ID: 1163653367

View in Genome Browser
Species Human (GRCh38)
Location 19:18531828-18531850
Sequence GTGGGGGGCTGGCACTCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163653356_1163653367 1 Left 1163653356 19:18531804-18531826 CCTGGACAGGGGGCGGCAGGCGG 0: 1
1: 0
2: 3
3: 46
4: 373
Right 1163653367 19:18531828-18531850 GTGGGGGGCTGGCACTCAGGCGG 0: 1
1: 0
2: 1
3: 34
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163653367 Original CRISPR GTGGGGGGCTGGCACTCAGG CGG Exonic
900204341 1:1425720-1425742 GTGGGGGGCTGGCCTCCAGGTGG + Intergenic
900225676 1:1532682-1532704 GTGGGGTGCAGCCACTCGGGTGG + Intronic
900420202 1:2552979-2553001 TTGGAGGGCTGGAACCCAGGTGG + Intergenic
900424229 1:2568679-2568701 TTGGAGGGCTGGAACCCAGGTGG - Intergenic
900632085 1:3642328-3642350 GTGTGGTGCTGGCACATAGGTGG + Intronic
901663571 1:10813995-10814017 GGAGGGCGCTGGCACTCTGGGGG - Intergenic
901768786 1:11520068-11520090 GTGAGTGGCTGGCACACAGCAGG - Intronic
901788700 1:11641841-11641863 GGAGGGGGCTGGCACCAAGGAGG - Intergenic
901810761 1:11765808-11765830 TTGGGTGGCTGGCACTCAGGTGG - Intronic
902243239 1:15102455-15102477 GTGGGGTGCTGGCTTTGAGGTGG + Intronic
902271683 1:15309513-15309535 GTGGTGGGGAAGCACTCAGGGGG + Intronic
902695049 1:18134634-18134656 GAGGGGGGTGGGCACTGAGGAGG - Intronic
902873481 1:19327580-19327602 CTGGGTGCCTGGCACACAGGAGG - Intronic
902917238 1:19646056-19646078 TTTGGGGGCTGGCACAGAGGTGG + Intronic
903221612 1:21872691-21872713 CTGGGTTGCTGGCACTCAGGTGG + Exonic
903320729 1:22541644-22541666 GTGGGGGCCTGGCCCAGAGGAGG - Intergenic
903692780 1:25186016-25186038 CTGGGGGGCTGGGACTTAGGTGG - Intergenic
903799381 1:25955227-25955249 GTAGGTGGCTGGCAGTTAGGAGG + Intergenic
904253548 1:29240642-29240664 GGGAGGGGCTGGCAGGCAGGAGG - Intronic
904298792 1:29541023-29541045 GTAGGGGGCGGGCAGTCAGGAGG - Intergenic
904876447 1:33658173-33658195 CTGGGTGTCTGCCACTCAGGAGG + Intronic
905678017 1:39843488-39843510 GGGTGGGGCTGGCCCTGAGGTGG + Intronic
905868664 1:41390627-41390649 CAGGAGGGCTGGCACTCTGGGGG + Intergenic
906241175 1:44243121-44243143 GTGGGGGCCTGGGCCCCAGGGGG - Intronic
906802222 1:48748376-48748398 GCACAGGGCTGGCACTCAGGAGG - Intronic
907328384 1:53655737-53655759 ATGGGGGTCTGGCACACAGCAGG + Intronic
907927921 1:58972084-58972106 GTGGAGAGCTGGCCCTGAGGAGG - Intergenic
912491695 1:110066032-110066054 GTGGAGGCCTGGCCCTGAGGAGG + Intronic
913112790 1:115671319-115671341 GAGGGGCGCGAGCACTCAGGTGG + Intronic
913479757 1:119276700-119276722 CTGTAGGGCAGGCACTCAGGAGG + Intergenic
915281626 1:154826554-154826576 GTGGGGTGCTGGGACACAGGCGG - Intronic
915822992 1:159045396-159045418 GTGTGGGGATGGCTCTCAGCTGG - Exonic
915823352 1:159049531-159049553 GTGTGGGGATGGCTCTCAGCTGG - Intronic
917602809 1:176594738-176594760 GTATGTGGATGGCACTCAGGTGG + Exonic
918176328 1:182048885-182048907 GTGGGGGACTTTCACTCAGCTGG + Intergenic
918950133 1:191126100-191126122 AGGAGGGGCTGGCAGTCAGGAGG - Intergenic
918962880 1:191303183-191303205 GTGAGGAGCTGGTAGTCAGGGGG + Intergenic
919704446 1:200663134-200663156 GTTGGGGAAGGGCACTCAGGGGG - Intronic
920505356 1:206511845-206511867 ATCGGGGGCTGTCACGCAGGCGG - Intronic
920511741 1:206557071-206557093 GGGGGCGGGTGGCACCCAGGCGG + Intronic
922493866 1:226040778-226040800 GTGGGGGCCTGGGAGTGAGGTGG - Intergenic
922851186 1:228735425-228735447 GTGGGGGGCGGGCAGGCGGGCGG - Exonic
923525660 1:234770588-234770610 CTGGGGGCCTGGCACACAGCAGG - Intergenic
1063322891 10:5068701-5068723 GGGGGTGGCAGGGACTCAGGGGG + Intronic
1063385889 10:5616293-5616315 CGGGGTGGGTGGCACTCAGGGGG - Intergenic
1064724525 10:18264989-18265011 GTAGGGGGGAGGCACACAGGTGG - Intronic
1065061295 10:21903813-21903835 GTGGGGGGTTGGAAATCAGATGG + Intronic
1066153581 10:32650920-32650942 GGGAGGGGCTGGCAGGCAGGTGG + Intronic
1066711005 10:38233753-38233775 GTGTGGGTCTGGCCCTCAGCAGG + Intergenic
1067103779 10:43351484-43351506 GTGGGGGTCTGGAATGCAGGGGG - Intergenic
1069618314 10:69820440-69820462 CTGGGGGCCTGGCACCCAGAAGG - Intronic
1069753558 10:70760260-70760282 GTGGAGGGCGGGCAGTCAGTGGG + Intronic
1069834410 10:71299563-71299585 GTTGGGGGCGGGCAGGCAGGAGG + Exonic
1070565345 10:77599869-77599891 GAGGAGGGGTGGCACACAGGAGG - Intronic
1070773525 10:79096706-79096728 GCAGGGGGCTGGCACCCAGCAGG - Intronic
1070802012 10:79249317-79249339 GTAGTGGGCTGACACCCAGGTGG - Intronic
1071458288 10:85868035-85868057 GGGTGGGGCTGATACTCAGGTGG + Intronic
1072336721 10:94403695-94403717 GTGTGGGGCTGGCACGGAAGCGG - Intronic
1072617819 10:97060956-97060978 GTGGGTGCCTGGCACACAGCAGG + Intronic
1072834381 10:98695489-98695511 GTGAATGGCTGGCACTCAGTAGG - Intronic
1073350838 10:102818698-102818720 CTGGTGGGCTGGCACCCAGGGGG + Intergenic
1073571186 10:104582392-104582414 GACGGTGGCTGGCACTCAGTGGG - Intergenic
1074229326 10:111517772-111517794 TTTGGTGGCTGGCACTTAGGAGG + Intergenic
1075516437 10:123112533-123112555 CAGGGGGGCTGGCACACAGGGGG - Intergenic
1076763147 10:132615694-132615716 GTGGGCAGCTGGGACTGAGGTGG + Intronic
1077155231 11:1088152-1088174 GTGGGGGGCTGGCCAGGAGGGGG - Intergenic
1077223150 11:1426191-1426213 ATGGGGGCCTGGCACACAGCGGG + Intronic
1077478202 11:2800901-2800923 GTGGCTGGCAGGCACTCATGAGG + Intronic
1077480826 11:2813668-2813690 GTGGTGGGCTGTCACTCCGGAGG + Intronic
1078725953 11:13931269-13931291 GAGGAGGTCTGGCACACAGGTGG - Intergenic
1078933315 11:15929815-15929837 GTGGGGCCCTGGCTCTCATGTGG + Intergenic
1079317253 11:19419112-19419134 CTGGGGGGCTGGCACTGTGCTGG + Intronic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1080750039 11:35142716-35142738 GTGGGAGGCTGGCAGCCAGTAGG + Intronic
1081531998 11:43968313-43968335 GTAGGGGACTGGGGCTCAGGGGG - Intergenic
1081566712 11:44265012-44265034 GTCTGGGGCTGGCAGTCACGTGG - Exonic
1081657675 11:44868185-44868207 GTTGGAGGCTGGAACCCAGGTGG + Intronic
1082809023 11:57467535-57467557 TTGGGGGGCTGGCCCCCAGCTGG + Intronic
1083882922 11:65557457-65557479 TTGGGAGGCTGGAACTCTGGGGG - Intronic
1083945431 11:65920308-65920330 AGGAGGGGCTGGCACTCAAGAGG - Intronic
1084013235 11:66364182-66364204 GTGGGGGGCTGGGAGTAGGGAGG - Intronic
1084225144 11:67711050-67711072 ATGGGGGGCGGGGCCTCAGGAGG + Intergenic
1084309714 11:68309838-68309860 GTGGGGGCCTGGCCAGCAGGTGG - Intergenic
1084720486 11:70902486-70902508 CTTGGGGGCTGCCTCTCAGGGGG + Intronic
1084795634 11:71502739-71502761 GTGGGGGGGGGGCACTCGGCAGG + Intronic
1085711350 11:78831640-78831662 CAGCGGGGCTGGCACACAGGAGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086752541 11:90515567-90515589 GTGGGGGGCTGGCTGGCAGGTGG + Intergenic
1091266942 11:134277909-134277931 GTGAGGGGCCGGCACTCACGTGG - Exonic
1091387336 12:103515-103537 GAGGGGAGGTGGGACTCAGGAGG + Intronic
1091387406 12:103703-103725 GAGGGGAGGTGGGACTCAGGAGG + Intronic
1091449206 12:562169-562191 GTGGGGAGCTGGCGGGCAGGGGG + Exonic
1091809965 12:3389016-3389038 GTGTGGTGCTGGCAAGCAGGTGG - Intronic
1091832240 12:3557990-3558012 GGGGTGGGCTGGCACTGAGAGGG - Intronic
1093066091 12:14659802-14659824 GAGGGGGCCTGGCAGACAGGTGG - Intronic
1094417703 12:30235016-30235038 GAGGGTGGCTGGCAGTGAGGAGG - Intergenic
1095980713 12:47973106-47973128 GCTGGGGGCAGTCACTCAGGGGG + Exonic
1096195660 12:49647420-49647442 GGGAGGGGCTGACACTGAGGTGG + Intronic
1096259136 12:50080128-50080150 GGCGGGGGCTGGCAGGCAGGGGG + Intronic
1096795563 12:54075507-54075529 GTGGAGGCCTGGCAGTAAGGGGG - Intergenic
1099443263 12:82723891-82723913 AAGTGGGGCTGGAACTCAGGTGG - Intronic
1100269541 12:93011473-93011495 GTGGGTGGCTGGGACTCCGCAGG + Intergenic
1101325119 12:103709026-103709048 GTCAGGGGATGGCACTCTGGGGG + Intronic
1101834585 12:108286501-108286523 GTGGGGGGCTGGCTGCAAGGAGG - Intergenic
1101865624 12:108517651-108517673 GTGTGGGGCTGATCCTCAGGTGG + Intronic
1101884245 12:108648113-108648135 GTGTGGGGCTGGCAACAAGGGGG - Intronic
1101994075 12:109512121-109512143 AAGGGGGTCTGGCATTCAGGAGG + Intronic
1102547610 12:113667865-113667887 TAGGGGGGCTGGCACACAGTAGG + Intergenic
1103544622 12:121691085-121691107 GTGGGAGGCTGGAAGGCAGGAGG - Intergenic
1103967323 12:124648070-124648092 GGGGGGGTGTGGCACTGAGGGGG - Intergenic
1106181311 13:27371912-27371934 CTGGAGGGCGGGCACTCAGGGGG + Intergenic
1107397413 13:40032019-40032041 GTGGAGTGCAGGCAATCAGGGGG + Intergenic
1107483876 13:40808117-40808139 GTAGGGGGTTGCCACTCAGCTGG + Intronic
1107992678 13:45832085-45832107 GTGGGGTGCAGCCACCCAGGTGG + Intronic
1108107532 13:47027852-47027874 GTCGGGGGCCTGCAGTCAGGGGG + Intergenic
1109058548 13:57582704-57582726 ATTGGGGGCTGGCAGGCAGGAGG + Intergenic
1109214375 13:59571396-59571418 TTGGGGGGCTGGGTTTCAGGTGG - Intergenic
1109450416 13:62507105-62507127 TTGGGAGGCTTGAACTCAGGAGG - Intergenic
1110862143 13:80355719-80355741 CTGGTGGGCTGGCACTGCGGGGG - Intergenic
1112202078 13:97286658-97286680 GTGGGGGGCTGGGGAGCAGGTGG - Intronic
1113508285 13:110831851-110831873 GTGGGTGGATGGCAGCCAGGAGG + Intergenic
1113961812 13:114130519-114130541 GTGGGGGTCAGGCACCCTGGAGG - Intronic
1116685776 14:48036264-48036286 CTGGGGGTGTGGCTCTCAGGTGG + Intergenic
1117029205 14:51651793-51651815 GTCGGGGGCGGGGTCTCAGGGGG + Intronic
1118603049 14:67483719-67483741 GGTGTGGGCTGGCAGTCAGGGGG - Intronic
1121103773 14:91267613-91267635 GTGGGGCCCTGGAACTCAGGAGG + Intergenic
1122143060 14:99673903-99673925 GAGGGGGGCTGGCACCAAGAGGG + Intronic
1122272892 14:100576266-100576288 GTGTGCTGCTGGCCCTCAGGTGG - Intronic
1122347166 14:101067672-101067694 GAGGGGGGCTGCCACTCTGAGGG - Intergenic
1122611843 14:102989735-102989757 GTGGCGGGCGGCTACTCAGGAGG + Intronic
1123449170 15:20349578-20349600 GTCTGGGGCTGACACCCAGGAGG - Intergenic
1126194548 15:45917681-45917703 CTGGGGGCCTGGCACTCAGCTGG + Intergenic
1128943251 15:71805595-71805617 GTGGGGGGCAGGAATTCGGGGGG + Intronic
1128976195 15:72155511-72155533 GTGGAGGTCAGGCACGCAGGCGG + Intergenic
1129599258 15:76988760-76988782 GTGGGGGTGTGGCGCTCAGATGG - Intergenic
1130704337 15:86218426-86218448 GTGGGGGACAGACTCTCAGGTGG + Intronic
1131166187 15:90143707-90143729 GTGAGAGGCAGGGACTCAGGAGG - Intergenic
1132602919 16:781901-781923 ATGAGGGCCTGGCACTCTGGAGG + Intronic
1133288895 16:4704981-4705003 GTGGGTCGCTGGACCTCAGGTGG - Intronic
1134060946 16:11199136-11199158 CTTGGGGACTGGCACCCAGGGGG + Intergenic
1135611560 16:23872003-23872025 AATGGTGGCTGGCACTCAGGGGG + Intronic
1135800357 16:25488750-25488772 GTGGGGTGCTGGCAGGCACGGGG + Intergenic
1136384186 16:29912367-29912389 GGGGAGGGCTGGCCCTGAGGAGG - Intronic
1137364446 16:47848704-47848726 GTGGAGGGGAGGCACACAGGGGG + Intergenic
1138337764 16:56266673-56266695 GGGAGGGTCTGGCACTCAGTAGG - Intronic
1138475566 16:57268982-57269004 GGGTGGGGCTGGCACTGACGTGG - Intronic
1140596015 16:76413235-76413257 GTGGGGGGCTTGCAGGGAGGTGG - Intronic
1143106775 17:4534129-4534151 GTGCCAGGCTGGCACTGAGGTGG + Intronic
1143282484 17:5765251-5765273 GAGTGGGGCTGGGAGTCAGGTGG - Intergenic
1143426450 17:6843036-6843058 GATGGGGGCTGGCACAAAGGAGG + Intergenic
1143781162 17:9230453-9230475 ATATGGGGCTGGCACTCGGGGGG - Intronic
1144286859 17:13785387-13785409 GGGGGGTGCTGGCAGTAAGGGGG + Intergenic
1145810699 17:27762291-27762313 GTGGGTGCCTGGCACTGGGGTGG - Intronic
1146603598 17:34239037-34239059 GTGGGTGGCTGGGGCTCAGGAGG - Intergenic
1147187852 17:38722263-38722285 GTGGGGGGCTGGCTCTGGGAAGG + Intronic
1147382751 17:40065294-40065316 GTGGGGCGCAGGAACTCAGCTGG - Intronic
1147736607 17:42642757-42642779 GTGGGGGGCAGGAATTGAGGGGG - Intergenic
1147997542 17:44368996-44369018 GTGGTGGGCTGGCACTGCTGGGG - Intergenic
1148562059 17:48611947-48611969 GTGGGGGGCAGGCATAAAGGTGG - Intronic
1148617943 17:49014266-49014288 CTGGGGGGCTGAGACTGAGGGGG - Intronic
1148617957 17:49014308-49014330 CTGGGGGGCTGAGACTGAGGGGG - Intronic
1148804452 17:50257283-50257305 GTGAGGGACTGGGGCTCAGGTGG + Intergenic
1149780884 17:59395595-59395617 CTGGGGGCCTGGCAGTTAGGTGG + Intronic
1150656391 17:67042505-67042527 CTGGGTGCCTGGCACTCAGTAGG + Intergenic
1150724332 17:67639303-67639325 GTGTGGAGCTGGCACTCAGTAGG - Intronic
1151215046 17:72571566-72571588 GTGGGGTGAAGGCACTCACGGGG - Intergenic
1151247548 17:72806505-72806527 ATAGTGGGCTGGCACTTAGGGGG + Intronic
1151481986 17:74374987-74375009 CTGGGGGGCTGTCTTTCAGGAGG + Intergenic
1151733290 17:75923414-75923436 GTGGAGTGCTGGCTCGCAGGAGG + Exonic
1152167197 17:78717330-78717352 GTGTCCGGCTGGCAGTCAGGGGG + Intronic
1152243841 17:79175148-79175170 ATGGGGGTCTGACACGCAGGTGG + Intronic
1152339478 17:79716286-79716308 GTGTGGGGCTGACACCCAGGAGG + Intergenic
1152412749 17:80137295-80137317 GTGTGGGGCCTGCACTTAGGCGG + Intronic
1152604642 17:81282985-81283007 GTGGGGGGCAAGCACGGAGGAGG + Intronic
1152656816 17:81523685-81523707 GTCAGGGCCTGGCACTGAGGTGG + Intronic
1152680476 17:81665382-81665404 GTGGGCGGCTGGAGCTCAGGTGG + Exonic
1152916407 17:83039094-83039116 GTGGGCAGCGGGCACTCAGGAGG - Intronic
1153971742 18:10233581-10233603 GTGGGAGGGTGGCATGCAGGTGG - Intergenic
1157566428 18:48681744-48681766 GTGTGGGGCAGGCAGGCAGGTGG - Intronic
1158139445 18:54241655-54241677 GTGGGGGTATGGGCCTCAGGGGG + Intergenic
1158285122 18:55872053-55872075 GTGGGGGGCTGGGAGGAAGGTGG + Intergenic
1158900027 18:61953811-61953833 GTGGGGAACTGGCACTTTGGTGG + Intergenic
1160710747 19:549925-549947 GAGGTGGGCTGGGACTCAGGCGG - Intergenic
1160776588 19:859429-859451 GTGGGGGGCAGTCCCTCAGATGG - Intergenic
1161203040 19:3026356-3026378 GAGAGGCGCTTGCACTCAGGAGG + Intronic
1162034032 19:7929675-7929697 GGGGGGGGCTGGGAGTCAAGTGG - Intronic
1162753079 19:12840710-12840732 TTGGGGGGCGGAGACTCAGGTGG + Intronic
1162950229 19:14067708-14067730 GTGTGGGCCTGCTACTCAGGAGG - Intergenic
1163653367 19:18531828-18531850 GTGGGGGGCTGGCACTCAGGCGG + Exonic
1163819178 19:19486484-19486506 GTGGGCGGCTGGCTCTGAAGAGG + Intronic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165438895 19:35812652-35812674 GTGGGGGCCAGGCACACAGCCGG + Exonic
1166016057 19:39980198-39980220 GTTGGGGGCTGGCACCTAAGGGG + Intronic
1166364974 19:42273766-42273788 TAGGGGTGCTGGCGCTCAGGTGG - Intronic
1166678519 19:44753921-44753943 TTGGGGACCTGGCACTCAGAGGG + Intronic
1167105617 19:47428631-47428653 GTGGGAAGCTGGGATTCAGGAGG - Exonic
1167293152 19:48635525-48635547 GGGCGGGGCTTGGACTCAGGGGG - Intronic
1167375521 19:49108867-49108889 GTGGGGGGCTGGGAATTAGGAGG + Intergenic
1167468341 19:49662102-49662124 GTGGGGGACTGGCTCTCTGGCGG - Exonic
1167576245 19:50319322-50319344 GTGGGAGGCTGGAAGTTAGGAGG - Intronic
926008091 2:9388458-9388480 GAGGTGGGCTGCCACTCAGGAGG - Exonic
926141662 2:10371710-10371732 GTGCCTGGCTGACACTCAGGTGG - Intronic
927271753 2:21217799-21217821 TGGAGGGGCTGGCATTCAGGAGG + Intergenic
927576575 2:24206499-24206521 GTTGGGGCCTGGCATTCATGTGG + Intronic
927810213 2:26176226-26176248 GTGTGGAGCTGTCCCTCAGGGGG + Intronic
929539493 2:42809353-42809375 GGAGGTGGCTGGCACTCTGGAGG + Intergenic
929852053 2:45600911-45600933 GTGGCAGGTTGGCATTCAGGTGG - Intronic
930124068 2:47782977-47782999 GGGCGGGGCTGGCACGCTGGCGG - Intronic
930124078 2:47783004-47783026 GGGCGGGGCTGGCACACTGGTGG - Intronic
930720083 2:54630042-54630064 GTGGGAGGCTGGCACACTGCTGG - Intronic
930953841 2:57179100-57179122 GTGGGGGGCTGGTAGGGAGGTGG - Intergenic
931717034 2:65037436-65037458 GGGGAGGGATGGCAATCAGGAGG - Intergenic
932463216 2:71896749-71896771 GAGCAGGGCTGGCGCTCAGGTGG - Intergenic
934762452 2:96864162-96864184 GTGGGGGGCAGGCCATCAGCAGG + Intronic
935265035 2:101386972-101386994 GAGGGGGCCTGGCATTCAGGCGG - Intronic
935296692 2:101656153-101656175 GTGGGGGACTCACACTGAGGGGG - Intergenic
935656323 2:105426670-105426692 AGGGGGGCCAGGCACTCAGGCGG + Intronic
936060714 2:109293966-109293988 GTGGGGGTCTAGCATCCAGGGGG + Intronic
937319848 2:120954634-120954656 GAGGGAGGCTGGCCCTCAGCAGG - Intronic
937392146 2:121498308-121498330 GTGGTGGGGTGGCCCTGAGGTGG - Intronic
937471034 2:122174161-122174183 TTTGGGGGCTGGAACTGAGGAGG - Intergenic
937643740 2:124243030-124243052 GTGTGGGGCTGGGACTGGGGAGG - Intronic
938033294 2:128014344-128014366 ATGGGAGGATGGCACTCAGGAGG - Intronic
938033300 2:128014372-128014394 ATAGGAGGATGGCACTCAGGAGG - Intronic
938033305 2:128014400-128014422 ATGGGAGGATGGCACTCAGGAGG - Intronic
938033311 2:128014428-128014450 ATGGGAGGATGGCACTCAGGAGG - Intronic
940854390 2:158718440-158718462 AGGGGAAGCTGGCACTCAGGGGG - Intergenic
941228188 2:162875373-162875395 GTGGGGGGCTGGCAGGGAGGTGG + Intergenic
942669719 2:178361884-178361906 ATGGGGGGCTGGCAGGGAGGTGG + Intronic
944580257 2:201125958-201125980 TTGCAGGGCTGGCAGTCAGGAGG + Intronic
946025503 2:216669634-216669656 GTGGGGGGCCGACAAGCAGGTGG + Intergenic
948159651 2:235813566-235813588 GGGGCGGGCAGGCAGTCAGGCGG + Intronic
1170208212 20:13822423-13822445 GTCGGGGACTGGGAGTCAGGTGG + Intergenic
1172703365 20:36865472-36865494 GTGAGGAGCAGGCACTCAGCAGG + Intergenic
1173836467 20:46129126-46129148 GTGAGGGGCTGGCACTGACTGGG + Exonic
1173943355 20:46930973-46930995 GTGGGAGGCTGGCACCCATTAGG + Intronic
1174421597 20:50402540-50402562 CTGGGGACCTGGCACACAGGAGG + Intergenic
1174530060 20:51204485-51204507 GTTGGGGGCAGGCAGCCAGGGGG + Intergenic
1174632685 20:51971972-51971994 GTGGGGGAATGGCAGCCAGGTGG + Intergenic
1175232504 20:57482718-57482740 GTTGGAGGCTGGGACACAGGAGG - Intergenic
1175951858 20:62587856-62587878 GGGGGGCGCAGGCACTGAGGAGG + Intergenic
1176139697 20:63539560-63539582 GTGGGGGGCAGGGTCTCCGGGGG + Intergenic
1176637300 21:9258426-9258448 GTGGGGGGGTGGCAGTCTTGTGG + Intergenic
1176742025 21:10613671-10613693 GTGAGGGGTTGCCACTCAGCTGG - Intergenic
1178391047 21:32198634-32198656 GTGAGGGGCTGTCCCTGAGGAGG + Intergenic
1178436894 21:32567656-32567678 GGGAGGGGCTGGCAGGCAGGTGG + Intergenic
1178518365 21:33266951-33266973 AGGGAGGGCTGGCACTGAGGGGG - Intronic
1178606069 21:34037074-34037096 GTGGGGAGGTGGCACCCGGGGGG + Intergenic
1178892441 21:36531372-36531394 CTGGGAGGCTGGAACCCAGGAGG - Intronic
1179519146 21:41930936-41930958 GGGAAGGGCTGGCTCTCAGGTGG + Intronic
1181395530 22:22618618-22618640 GCGGGTGGCTGGGACTCTGGCGG - Intergenic
1181811852 22:25408049-25408071 GTGGGGGCCTGGCCAGCAGGTGG + Intergenic
1182057655 22:27372576-27372598 GTGGGGTCCTGGTACCCAGGAGG - Intergenic
1182829848 22:33296189-33296211 ACGGGGGCCTGGCACTAAGGAGG + Intronic
1183362815 22:37391465-37391487 GCGGGGGCCTGGCACACAGCGGG - Intronic
1183475073 22:38031628-38031650 GTGAGGAGCTGCCACTCAGCCGG - Intronic
1183858542 22:40652772-40652794 GTGGGGGCCTGGCACAGAGCAGG - Intergenic
1184148386 22:42624583-42624605 GTGGGGGGCGGGGAGTCGGGTGG - Intronic
1184243527 22:43223818-43223840 GTGCGAGGCTGTCACTCATGAGG - Intronic
1184521947 22:44999841-44999863 GTGGGGCGCTGGCTCTGAGCAGG - Intronic
1185139017 22:49089887-49089909 GGAGGCGGCTGGCACGCAGGAGG + Intergenic
953604740 3:44404382-44404404 ATGGGTGCCTGGCACACAGGGGG + Intronic
954133693 3:48572472-48572494 GTGTGGGGCTGCCAGTGAGGGGG - Intronic
954614785 3:51964117-51964139 GAGGGGGCCTGGGAGTCAGGAGG - Intronic
955281269 3:57597047-57597069 GTGAGGGGCTGCGAGTCAGGCGG - Intronic
955874074 3:63471899-63471921 GTGGGTGGCTGACAATTAGGAGG + Intronic
957078397 3:75618835-75618857 ATGGGGGGCGGGGCCTCAGGAGG + Intergenic
958673330 3:97232855-97232877 GTGGCCTGCTGGCACTCGGGAGG + Intronic
959108921 3:102098352-102098374 GTGCAGGGCTGGCAGTCATGAGG + Intergenic
960973970 3:123157858-123157880 GTGGTGGGCTGGCAAGCAGGTGG + Intronic
961811901 3:129526898-129526920 GTAGGGGGCTGGAGCCCAGGTGG + Intergenic
962313108 3:134339728-134339750 CCTGGGGGCTGGGACTCAGGTGG - Intergenic
962410861 3:135140787-135140809 GCGCGGGGCTGGCATGCAGGGGG - Intronic
963843558 3:150132259-150132281 GTGGGGGGCAGTGAGTCAGGAGG - Intergenic
966818435 3:183907391-183907413 TTGGGGGCCTGGCATTCAGGAGG + Intergenic
967084100 3:186078679-186078701 GTGGGGGGCTGGCTCTGGAGTGG - Intronic
967270575 3:187729152-187729174 ATGGGTGGCTGGCAGGCAGGTGG + Exonic
1202749594 3_GL000221v1_random:146593-146615 GTGGGGGGGTGGCAGTCTTGTGG - Intergenic
968460009 4:720117-720139 GTCCAGGGCTGTCACTCAGGAGG - Intronic
968759648 4:2435884-2435906 GTGGGGAGCAGCTACTCAGGAGG + Intronic
968759655 4:2435912-2435934 GTGGGGAGCAGCTACTCAGGAGG + Intronic
968759662 4:2435940-2435962 GTGGGGAGCAGCTACTCAGGAGG + Intronic
968759669 4:2435968-2435990 GTGGGGAGCAGCTACTCAGGAGG + Intronic
968970151 4:3789566-3789588 TTGGGGGGCTGGGACCCTGGAGG - Intergenic
969306318 4:6328063-6328085 GAGGGTGGCTGGCACTGTGGTGG - Intronic
969306749 4:6330187-6330209 GCAGAGGGCTGGCACTCATGCGG - Intronic
969311087 4:6353544-6353566 GTGGGGGGCTGTCACTGTGGGGG - Intronic
969732393 4:8964608-8964630 ATGGGGGGCGGGGCCTCAGGAGG - Intergenic
969791974 4:9498691-9498713 ATGGGGGGCGGGGCCTCAGGAGG - Intergenic
970061830 4:12042270-12042292 GTTGGGGGCTGGCCATCAAGAGG - Intergenic
970823841 4:20251638-20251660 GTTGGGGGCTGGGGCTCGGGTGG + Intergenic
973218139 4:47694768-47694790 GCCAGTGGCTGGCACTCAGGAGG + Intronic
973675368 4:53256741-53256763 GTGGCGGGCAGGCACTCGGCAGG + Intronic
974440433 4:61908516-61908538 TTGGGAGGCTTGAACTCAGGAGG + Intronic
975582554 4:75920117-75920139 GTGGTGGGCTGGGCCTCAGCAGG - Intronic
976613085 4:87049767-87049789 GTGGGAGGATGGAACTGAGGGGG + Intronic
982724037 4:158886528-158886550 GTGTGGTGTGGGCACTCAGGAGG + Intronic
985646712 5:1088450-1088472 GTTGGGGGCTGGCATTCGGCGGG - Intronic
986093921 5:4537506-4537528 ATTGGGTGATGGCACTCAGGGGG - Intergenic
986743831 5:10727218-10727240 ATGGGTGGCTGGCACACAGCAGG + Intronic
988519871 5:31936088-31936110 GTGGGGCTCTGGAGCTCAGGAGG + Intronic
989553758 5:42766768-42766790 GTGGGGGGCTGGAAGGGAGGTGG + Intronic
995357382 5:111254676-111254698 TGGGGGAGCTGGCAATCAGGTGG - Intronic
998164834 5:139837031-139837053 GAGGGAGGCTGGCACAGAGGGGG + Intronic
999279793 5:150357688-150357710 GTGGCGGGCGGGGACTAAGGCGG + Exonic
1001966589 5:175914093-175914115 GTTAGGGCCTGGCACTCGGGAGG - Intergenic
1002467285 5:179413934-179413956 GAGGGAGGCTGGCAGGCAGGTGG - Intergenic
1002565811 5:180112617-180112639 GGGTGGGGCTGGCTCTCAGTGGG + Intronic
1002945791 6:1759885-1759907 GTGGGGGGCTGGGGCGCAGTAGG - Intronic
1003070230 6:2939804-2939826 CTGGTGGGCTGGCACTATGGGGG - Intergenic
1003520589 6:6855474-6855496 GATGGTGGCTGGCACTCATGAGG - Intergenic
1004162008 6:13222475-13222497 GTGTGAGGCTGGCATTCTGGGGG - Intronic
1005459928 6:26058386-26058408 TGGGGGTGGTGGCACTCAGGAGG + Intergenic
1006341318 6:33448725-33448747 GTGGGGGGATGGCAGGCGGGGGG - Intronic
1006449820 6:34099435-34099457 GTGGGCGGCAGGCACTTAGCGGG + Intronic
1006861613 6:37175123-37175145 GTGGGGTGACGGGACTCAGGCGG + Exonic
1007406121 6:41637332-41637354 GTGGAGAGCTGGGACGCAGGAGG - Intronic
1011232045 6:85173294-85173316 GTGAGGGGCTGGCAGGAAGGTGG - Intergenic
1015111586 6:129597663-129597685 GTGGGGGCCTAGCACCAAGGTGG + Intronic
1015325765 6:131921695-131921717 GTGGGGGGCTGGCGGGGAGGTGG + Intergenic
1017352581 6:153459371-153459393 GGGAGGGGCTGGCAGGCAGGTGG + Intergenic
1017356379 6:153514174-153514196 GTGGGGGGCTGGAGAGCAGGTGG - Intergenic
1018657797 6:166056152-166056174 ATGGGGGGCTGGGAGACAGGTGG - Intergenic
1021330363 7:19330843-19330865 GTGCTGGGCTGGCAATCTGGTGG - Intergenic
1021342544 7:19482305-19482327 GTGTGGGGCTGGAACAGAGGTGG - Intergenic
1021734999 7:23634338-23634360 GTGGGGAGGGGGCACTGAGGTGG + Intronic
1022218270 7:28286776-28286798 GAGGAGGGCTGGAACCCAGGAGG + Intergenic
1022488623 7:30799800-30799822 GTTGGGGGCATGCTCTCAGGAGG + Intronic
1023598874 7:41861719-41861741 GAGGGGTGCTCCCACTCAGGAGG - Intergenic
1023742579 7:43293867-43293889 GATGGGAGGTGGCACTCAGGTGG - Intronic
1025249221 7:57340924-57340946 CTGGGGACCTGGCACACAGGAGG - Intergenic
1026776607 7:73234877-73234899 GTGTGGGGCTGGCACGGGGGCGG + Intergenic
1026881449 7:73909128-73909150 GTGGGGGCCTGGGAGCCAGGAGG + Intergenic
1027017458 7:74788247-74788269 GTGTGGGGCTGGCACGGGGGCGG + Intronic
1027070564 7:75157685-75157707 GTGTGGGGCTGGCACGGGGGCGG - Intergenic
1029402306 7:100353735-100353757 GTAAGGGGGTGGCACCCAGGAGG - Intronic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1029725815 7:102403616-102403638 TTGGGAGGCTGATACTCAGGAGG - Intronic
1030059653 7:105612595-105612617 GAGGGGGGCTGGCACCCACAGGG - Intronic
1031998947 7:128252262-128252284 GTAGGTGCCTGGCATTCAGGAGG - Intronic
1032499608 7:132390689-132390711 GAAGGGGGCTGGGACTCATGGGG - Intronic
1033967431 7:146993285-146993307 GTGGGCTGCTGGCACTTGGGAGG + Intronic
1034164219 7:149013274-149013296 GCTGGGGCCTGGCACACAGGAGG + Intronic
1034418703 7:150978118-150978140 GCGGGCGGCTCGCGCTCAGGCGG - Exonic
1036465530 8:8993560-8993582 GGGCGGGGCTAGGACTCAGGTGG + Intergenic
1037976224 8:23215117-23215139 GTGGGTAGCTTGCTCTCAGGTGG + Intronic
1039523104 8:38189077-38189099 GTGGCGGGCAGCTACTCAGGAGG - Intronic
1040286333 8:46102347-46102369 GTGGGCCGCAGGGACTCAGGGGG - Intergenic
1040289192 8:46115721-46115743 GAGGGCCGCTGGGACTCAGGGGG - Intergenic
1040301644 8:46191080-46191102 GTGGGCAGCAGGTACTCAGGGGG + Intergenic
1040303854 8:46202020-46202042 GTGGGCCGCCGGGACTCAGGGGG + Intergenic
1040305399 8:46209290-46209312 GTGGGCGGCAGGGACTCAGAGGG + Intergenic
1040313089 8:46246881-46246903 GCAGGTGGCTGGGACTCAGGGGG + Intergenic
1040313881 8:46250786-46250808 GTGGGTGGCAGGGACTCAGGGGG + Intergenic
1040313924 8:46251003-46251025 GTGGGCTGCAGGGACTCAGGGGG + Intergenic
1040334272 8:46408158-46408180 GAGGGTGGCAGGGACTCAGGGGG + Intergenic
1040336467 8:46418552-46418574 GTGGGTGGCAGGGACTCAAGGGG + Intergenic
1040337701 8:46424423-46424445 CTGGGTGGCAGGGACTCAGGGGG + Intergenic
1040339932 8:46435350-46435372 GTGGGCCGCAGGAACTCAGGGGG - Intergenic
1040834520 8:51718258-51718280 GTGGGGGCCAGGGACTGAGGGGG + Intronic
1042144739 8:65716034-65716056 GTGGTGTGGTGGCACTCAGGAGG + Intronic
1045324044 8:101103614-101103636 GGGAGGGGCAGGCACTCTGGAGG - Intergenic
1046612207 8:116438497-116438519 GTAGGAGGCTGACACTCAAGGGG - Intergenic
1047391936 8:124459398-124459420 GTGGGAGGTTGCTACTCAGGAGG - Intronic
1048257280 8:132914651-132914673 GGGTGGGGCTGACACACAGGAGG + Intronic
1049179654 8:141215701-141215723 ATGGAGGGAAGGCACTCAGGAGG + Intronic
1049261366 8:141640910-141640932 CTGGGGGGCTGCCAGTCAGATGG - Intergenic
1049350246 8:142160507-142160529 GTGGGAGGGTGGCTGTCAGGGGG + Intergenic
1049455068 8:142682513-142682535 GCAGGGGACAGGCACTCAGGAGG + Exonic
1049799388 8:144510723-144510745 GTGAGGGGCTGGCCTTGAGGAGG + Intronic
1049868115 8:144952245-144952267 TTTGGGGACTGGGACTCAGGGGG - Intergenic
1052274429 9:26661521-26661543 GTGGGACGCTGGCAATTAGGGGG - Intergenic
1056809456 9:89753066-89753088 GAGGGTGGTTGGCACTCAGAGGG - Intergenic
1057019235 9:91683116-91683138 GTGATGGGCTGTCACTCCGGTGG - Intronic
1060747404 9:126146570-126146592 GTGGGGCTCTGACACTCCGGAGG + Intergenic
1061286595 9:129626748-129626770 GTGTCGGGCTGGCGCTCGGGTGG - Intronic
1061599870 9:131661084-131661106 GTGGGTGGCTGTCAGTCAGCAGG - Intronic
1061882268 9:133574322-133574344 GCCAGGGGCTGGCACACAGGGGG + Intronic
1061926294 9:133807638-133807660 GTGAGGGGCTGAGACCCAGGAGG + Intronic
1062269425 9:135701886-135701908 GTGGTGGGCGGGGGCTCAGGGGG - Intergenic
1203718236 Un_KI270742v1:176681-176703 GTGGGGGGGTGGCAGTCTTGTGG - Intergenic
1186679799 X:11860579-11860601 GTGGGGAGCTGACACCCAGAGGG - Intergenic
1187144262 X:16623394-16623416 GTGGGGGGCTGGTAGGGAGGTGG - Intronic
1187869785 X:23755007-23755029 ATCAGGGGCTGGCACTCTGGTGG - Intronic
1187925344 X:24244624-24244646 GAGGATGGCTGGAACTCAGGGGG + Intergenic
1190049389 X:47138353-47138375 GTTGGGGCTTGGCACTCAGTAGG + Intergenic
1191840324 X:65509142-65509164 TTGGGGAACTTGCACTCAGGGGG + Intergenic
1192869654 X:75173785-75173807 CTGGTGGGCTGGCACTCCTGGGG + Intergenic
1193123706 X:77849465-77849487 GTGGGAAGGTGGCAATCAGGAGG + Intronic
1193989899 X:88293748-88293770 GTGGGGGGCAGGGAATTAGGAGG + Intergenic
1194352900 X:92842187-92842209 GTGGGGCGCTGGCAGAAAGGTGG + Intergenic
1195108487 X:101623180-101623202 GTGGGGAGCTGGTACTCAGACGG - Exonic
1195252651 X:103063792-103063814 GCGGGGCGCTGGCAGTGAGGAGG - Intronic
1195668300 X:107449766-107449788 GCGGGGAGCTGGCGCGCAGGCGG - Intergenic
1195676011 X:107507455-107507477 GTGGGGTCCTAGCACTCAGAGGG - Intergenic
1199050921 X:143235872-143235894 GTGGGGGGCTGGTAGGGAGGAGG + Intergenic