787791 GAGTCTGAAGTACTGTGGTGTGG - Intronic
932314369 2:70769636-70769658 CAGACCTAGGTCCTGGGGTGGGG - Intergenic
933626483 2:84606339-84606361 CCAATTGATGTCATGTGGTGAGG + Intronic
934024163 2:87986178-87986200 CAGGCTGGAGTGCTGTGGTGCGG + Intergenic
934743424 2:96742344-96742366 CAGGCTGGAGTGCTGTGGTGCGG - Intergenic
936697448 2:114966995-114967017 CAGACTGGTGTACAATGGTGTGG - Intronic
938044829 2:128109117-128109139 CAGGCAGATCTCCTGTGGTCAGG - Intronic
938130576 2:128712332-128712354 CAGACAGATCTCCTGAGGTCAGG - Intergenic
939218377 2:139270502-139270524 TACACTGATGTCCTTTGTTGGGG + Intergenic
940553192 2:155187627-155187649 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
940867954 2:158835977-158835999 CAGGCTGGAGTCCTGTGGTGTGG - Intronic
941009766 2:160286253-160286275 CAGGCTGGAGTCCAGTGGTGTGG - Intronic
941431227 2:165417048-165417070 CAGACACAGGTCCTCTGGTGAGG + Intergenic
944805202 2:203274228-203274250 CAGACTGGAGTGCAGTGGTGCGG + Intronic
945146057 2:206739367-206739389 CAGGCTGAAGTGCAGTGGTGCGG - Intronic
945357503 2:208857232-208857254 AAGACTGCTGTGCTGTGCTGGGG + Intergenic
945445153 2:209928289-209928311 CAGGCTGAAGTGCAGTGGTGCGG - Intronic
946275782 2:218630638-218630660 TAGTCTGATGTCTGGTGGTGAGG - Exonic
946481616 2:220062309-220062331 CTGACTGATGTCCTCTGGTGGGG + Intergenic
946529939 2:220560067-220560089 CATACTGATGTACTGGGGTTAGG - Intergenic
946626199 2:221614360-221614382 CAGACTCCTTTCCCGTGGTGTGG - Intergenic
946842991 2:223836682-223836704 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
948510527 2:238461271-238461293 CAGAGTGATGTGGTGTGGGGAGG - Intergenic
948611289 2:239168775-239168797 CAGAGTGTGGTCTTGTGGTGAGG - Intronic
1169137626 20:3206967-3206989 CAGGCTGAAGTACAGTGGTGTGG - Intergenic
1169569065 20:6887122-6887144 CAGGCTGATGTCCTGGAGAGAGG + Intergenic
1169936678 20:10891149-10891171 CAGACAGATGACCTGAGGTCAGG - Intergenic
1170172581 20:13431867-13431889 CACACTGATGTCACATGGTGAGG - Intronic
1170705778 20:18743627-18743649 CAGGCTGAAGTACAGTGGTGCGG - Intronic
1172151303 20:32792485-32792507 CAGACAGCTGTCCTGGGCTGTGG - Intronic
1172264747 20:33601307-33601329 CAGACTGGAGTGCAGTGGTGCGG + Intronic
1173626267 20:44475437-44475459 CAGACAGATGTCCCCTGGTTTGG + Intergenic
1174224575 20:48986567-48986589 CAGGCTGGTGTGCAGTGGTGTGG - Intronic
1174265629 20:49329636-49329658 CAGAGTCAGGTCATGTGGTGAGG - Intergenic
1174565769 20:51463456-51463478 CTCCCTGATGTCCTGTGGAGTGG - Intronic
1174843274 20:53919509-53919531 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1175828962 20:61951706-61951728 CAGGGTGAGGCCCTGTGGTGGGG + Intergenic
1176064303 20:63186861-63186883 CAGCCTGAGGACCTGTGGAGGGG + Intergenic
1176150084 20:63586258-63586280 CTGACAGATGACCTGTGGGGAGG + Intergenic
1176247257 20:64103273-64103295 CAGGCTGGAGTGCTGTGGTGGGG - Intergenic
1177546303 21:22562784-22562806 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1178070441 21:28960137-28960159 CAGACAGATCACCTGAGGTGAGG + Intronic
1178952626 21:36997742-36997764 CAGACTGGTGTGCAGTGCTGTGG - Intergenic
1181458336 22:23071728-23071750 CAGAGTGGTGTCCTGGGCTGGGG + Intronic
1181762671 22:25068775-25068797 CTGCCTGGTGTCCAGTGGTGAGG + Intronic
1182375370 22:29843378-29843400 CAGGCTGAAGTGCAGTGGTGTGG - Intergenic
1182714685 22:32348190-32348212 CAGAGCGAAGTCCTGGGGTGGGG - Intergenic
1183503870 22:38197890-38197912 CAGACAGATGACCTGAGGTCAGG + Intronic
1183641534 22:39095844-39095866 CAGGCTGATGACCTGAGGTCAGG - Intergenic
1183656544 22:39188817-39188839 CGGACTGATCACCTGAGGTGAGG - Intergenic
1184326476 22:43791326-43791348 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1184455420 22:44607248-44607270 CAGAGGGATGGCCGGTGGTGGGG + Intergenic
1184898015 22:47423555-47423577 CAGACTGAGTGCCTGTGATGTGG + Intergenic
1185226868 22:49658222-49658244 CAGACTGATGGCCTCTGGGGTGG + Intergenic
950406662 3:12809181-12809203 CAGACAGAGGTGCTGTGATGGGG + Intronic
950536021 3:13578825-13578847 CAGACAGATCTCCTGAGGTCGGG + Intronic
953433179 3:42856232-42856254 CAGGCTGAGCTCCTGGGGTGGGG + Intronic
954234349 3:49244802-49244824 CAGCCTGGTTTCCAGTGGTGAGG + Intronic
954433526 3:50483981-50484003 AAGACTGATGTTCTGAGTTGAGG - Intronic
959720952 3:109488425-109488447 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
960379973 3:116947980-116948002 CTGACTGAAGTCCTGAGATGAGG - Intronic
960662253 3:120073340-120073362 CAGGCTGAAGTGCTGTGGTGTGG - Intronic
960943993 3:122953514-122953536 CAGACAGACGTGCTGTGCTGGGG - Intronic
961508416 3:127387042-127387064 CAGAATGACGTCCTCTGTTGTGG + Intergenic
963623950 3:147647506-147647528 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
964818356 3:160741441-160741463 CAGAATTATATCCTGTGGTTTGG - Intergenic
966631791 3:182084302-182084324 CAGACGGATCTCCTGAGGTCAGG + Intergenic
968009765 3:195266447-195266469 CAGGCTGGGGTGCTGTGGTGCGG - Intronic
969832040 4:9805649-9805671 CAGGCTGAAGTGCAGTGGTGCGG - Intronic
969893410 4:10280405-10280427 CAGAGTGCTCTCCTGTGATGTGG + Intergenic
970591675 4:17565465-17565487 CCGTCTGATGTCTGGTGGTGTGG - Intergenic
971999983 4:34019291-34019313 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
972187260 4:36545215-36545237 CAGACAGATCACCTGAGGTGGGG - Intergenic
973071958 4:45871596-45871618 CAGGCTGGAGTGCTGTGGTGTGG - Intergenic
973265945 4:48210438-48210460 CAGACTGGAGTGCAGTGGTGTGG - Intronic
973886658 4:55328777-55328799 CAGGCTGAAGTGCTGTGGCGCGG - Intergenic
977097737 4:92767704-92767726 CAGACTGGAGTGCAGTGGTGTGG - Intronic
978124694 4:105121790-105121812 CAGGCTGAAGGGCTGTGGTGTGG - Intergenic
978286668 4:107085913-107085935 CTGACAAATGTCCTGTGGAGAGG - Intronic
978658135 4:111091076-111091098 CAGACTGAAGTGCAATGGTGCGG - Intergenic
979049059 4:115907120-115907142 CAGACAGATTTCCTGAGGTCAGG + Intergenic
979250730 4:118564376-118564398 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
979936685 4:126706692-126706714 CAGACTGGAGTACAGTGGTGTGG - Intergenic
980078680 4:128321055-128321077 CAGGCTGAAGTGCAGTGGTGCGG + Intergenic
982191243 4:152857870-152857892 TAGACTGATGTTCTGGGGGGTGG - Intronic
982211815 4:153043440-153043462 CAGCATGATTGCCTGTGGTGAGG - Intergenic
982248466 4:153379803-153379825 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
983252088 4:165357063-165357085 CAGGCTGGAGTCCAGTGGTGTGG + Intergenic
983621961 4:169771514-169771536 CAGGCTGATCACCTGAGGTGAGG - Intergenic
983979443 4:173976168-173976190 CAGACTGAGCTCCTGTAGAGGGG - Intergenic
984074493 4:175157851-175157873 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
985632530 5:1021431-1021453 GAGACTGAGGCCCTGTGGGGAGG - Intronic
986850862 5:11812171-11812193 AACACAGATGTCCTGTTGTGCGG + Intronic
990813249 5:59752724-59752746 CAGAATGATGCTTTGTGGTGGGG - Intronic
991623444 5:68571087-68571109 CAGGCTGATCTCCTGAGGTCAGG - Intergenic
994868561 5:105313745-105313767 CAGACTGATTGCCTGAGGTCAGG + Intergenic
995518622 5:112978020-112978042 CAGGCTGGTGTGCAGTGGTGCGG + Intronic
995681530 5:114726181-114726203 TAGACTGATGTCCTTTGGGTTGG - Intergenic
996425290 5:123307371-123307393 CAGACTGATCACCTGAGGTCAGG + Intergenic
997568486 5:134907287-134907309 CAGACTGGAGTGCAGTGGTGCGG + Intronic
998081744 5:139281217-139281239 CAGGCTGGTGTGCAGTGGTGTGG + Intronic
998402395 5:141854521-141854543 CATACTCCTGTCCTGAGGTGGGG - Intronic
999625502 5:153516552-153516574 TACACTGATGCCTTGTGGTGTGG + Intronic
1002685903 5:181009014-181009036 GAGGCTGATGACCTGTGGTTGGG - Intergenic
1002854536 6:1025691-1025713 CAGGGTGATGTCCTGGGATGTGG + Intergenic
1003353686 6:5344831-5344853 CAGACTGGAGTGCAGTGGTGTGG + Intronic
1004300330 6:14451947-14451969 CAGGCTGGAGTCCAGTGGTGTGG + Intergenic
1004651331 6:17612679-17612701 CAGACTGATGCACTGAGGTTTGG - Intergenic
1005894227 6:30164102-30164124 CAGGATGATGTCCTGTTATGAGG + Intronic
1005926956 6:30452440-30452462 CAGGCTGAGGTCCTCTGCTGGGG - Intergenic
1005955941 6:30663492-30663514 CAGACGGATCTCCTGAGGTTGGG + Intronic
1006127976 6:31852248-31852270 CTGAGTCCTGTCCTGTGGTGAGG - Intergenic
1006199522 6:32275396-32275418 CAGGCTGGTGTGCAGTGGTGTGG + Intergenic
1006950712 6:37819581-37819603 CAGAGAGATGTCCTGTGCGGTGG - Exonic
1011273337 6:85602649-85602671 CAGGCTGATGGCCTGAGGTCAGG + Intronic
1011497674 6:87952546-87952568 CAGTCTGGAGTGCTGTGGTGTGG + Intergenic
1011935896 6:92776759-92776781 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1013199903 6:107883760-107883782 CAGACTGAAGTGCTGTGGCATGG - Intronic
1013487512 6:110611556-110611578 CAGGCGGATGACCTGAGGTGAGG + Exonic
1015856484 6:137630318-137630340 CAGGCTGGTGTGCAGTGGTGCGG - Intergenic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1017524734 6:155232575-155232597 CTGACTGATGTCCTGGTTTGGGG + Intronic
1017819663 6:158039997-158040019 CAGACTGGCTCCCTGTGGTGGGG + Intronic
1019021036 6:168917944-168917966 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
1020483958 7:8697507-8697529 CAGACTGAAGTGCTGGGGTAAGG + Intronic
1021826324 7:24555950-24555972 TAGACAGATGTACTGTGGTTAGG + Intergenic
1022450002 7:30505333-30505355 CAGATTGATGACCAGTGCTGGGG - Intronic
1023190416 7:37574484-37574506 CAGACTGGAGTACAGTGGTGCGG - Intergenic
1023826151 7:44011142-44011164 CAGACTGGGGTACAGTGGTGTGG + Intergenic
1025095043 7:56090158-56090180 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1025931746 7:66000561-66000583 CGGACTGATGACCTGAGGTCAGG + Intergenic
1026089724 7:67290010-67290032 CAGACTGGGGTGCAGTGGTGTGG + Intergenic
1026154624 7:67816354-67816376 CAGCCTGCTGTGCTGTGCTGTGG - Intergenic
1026611169 7:71861155-71861177 CAAACTGGTGTGTTGTGGTGTGG + Intronic
1026724560 7:72860502-72860524 CAGACTGGGGTGCAGTGGTGTGG - Intergenic
1026746668 7:73018522-73018544 CAGACTGGGGTGCAGTGGTGCGG - Intergenic
1026750320 7:73046665-73046687 CAGACTGGGGTGCAGTGGTGCGG - Intergenic
1026753967 7:73074775-73074797 CAGACTGGGGTGCAGTGGTGCGG - Intergenic
1026757618 7:73102811-73102833 CAGACTGGGGTGCAGTGGTGCGG - Intergenic
1027032772 7:74903080-74903102 CAGACTGGGGTGCAGTGGTGCGG - Intergenic
1027089785 7:75290675-75290697 CAGACTGGGGTGCAGTGGTGCGG + Intergenic
1027093430 7:75318603-75318625 CAGACTGGGGTGCAGTGGTGCGG + Intergenic
1027097073 7:75346570-75346592 CAGACTGGGGTGCAGTGGTGCGG + Intergenic
1027119318 7:75505325-75505347 CAGACTGGGGTGCAGTGGTGTGG + Intergenic
1027272508 7:76530287-76530309 CAGACTGGGGTGCAGTGGTGTGG - Intergenic
1027322275 7:77021100-77021122 CAGACTGGGGTGCAGTGGTGCGG - Intergenic
1027325963 7:77049365-77049387 CAGACTGGGGTGCAGTGGTGTGG - Intergenic
1027812720 7:82925762-82925784 CAGGCTGAAGTGCAGTGGTGCGG + Intronic
1029398185 7:100323571-100323593 CAGACTGGGGTGCAGTGGTGCGG + Intergenic
1029718177 7:102344707-102344729 CAGACTGGGGTGCAGTGGTGTGG - Intergenic
1029754441 7:102564549-102564571 CAGACTGGGGTGCAGTGGTGTGG + Intronic
1029772390 7:102663631-102663653 CAGACTGGGGTGCAGTGGTGTGG + Intronic
1030551279 7:110963680-110963702 GAGACTGATGTCATGTCATGGGG - Intronic
1031732555 7:125316546-125316568 CAGACTGAAGTGCTCTGGTGTGG + Intergenic
1032409530 7:131684235-131684257 CAGACTGGAGTGCTGTGATGTGG + Intergenic
1035610560 8:960460-960482 CAGACGGATTGCCTGTGGTCAGG - Intergenic
1035715506 8:1751203-1751225 CAGACAGATCACCTGTGGTCAGG + Intergenic
1035962971 8:4157876-4157898 CATCCTGTTGTCCTGTGGGGAGG - Intronic
1036756274 8:11473265-11473287 CAGACTGATGAACACTGGTGTGG + Intronic
1039038069 8:33381090-33381112 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1039098835 8:33918731-33918753 CAGGCTGGAGTGCTGTGGTGTGG + Intergenic
1039247983 8:35630780-35630802 CAGAATAATGTACTGGGGTGGGG + Intronic
1039308127 8:36286519-36286541 CAGGCTGGTGTGCAGTGGTGCGG + Intergenic
1039495364 8:37976172-37976194 CAGACTGGAGTGCAGTGGTGAGG + Intergenic
1039622933 8:39016914-39016936 CAGACTCTTGTCCTCTGGTCCGG + Intronic
1040927399 8:52698916-52698938 CAGACAGATCACCTGAGGTGAGG - Intronic
1041236300 8:55806126-55806148 CAGGCTGATCACCTGAGGTGGGG + Intronic
1042371248 8:67993449-67993471 CAGACTGGAGTACAGTGGTGTGG + Intronic
1042936833 8:74067831-74067853 CAGACTGATCACCTGAGGTCAGG + Intergenic
1043067063 8:75587456-75587478 CAGGCTGGAGTGCTGTGGTGCGG + Intergenic
1043209843 8:77498426-77498448 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1044448598 8:92307614-92307636 CACAATGATGTCCCTTGGTGTGG + Intergenic
1046679130 8:117148973-117148995 CAGGGTGATGTCCTGGGATGAGG - Intronic
1046749872 8:117915625-117915647 CAGACAGATCACCTGAGGTGAGG + Intronic
1047004044 8:120601212-120601234 CAGACTGATCTCTAGTGGGGAGG + Intronic
1049160700 8:141095812-141095834 GAGACTGAGGCCCTGGGGTGGGG + Intergenic
1049397277 8:142406863-142406885 CAGACCACTGTCCTGTGCTGGGG - Intergenic
1049495958 8:142933484-142933506 CAGACTGGAGTGCAGTGGTGTGG + Intergenic
1049615211 8:143572924-143572946 CAGCCTGAGTGCCTGTGGTGTGG + Exonic
1049818186 8:144618241-144618263 CAGACTGGGGTCCTGGTGTGGGG + Intergenic
1049853405 8:144846741-144846763 CAGGCTGAAGTGCAGTGGTGCGG + Intronic
1049946533 9:602302-602324 CAGGCTGGTGTGCAGTGGTGTGG + Intronic
1050346626 9:4695227-4695249 CAGGCTGAAGTGCAGTGGTGAGG + Intronic
1051424403 9:16919020-16919042 CAGACTGGAGTGCAGTGGTGTGG - Intergenic
1051635842 9:19180305-19180327 CAGGCTGAAGTACAGTGGTGGGG + Intergenic
1052948716 9:34190332-34190354 CAGACTGGAGTGCAGTGGTGTGG + Intronic
1053160059 9:35807731-35807753 CAGACTGATTTAGTGGGGTGAGG + Intronic
1054929704 9:70623319-70623341 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1056644447 9:88398799-88398821 CAGGCGGATGACCTGAGGTGGGG - Intronic
1057038494 9:91830425-91830447 CAGACTGGAGTGCAGTGGTGTGG - Intronic
1057237016 9:93369282-93369304 CAGATTGATCTCCTGAGGTCAGG - Intergenic
1058470953 9:105278291-105278313 CAGACTGGAGTGCAGTGGTGCGG + Intronic
1059958523 9:119543027-119543049 CAGAATGAAGGCTTGTGGTGGGG - Intergenic
1060021753 9:120137570-120137592 CAGCCTAATGTCCTGTGGAAGGG + Intergenic
1062214358 9:135381045-135381067 TCGCCTGATGTCCTGTGGTCGGG + Intergenic
1062675905 9:137743721-137743743 CAGACAGGTGGGCTGTGGTGAGG - Intronic
1062683092 9:137794418-137794440 CAGAAGGATGGCCTGAGGTGAGG + Intronic
1185609860 X:1387769-1387791 CATCCTGAGGTCCTGGGGTGGGG - Intronic
1185953498 X:4462741-4462763 CAGACTGGAGTGCAGTGGTGAGG - Intergenic
1186048335 X:5561460-5561482 CAGGCTGGTGTGCGGTGGTGTGG - Intergenic
1186091400 X:6052570-6052592 CTGTCAGCTGTCCTGTGGTGTGG + Intronic
1187474880 X:19601976-19601998 CAGACTGATGGCCTATTGGGTGG + Intronic
1187980939 X:24756516-24756538 CAGACTGGTGTGCAGTGATGCGG - Intronic
1189371764 X:40434482-40434504 CAGACTGATCACCTGAGGTCAGG - Intergenic
1190764828 X:53467315-53467337 CAGGCTGGTGTGCAGTGGTGTGG - Intergenic
1191702248 X:64055160-64055182 CAGAATTCTGTCCTGTGGAGAGG + Intergenic
1192496065 X:71617325-71617347 CAGGCTGAAGTCCTGTGGGCAGG + Exonic
1193566167 X:83079730-83079752 CATACTCAGGTCCTGTGCTGTGG + Intergenic
1193893089 X:87075747-87075769 CAGGCTGATGTGCAGTGGTGTGG - Intergenic
1199717911 X:150519483-150519505 CAGACAGATCACCTGAGGTGGGG + Intergenic
1199979662 X:152914010-152914032 CAGGCAGATGGCCTGTGGAGAGG - Intergenic
1199990559 X:152985383-152985405 CAGAGAGAGGTCCTGTGCTGTGG - Intergenic
1200033649 X:153314857-153314879 CAGAGAGAGGTCCTGTGCTGTGG - Intergenic