ID: 1163650511

View in Genome Browser
Species Human (GRCh38)
Location 19:18515189-18515211
Sequence CCTGCAGAGACTGCCAGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163650506_1163650511 1 Left 1163650506 19:18515165-18515187 CCTCACACACACTCTTGCCTGCC 0: 2
1: 8
2: 31
3: 143
4: 597
Right 1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG 0: 1
1: 0
2: 3
3: 26
4: 293
1163650505_1163650511 2 Left 1163650505 19:18515164-18515186 CCCTCACACACACTCTTGCCTGC 0: 1
1: 21
2: 266
3: 585
4: 1896
Right 1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG 0: 1
1: 0
2: 3
3: 26
4: 293
1163650504_1163650511 20 Left 1163650504 19:18515146-18515168 CCGAGTGCAGAGCTCAGTCCCTC No data
Right 1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG 0: 1
1: 0
2: 3
3: 26
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163650511 Original CRISPR CCTGCAGAGACTGCCAGCTC GGG Intronic
900782556 1:4627527-4627549 CCTGCAGAGGCTGCCCCCGCTGG - Intergenic
901551296 1:9997681-9997703 CCTGCGGAGACTGCAGACTCGGG + Intronic
901766778 1:11505153-11505175 CCTGAAAATACTGCCAGGTCTGG - Intronic
903886035 1:26541774-26541796 CCTGCAAATGCTGCCAGCTGGGG + Intronic
904840570 1:33369446-33369468 CCTGCAGACACAGTCAGCTTTGG + Intronic
905655065 1:39681535-39681557 ACTGCTGAGAGTGGCAGCTCAGG + Exonic
906286114 1:44588875-44588897 CCTTCAGACTCTGCCATCTCAGG + Intronic
906529647 1:46516257-46516279 CCTGGAGACACTGCCTGCTCAGG - Intergenic
906709793 1:47920694-47920716 CCTGCAGGGAGTTACAGCTCAGG - Intronic
906751110 1:48261631-48261653 CCTGCAGAGACTTTCAGATGAGG + Intergenic
907437975 1:54461849-54461871 CCTGCAGTGAATGCCAGCATGGG + Intergenic
909529760 1:76669309-76669331 CTTGCTGAGACTGCCAGCTCAGG - Intergenic
910878776 1:91903602-91903624 CCTGCAGAGACTACCATGCCCGG - Intronic
912562706 1:110561880-110561902 CCAGCAGAGACTCCCAGATAGGG + Intergenic
912870672 1:113302232-113302254 GCTGCAGACACTGCCAGCCTTGG + Intergenic
913585428 1:120270570-120270592 CCTGCTCAGACTGAGAGCTCCGG - Intergenic
914887495 1:151597440-151597462 CCAGCTGATACTGGCAGCTCTGG - Intergenic
917294423 1:173504113-173504135 CCTTCAGAGACTGTGAGCTGGGG + Intronic
918198299 1:182243178-182243200 CCCACAGAGTCTGCCAGCACTGG + Intergenic
918696420 1:187551295-187551317 CCAGCAGAGGGAGCCAGCTCCGG + Intergenic
919614121 1:199783895-199783917 CCTGCAGAGAGTGCAAGTTCAGG + Intergenic
920694621 1:208172736-208172758 CCTGCAGGGACTCCCAGGTAAGG - Intronic
920754294 1:208714057-208714079 CCTGAAGAGACTGTTAGCTGAGG - Intergenic
921031813 1:211340829-211340851 GCTGCGAAGACCGCCAGCTCTGG - Intronic
922132344 1:222792236-222792258 ACTGCAGAGGCTGACTGCTCTGG - Intergenic
922205458 1:223442642-223442664 CCTGCTGCGACTGCCGTCTCAGG + Intergenic
922436063 1:225607812-225607834 CCTGGAGACACTGACAGCTGAGG + Intronic
923051502 1:230393946-230393968 CCTGCAGAGGATGCCAGGCCGGG - Intronic
924894019 1:248316649-248316671 CCTGCAGAGATGGCCTGCCCTGG + Intergenic
1063030440 10:2229185-2229207 CCCGCAGAGACTGCCATGTATGG + Intergenic
1063461823 10:6219701-6219723 CTTGCAGAGACGGCCAGCCACGG - Intronic
1064964453 10:21000955-21000977 CCTGCAGACAAAGCCAGCACAGG + Intronic
1065490505 10:26277379-26277401 ACAGCAGTGACTCCCAGCTCAGG - Intronic
1065724437 10:28656118-28656140 CCTTCAGGGAATGCCAGCTGTGG - Intergenic
1065883404 10:30057630-30057652 GCTGCAGAGACTGGAAGGTCAGG - Intronic
1066264613 10:33764022-33764044 CCTGCAAAGACAAGCAGCTCAGG - Intergenic
1067098363 10:43317067-43317089 CCTGCAGAGGCTCCCAGGGCAGG - Intergenic
1067822100 10:49539391-49539413 CCTGCAGAGAAAGTCAGCTTGGG + Intronic
1067947056 10:50696326-50696348 CCTGCTGAGACTCCCTGCCCAGG + Intergenic
1069841985 10:71345721-71345743 CCTGCGGAGACCGCCACCCCAGG + Intronic
1070882369 10:79861316-79861338 CCTGCTGAGACTCCCTGCCCGGG + Intergenic
1071344985 10:84684161-84684183 CCTGAAGAGGCTGACAGCTGAGG + Intergenic
1071573598 10:86711094-86711116 CCTGCAGAGACTGGGAACACAGG + Intronic
1071648939 10:87377627-87377649 CCTGCTGAGACTCCCTGCCCGGG + Intergenic
1072264459 10:93714018-93714040 TCTTCAGAGACTGCCTTCTCAGG + Intergenic
1072959178 10:99913962-99913984 CCTCCACACACAGCCAGCTCTGG - Intronic
1073051143 10:100668160-100668182 CCTGGAGATGCTGCCGGCTCAGG - Intergenic
1073839487 10:107482162-107482184 TCTGCAAAGACAGACAGCTCTGG + Intergenic
1075100672 10:119503997-119504019 GCTGCAGAGCCTGCCAGGGCTGG - Intronic
1075198681 10:120383082-120383104 CCTACAAAGACTGGCAGCACTGG + Intergenic
1075406353 10:122198358-122198380 CCTTCAGATCCTTCCAGCTCCGG + Intronic
1076759570 10:132595236-132595258 CCTGCAGAAACTGCATGCCCTGG - Intronic
1077376835 11:2209223-2209245 GCTGGAGACACTGCCAGCTCAGG + Intergenic
1078902238 11:15652111-15652133 CCTGCAAATACTGCCAGGTCTGG - Intergenic
1080827560 11:35860841-35860863 CAAGCCCAGACTGCCAGCTCTGG - Intergenic
1081459702 11:43260862-43260884 TCTGAAGATACTTCCAGCTCTGG + Intergenic
1083432578 11:62621967-62621989 CCTGCAGACCCCGCCTGCTCGGG - Exonic
1083546416 11:63552260-63552282 GGTGGAGAGAGTGCCAGCTCTGG + Intergenic
1083752461 11:64768038-64768060 ACTGCAGAGACTGGGAGCTATGG - Intronic
1083856615 11:65396240-65396262 AGTGCAGAGGCTGCCGGCTCAGG + Intronic
1084496744 11:69509646-69509668 CCTGCAGAGAGAGCCAGGCCTGG - Intergenic
1085789215 11:79482327-79482349 CCTCCAGATTCTGCCCGCTCTGG - Intergenic
1087619882 11:100528943-100528965 CCTGCAGACAGTGCCAGCAAAGG - Intergenic
1088465795 11:110136882-110136904 TCTGAAGAGAATGCAAGCTCTGG + Exonic
1090777553 11:129978721-129978743 GCTGCAGAGACTATCAGCTCAGG + Intronic
1090998679 11:131889874-131889896 CCTGCAGAGACATCCATCTTTGG - Intronic
1091151973 11:133337463-133337485 ACAACAGAGACTGCAAGCTCAGG + Intronic
1091715364 12:2772790-2772812 GCAGCAGAGACTCCCAGCTCTGG - Intergenic
1094631580 12:32180610-32180632 CCTTTAGTGACTCCCAGCTCTGG + Intronic
1097715817 12:62964778-62964800 TCTGAAGATACTTCCAGCTCTGG + Intergenic
1097725172 12:63067001-63067023 GCTGCAGAGCCTCCCAGCTGCGG + Intergenic
1097747938 12:63319641-63319663 CCTGCAGATACTGAGAGCACAGG - Intergenic
1100346159 12:93733633-93733655 CCTGGGGAGGCTGCCTGCTCAGG + Intronic
1101832544 12:108270659-108270681 TCTGCAGAGACAGCCAGGCCTGG - Intergenic
1102347405 12:112168777-112168799 CCTGCCCAGAGTGCCAGCCCTGG - Intronic
1102937748 12:116911553-116911575 TCTGCAGACACTGCCACATCTGG - Intronic
1107016876 13:35714633-35714655 CCTCCAGACAAGGCCAGCTCTGG + Intergenic
1107817112 13:44254217-44254239 CCTGCCCAGACTGCCACCACTGG + Intergenic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1110356324 13:74571924-74571946 TCTGCAGAGAATGCCAGGTAGGG - Intergenic
1111197597 13:84894928-84894950 CCAGCAGAGGGAGCCAGCTCTGG + Intergenic
1111333520 13:86792227-86792249 CCAGCAGAGGGAGCCAGCTCTGG - Intergenic
1112235233 13:97630044-97630066 TCTGCAGAGGCTGCCATCTGCGG + Intergenic
1112253876 13:97809730-97809752 CCTGGAAAGAATGCCAGCTTGGG - Intergenic
1113604452 13:111595446-111595468 CCTGCAGTGAGTGACAGCACTGG + Intronic
1114933682 14:27506966-27506988 CAGGCATAGTCTGCCAGCTCAGG + Intergenic
1115707361 14:36012916-36012938 TCTGCAAAGACAGACAGCTCTGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118323976 14:64769191-64769213 CCTGCAAAGAATGCCAGGTTTGG + Intronic
1118966861 14:70595214-70595236 CAAGCCCAGACTGCCAGCTCTGG + Intronic
1119620100 14:76125482-76125504 CCTGTAGAGGCTGCCGGCTTTGG + Intergenic
1119924549 14:78480423-78480445 GCTCCAGAGAGTCCCAGCTCTGG + Intronic
1119942254 14:78653467-78653489 CCTGGAGAGACTCCATGCTCAGG - Intronic
1120019770 14:79515444-79515466 CCTGAAGAGGCTGGCAGCTCAGG + Intronic
1121450043 14:94001278-94001300 CCTCCAGAGACTCCAGGCTCCGG - Intergenic
1122785304 14:104160725-104160747 ACTGCAGAGGCTCCCAGCGCCGG - Intronic
1122829327 14:104388095-104388117 CGTGCAGAACCAGCCAGCTCTGG + Intergenic
1123883417 15:24697126-24697148 TCTGCAAAGACGGACAGCTCTGG + Intergenic
1124135275 15:27029766-27029788 CAGCCAGAGCCTGCCAGCTCGGG - Intronic
1124217952 15:27825238-27825260 CCTGCTGGGCCTGGCAGCTCTGG - Intronic
1124551147 15:30682494-30682516 CCTGCAGAGCCTGAGAACTCAGG - Intronic
1124680099 15:31723160-31723182 CCTGCAGAGCCTGAGAACTCGGG + Intronic
1127163065 15:56211902-56211924 CCAGCAGTGAATGCGAGCTCTGG - Intronic
1128332225 15:66763306-66763328 CCTGGGGAGACTGGCGGCTCTGG + Intronic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1131425039 15:92339085-92339107 ACTGCAGATTCTGCCAGCCCTGG + Intergenic
1132200941 15:99954355-99954377 CCTGCAGTGATTGTCACCTCTGG - Intergenic
1132372889 15:101310226-101310248 CCTGCAGAGGCTGACAGTGCTGG - Intronic
1133041738 16:3064680-3064702 CCTGAACAGAATCCCAGCTCCGG + Intergenic
1135158283 16:20072824-20072846 CCTGCGGTGGCTGCCACCTCAGG - Intronic
1135577518 16:23597214-23597236 TCTGCAAAGACTGACAGCTCTGG + Intergenic
1136074683 16:27808824-27808846 CCCGCAGAGGCTGCTCGCTCTGG - Intronic
1137674657 16:50298324-50298346 CCTGCAGAGACTGGCATGGCCGG + Intronic
1139366594 16:66437495-66437517 CCCGCAGAGGTTGACAGCTCAGG + Intronic
1140479191 16:75253379-75253401 CCTGCAGAGACTGCTGCCTGGGG - Intronic
1141941473 16:87278871-87278893 ACTGGAGAGGCTGGCAGCTCAGG - Intronic
1143022386 17:3923622-3923644 CCCGCAGAGCCTCCCAGCTTGGG - Intergenic
1144765631 17:17731004-17731026 CCTGCAGAGCCTGCCTCCTTGGG - Intronic
1145269677 17:21398039-21398061 CCTGCAGCCACTGCCAGGGCTGG + Intronic
1149286153 17:55166654-55166676 CATCCATAGAGTGCCAGCTCTGG - Intergenic
1149644177 17:58227786-58227808 CCTGCAGAGGCACCCAGCTAAGG + Intronic
1149936351 17:60810838-60810860 CAAGCCCAGACTGCCAGCTCTGG + Intronic
1151221762 17:72618017-72618039 CCTGCAGCCAATGCCAGCTGAGG + Intergenic
1151237745 17:72733847-72733869 CCTGCAGAAACAGCCTGCTATGG - Intronic
1151361314 17:73590837-73590859 CCTGCCCAGACTGCCACCACCGG + Intronic
1151398180 17:73838836-73838858 CCAGGAGAGACAGCCAGCCCAGG - Intergenic
1152139046 17:78525687-78525709 CACGCAGGGACTGCCTGCTCTGG + Intronic
1152270260 17:79320335-79320357 CTGGCAGAGGCTGCCAGCACTGG - Intronic
1152891528 17:82884325-82884347 GCTGCTGAGAGTGCCAGCTGCGG + Intronic
1153062451 18:1007995-1008017 CCTGTAGAGACTACCAGCTGAGG + Intergenic
1153189136 18:2518563-2518585 CCTACAGAGACTGACAGTTCAGG + Intergenic
1153304140 18:3617058-3617080 CCTGGAGAGACTGCAAGCTCAGG + Intronic
1156289227 18:35731006-35731028 TCTGCAAAGACGGACAGCTCTGG + Intergenic
1157195579 18:45617763-45617785 CCTTCAGAGTCTACCAACTCAGG + Intronic
1157323723 18:46654403-46654425 CCTGCACAGGCTTCCAGCCCCGG - Intronic
1157713818 18:49868722-49868744 CCTGCAGTGACTGTTAGCCCCGG - Intronic
1157894274 18:51449095-51449117 CGTGCAGAGACTCCCCGCGCAGG + Intergenic
1158604881 18:58887028-58887050 CCTGCAGGGATGGTCAGCTCTGG + Intronic
1161021445 19:2013449-2013471 CCTGCCCAGACTCCCATCTCCGG - Intronic
1162816133 19:13195913-13195935 CTTGTACAGACTGCCACCTCAGG + Intergenic
1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG + Intronic
1165385964 19:35510848-35510870 GCTGGAGAGACTGCCGGCTCTGG + Intronic
1165876421 19:39010763-39010785 CTGGCAGAGACTAGCAGCTCAGG - Intronic
1166708043 19:44919405-44919427 CCTGCAGACCCTGCCCTCTCTGG - Intergenic
1166743111 19:45126085-45126107 CCTGCAGAGAGGCCCAGCACCGG + Intronic
1166765936 19:45252033-45252055 CCTGCTGAGAGTGCCAGGGCCGG - Intronic
1166996349 19:46721404-46721426 CCACCAGAGGCTGCCAGCACAGG + Intronic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1168141607 19:54391699-54391721 CCTGCTGTGACAGGCAGCTCAGG - Intergenic
1168340767 19:55621863-55621885 CCTCCAGAGTCTCCCAGCCCCGG + Exonic
1168404141 19:56102170-56102192 CCGGCAGAGCTTGCCAGCTCAGG - Intronic
925578496 2:5385143-5385165 CTTACCGTGACTGCCAGCTCAGG - Intergenic
925747214 2:7053762-7053784 CCTGCTGAGTCTGGCAGGTCTGG - Intronic
926817927 2:16819039-16819061 CCTCCATAGCATGCCAGCTCAGG - Intergenic
928363313 2:30682814-30682836 CCTGCACACACTGCCAGTACAGG - Intergenic
928883293 2:36121763-36121785 TCTGCAAAGACAGACAGCTCTGG + Intergenic
929454332 2:42055347-42055369 TCTGCAGATACTGCCCGCTCCGG - Exonic
929863560 2:45699218-45699240 CCTGCAGGGAGTGACACCTCTGG - Intronic
929920141 2:46165980-46166002 CCTGGAGAGACTCCCCACTCTGG - Intronic
932015637 2:68023912-68023934 CCTGGAGGGAATGCCAGCCCTGG - Intergenic
932308257 2:70719183-70719205 ACTGCAGTGACTGGCAGCCCTGG - Intronic
932404300 2:71503453-71503475 CCTCCAGACACTGCAAACTCTGG - Intronic
932567749 2:72920191-72920213 CCTGGAGAGAAATCCAGCTCCGG + Intronic
932764587 2:74461828-74461850 TCTGCAAAGACTCCTAGCTCTGG + Exonic
933580523 2:84121384-84121406 ACTGCAGAGACAGCCACCTGTGG + Intergenic
935468733 2:103431114-103431136 CCTGCTCAGGCTGCCAGCTTGGG - Intergenic
935649720 2:105371940-105371962 CCTGCAGAGGCTGGAAACTCGGG - Intronic
936152377 2:110028802-110028824 CCAGCAGAGAGTGCCAGAGCTGG + Intergenic
936192302 2:110342610-110342632 CCAGCAGAGAGTGCCAGAGCTGG - Intergenic
937127092 2:119481887-119481909 CATCCAGGGCCTGCCAGCTCTGG + Intronic
937150484 2:119682737-119682759 CCTGGGGAGGCTGACAGCTCTGG - Intronic
938377610 2:130819104-130819126 CCAGCAGCTGCTGCCAGCTCAGG - Intergenic
940517135 2:154697409-154697431 CCTGCAGTGTCTGGCAGCTCAGG - Intergenic
941322528 2:164073296-164073318 TCTGCAGTGCCTGCCAGCACTGG - Intergenic
943677384 2:190729224-190729246 ACTGCAGACACTGGCAGCCCAGG - Intergenic
945993572 2:216416725-216416747 CCAGCAGTGACAGGCAGCTCAGG + Intronic
946929096 2:224655260-224655282 CAAGCAGAGGGTGCCAGCTCCGG - Intergenic
948287063 2:236793952-236793974 CCTGCAAAGCTTGCCAGCTCTGG + Intergenic
948421778 2:237864424-237864446 CCTGCAGAGAGAGCCACCCCGGG - Intronic
948565114 2:238879912-238879934 TCTGCTAAGACTGCCAGCTGGGG + Intronic
1169475509 20:5927895-5927917 AGTGCAGAGACTGCCAGCCTGGG - Intergenic
1171945192 20:31370251-31370273 CCAGCAGAAATTGCCAACTCTGG + Intronic
1173060075 20:39652163-39652185 CTTGCAGAGAAACCCAGCTCTGG - Intergenic
1174133093 20:48359707-48359729 CCTGCTGGGAAAGCCAGCTCTGG - Intergenic
1174181856 20:48679992-48680014 CCTGCTGAGACTCGCAGCTTGGG + Intronic
1175284521 20:57829066-57829088 CCTGCAAGGACTGCCTCCTCCGG - Intergenic
1175920908 20:62450302-62450324 CCTGAAGACCCTGCCAGCCCTGG - Intergenic
1176041350 20:63067516-63067538 GATGCAGAGCCTGCCAGCACCGG + Intergenic
1176373163 21:6074584-6074606 CCTGGACACACTGGCAGCTCTGG + Intergenic
1179057901 21:37952856-37952878 CCTGCAGAGAATACCTGCTCTGG - Intronic
1179272644 21:39863503-39863525 CCTGCATAGCCTCCCGGCTCGGG + Intergenic
1179544999 21:42107837-42107859 GCTTCAGAGACTCCCAGCCCAGG - Intronic
1179750314 21:43463659-43463681 CCTGGACACACTGGCAGCTCTGG - Intergenic
1179991734 21:44951811-44951833 CCTGAAGACACTGCTAGCTAAGG - Intronic
1180791733 22:18578459-18578481 CCAGCAGTGACTGCAAGCTCGGG + Intergenic
1181230003 22:21416850-21416872 CCAGCAGTGACTGCAAGCTCGGG - Intergenic
1181248646 22:21518016-21518038 CCAGCAGTGACTGCAAGCTCGGG + Intergenic
1181416685 22:22764668-22764690 GCTGCAGAGCCTTCCTGCTCTGG + Intronic
1181492217 22:23267696-23267718 GCAGCAGACACTGCCATCTCTGG - Intronic
1181582790 22:23837283-23837305 CTTGCACAGAGTGCCAGCCCCGG + Intronic
1181770596 22:25122489-25122511 CAGGCAGAGAGTGGCAGCTCAGG - Intronic
1184831899 22:46994026-46994048 CCTGCAAAGACTGACAGCTATGG - Intronic
1185079907 22:48703872-48703894 GCTGCAGAGAGTGCCAGAACTGG + Intronic
950530030 3:13548123-13548145 CAGGCACAGGCTGCCAGCTCAGG + Intergenic
953468937 3:43150323-43150345 CCAGCTGGGACTGCCAGCTATGG + Intergenic
954107537 3:48417505-48417527 CCTGAAGAGCCTGGCAGCCCAGG + Intronic
954538271 3:51377451-51377473 CGTGCAGTGACTCCCAGATCAGG + Intronic
955878771 3:63521969-63521991 CCTGGAGAGGCTGCCTGCTTTGG - Intronic
956248938 3:67215280-67215302 CCTGCCTAGCCTGCCACCTCTGG - Intergenic
956865750 3:73367018-73367040 CCTTCAGAGACTGCCTCTTCTGG - Intergenic
958931166 3:100209702-100209724 CCTCCAGAGAATGCTACCTCAGG - Intergenic
959159201 3:102703546-102703568 CCTGCAGAGACTGCCCTAGCAGG - Intergenic
959565922 3:107833262-107833284 CCTTCAGAGCCATCCAGCTCTGG - Intergenic
960699438 3:120426271-120426293 CCTGCAGTGCCTGCCACATCTGG + Intronic
960966860 3:123111431-123111453 CCTGCAGAGGATGCCAGCAGAGG - Intronic
961458052 3:127033915-127033937 CCTGCAGATCCTGGCAGCCCTGG + Exonic
961573318 3:127816050-127816072 CCTGCAGAGACTGACAGAGTGGG + Intronic
964483363 3:157163257-157163279 CAAGCCCAGACTGCCAGCTCTGG - Intergenic
965432349 3:168605331-168605353 CTTGAAGACACTGGCAGCTCTGG - Intergenic
968487729 4:872012-872034 CCTGCAGACACTGGCAGCCTGGG - Intronic
968526317 4:1059421-1059443 CCTGCAGAGACTGCCCTCCTAGG + Intronic
969347221 4:6576946-6576968 CTTGAAAAAACTGCCAGCTCTGG + Intronic
969986515 4:11217297-11217319 GCTGCAGACACTGCCATCACAGG - Intergenic
970961131 4:21872110-21872132 GCTGCAGAGATTCCCAGGTCAGG - Intronic
972538728 4:40020912-40020934 CAAGCTCAGACTGCCAGCTCTGG + Intergenic
974566223 4:63580756-63580778 GCTGCAGAGATTTCCAGCTGTGG - Intergenic
975177221 4:71301685-71301707 GCTGCACAGATTGCCAGCGCAGG + Intronic
975395539 4:73869697-73869719 CCTGCAGGGTCTGCAAGCACTGG - Exonic
975401451 4:73944085-73944107 CCTGCAGGGTCTGCAAGCACTGG + Intergenic
975409950 4:74038363-74038385 CCTGCAGTGTCTGCAAGCACTGG + Exonic
975415335 4:74098872-74098894 CCTGCAGGGTCTGCAAGCACTGG + Exonic
976073707 4:81272765-81272787 CCTGAAGAGTCTTCCAGCTTGGG + Intergenic
979865169 4:125744954-125744976 CAAGCAGAGAGAGCCAGCTCCGG - Intergenic
982064436 4:151640712-151640734 GGTGCAGAGCCTCCCAGCTCTGG + Intronic
984266105 4:177499636-177499658 CAAGCAGAGAGAGCCAGCTCTGG - Intergenic
985130318 4:186732573-186732595 CCTACAGAGAGAGCAAGCTCTGG + Intergenic
985548302 5:520832-520854 CTTGCAGAGACTGCCAGGCCTGG - Intronic
985705950 5:1401506-1401528 CCTGAAGATGCTGCCTGCTCTGG - Intronic
985992303 5:3573637-3573659 TCTGCAGAGACTGCCTGCAAGGG + Intergenic
986452310 5:7878842-7878864 CATTCAAAGACTGCCTGCTCTGG - Intronic
993537630 5:89106185-89106207 TCTGCAAAAACTGCCAGCTGTGG - Intergenic
994716675 5:103329777-103329799 TCTGCAGAGGCAGGCAGCTCGGG + Intergenic
995215354 5:109588977-109588999 CAAGCCCAGACTGCCAGCTCTGG + Intergenic
996796749 5:127355950-127355972 CCTGCAAAGACTGCAATTTCAGG - Intronic
997984754 5:138493047-138493069 CCTGCTCAGCCTGACAGCTCTGG + Intergenic
1001519000 5:172377401-172377423 CCAGCTGAGACTGCCTGCTGTGG + Intronic
1002005059 5:176225748-176225770 CCTGCATAGATTGCCTACTCTGG - Intergenic
1002221316 5:177684877-177684899 CCTGCATAGATTGCCTACTCTGG + Intergenic
1003198901 6:3940850-3940872 CCTGCACAGACAGGCAGCCCAGG + Intergenic
1003351879 6:5325442-5325464 CCTGCACAGACAGGCAGCCCAGG - Intronic
1003354343 6:5352572-5352594 TCTGCAGAGAAGACCAGCTCTGG + Intronic
1003775107 6:9351614-9351636 TCTCCAGAGACTGACAGGTCAGG - Intergenic
1004516101 6:16323571-16323593 TCTGCAGAGGCTGCCAGGCCTGG + Intronic
1004550169 6:16639182-16639204 CCAGCAGAGACAACCCGCTCGGG + Intronic
1004953330 6:20699706-20699728 CATGCAGAGATTGAGAGCTCCGG - Intronic
1005997695 6:30941340-30941362 ACTGTAGAGGCTGCCAGCCCTGG + Intronic
1006511874 6:34525946-34525968 CCAGGAGAGAGAGCCAGCTCTGG + Intronic
1006796029 6:36732881-36732903 CATCCAGAGACTGACAACTCAGG - Exonic
1007248448 6:40479341-40479363 ACTGCAGCCACTGTCAGCTCAGG - Intronic
1008410649 6:51174699-51174721 CCTGAAGAGGCTGCAGGCTCTGG + Intergenic
1011825777 6:91303526-91303548 CCAGCAGAGAGAGCCAGCTCTGG + Intergenic
1014009236 6:116457919-116457941 CAAGCCCAGACTGCCAGCTCTGG - Intergenic
1014543958 6:122710691-122710713 CCTTCACAGACTGCCAGTTAAGG + Intronic
1014642464 6:123929409-123929431 TCTGCATAGAATGCCAGATCTGG - Intronic
1018395640 6:163376291-163376313 ACAGCACAGCCTGCCAGCTCAGG + Intergenic
1018433438 6:163741679-163741701 CCTGAAGACACAGCCAGCTGCGG + Intergenic
1018734790 6:166679722-166679744 CCAGCAGAGAGAGCCGGCTCCGG - Intronic
1018850115 6:167581612-167581634 CATGGAGAGACTGTCTGCTCAGG + Intergenic
1018956310 6:168412719-168412741 CCTGGAGACACAGCCACCTCCGG - Intergenic
1019146688 6:169980040-169980062 CCTGCAGAGCCTGCCACCTCCGG - Intergenic
1019464563 7:1180228-1180250 CTTGCAGAGACAGGCAGCTAGGG + Intergenic
1019475702 7:1243060-1243082 TCTGCAGAGCCGCCCAGCTCAGG + Intergenic
1020531818 7:9347746-9347768 CCTGCAGAGACTGAAAGATAAGG + Intergenic
1020571196 7:9864495-9864517 ACTGCAGAGAATCCCTGCTCTGG + Intergenic
1020675958 7:11185405-11185427 CCTACAGAGACTGGGAGCTAGGG + Intergenic
1021105028 7:16628469-16628491 TCTGTAGAGACTCCCAGCTAAGG - Intronic
1021313654 7:19119220-19119242 CCTGCTGAGACTCGCAGCTTTGG + Intergenic
1023522828 7:41065909-41065931 CCAGCAGGGTTTGCCAGCTCAGG + Intergenic
1023780405 7:43650143-43650165 TCTGCAGAGTCCGACAGCTCAGG - Exonic
1023870279 7:44259511-44259533 CCTGCTGACCATGCCAGCTCTGG - Intronic
1024675197 7:51631890-51631912 CCTGCTGGGACTGCCAGGTCAGG + Intergenic
1025023835 7:55499834-55499856 CCTGCAGAAACAGCCAGACCAGG - Intronic
1027237494 7:76306708-76306730 CCAGCAGAGACCCCCAGATCTGG - Intergenic
1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG + Intergenic
1032089574 7:128904487-128904509 CCTGCAGAGTAAGCCAGCTCTGG - Intronic
1032533435 7:132640493-132640515 CATGCAGAGATAGCAAGCTCTGG - Intronic
1033607950 7:142941255-142941277 CCTCCAGCCGCTGCCAGCTCTGG - Exonic
1034426626 7:151017451-151017473 CCTGGACTGATTGCCAGCTCGGG + Intronic
1034672820 7:152870889-152870911 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034672832 7:152870941-152870963 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034672844 7:152870993-152871015 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034672856 7:152871045-152871067 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1035337361 7:158138465-158138487 CCTGCAGAGGCAGCCGGCTGAGG - Exonic
1036655510 8:10674639-10674661 CCTGCAGAGACCACAAGGTCGGG + Exonic
1044727384 8:95204484-95204506 TCTGCAAAGACCGACAGCTCTGG - Intergenic
1045987726 8:108268407-108268429 CCTCCAGACAGAGCCAGCTCTGG - Intronic
1046187374 8:110739531-110739553 CATGGAGGGTCTGCCAGCTCAGG + Intergenic
1046694168 8:117319850-117319872 CCTGCAAAGACAGAGAGCTCTGG + Intergenic
1046728437 8:117699274-117699296 CTGACAGAGACTTCCAGCTCAGG - Intergenic
1047512990 8:125529637-125529659 CCCCCAGACATTGCCAGCTCTGG + Intergenic
1049037374 8:140087014-140087036 CCTGCAAGCACTGCCTGCTCGGG + Intronic
1049663349 8:143830370-143830392 ACTGCAGTGCCTGCCAGCCCCGG - Intergenic
1049746223 8:144264437-144264459 CCTGCATAGACAGCCGGGTCAGG + Exonic
1049804519 8:144532868-144532890 CCTGCAGAGACGGCCACCAGGGG - Intronic
1049922643 9:379698-379720 CCTGGAGAAACTTCCACCTCAGG + Intronic
1053425520 9:38007539-38007561 CCTCCAAAGAATGCCAGATCTGG - Intronic
1053473438 9:38363769-38363791 CCTCCAGAGGGTGCCAGCCCTGG - Intergenic
1056329718 9:85511332-85511354 CCTTCAGAGCTTGCCAGCTGGGG - Intergenic
1057869208 9:98706194-98706216 GCCGCTGAGCCTGCCAGCTCAGG + Intronic
1060478424 9:124001676-124001698 CCTGCAGAACCTCCCATCTCGGG - Intronic
1061614610 9:131771763-131771785 CAAGTGGAGACTGCCAGCTCTGG - Intergenic
1061805581 9:133135841-133135863 CCTGCAGAGGATGCCACCTTGGG - Intronic
1062148445 9:135004475-135004497 CCTGGAGAGGATCCCAGCTCTGG - Intergenic
1188196079 X:27236216-27236238 CTTGAAGATACTGCCAGCTACGG + Intergenic
1188479903 X:30626663-30626685 CTTGCAGAGACCTCCAGCTTAGG - Intergenic
1189440485 X:41031467-41031489 GCTGCAAAGACTGCAATCTCTGG - Intergenic
1190622784 X:52304752-52304774 GCGGCAGAGAATGCCAGATCAGG + Intergenic
1195942660 X:110178557-110178579 CCTGCACTGGCTGCCAGGTCTGG - Intronic
1197264021 X:124347031-124347053 GCTGCAGAGAATGCCATTTCGGG + Intronic
1199097230 X:143757602-143757624 CCAGCAGAGGGAGCCAGCTCCGG + Intergenic
1199157957 X:144572303-144572325 GCTGCAGACAATGCCAGCCCAGG + Intergenic
1199744290 X:150762013-150762035 CCTGCCGGCACTGCCCGCTCCGG + Intronic
1200094578 X:153651185-153651207 GCTGCAAAGACTGCCAGCCCTGG - Exonic