ID: 1163654584

View in Genome Browser
Species Human (GRCh38)
Location 19:18538367-18538389
Sequence CCCTGAAGACGGCTGTGGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 115}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163654584_1163654598 9 Left 1163654584 19:18538367-18538389 CCCGTCCACAGCCGTCTTCAGGG 0: 1
1: 0
2: 3
3: 6
4: 115
Right 1163654598 19:18538399-18538421 GGCACAGGGCCGCGTGCGGGGGG 0: 1
1: 0
2: 2
3: 17
4: 240
1163654584_1163654597 8 Left 1163654584 19:18538367-18538389 CCCGTCCACAGCCGTCTTCAGGG 0: 1
1: 0
2: 3
3: 6
4: 115
Right 1163654597 19:18538398-18538420 AGGCACAGGGCCGCGTGCGGGGG 0: 2
1: 0
2: 9
3: 69
4: 726
1163654584_1163654601 18 Left 1163654584 19:18538367-18538389 CCCGTCCACAGCCGTCTTCAGGG 0: 1
1: 0
2: 3
3: 6
4: 115
Right 1163654601 19:18538408-18538430 CCGCGTGCGGGGGGATGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1163654584_1163654593 5 Left 1163654584 19:18538367-18538389 CCCGTCCACAGCCGTCTTCAGGG 0: 1
1: 0
2: 3
3: 6
4: 115
Right 1163654593 19:18538395-18538417 TCCAGGCACAGGGCCGCGTGCGG 0: 2
1: 0
2: 0
3: 17
4: 211
1163654584_1163654590 -6 Left 1163654584 19:18538367-18538389 CCCGTCCACAGCCGTCTTCAGGG 0: 1
1: 0
2: 3
3: 6
4: 115
Right 1163654590 19:18538384-18538406 TCAGGGTCACCTCCAGGCACAGG 0: 1
1: 1
2: 1
3: 29
4: 297
1163654584_1163654591 -5 Left 1163654584 19:18538367-18538389 CCCGTCCACAGCCGTCTTCAGGG 0: 1
1: 0
2: 3
3: 6
4: 115
Right 1163654591 19:18538385-18538407 CAGGGTCACCTCCAGGCACAGGG 0: 1
1: 1
2: 1
3: 46
4: 319
1163654584_1163654595 6 Left 1163654584 19:18538367-18538389 CCCGTCCACAGCCGTCTTCAGGG 0: 1
1: 0
2: 3
3: 6
4: 115
Right 1163654595 19:18538396-18538418 CCAGGCACAGGGCCGCGTGCGGG 0: 1
1: 0
2: 0
3: 49
4: 430
1163654584_1163654596 7 Left 1163654584 19:18538367-18538389 CCCGTCCACAGCCGTCTTCAGGG 0: 1
1: 0
2: 3
3: 6
4: 115
Right 1163654596 19:18538397-18538419 CAGGCACAGGGCCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 241
1163654584_1163654599 17 Left 1163654584 19:18538367-18538389 CCCGTCCACAGCCGTCTTCAGGG 0: 1
1: 0
2: 3
3: 6
4: 115
Right 1163654599 19:18538407-18538429 GCCGCGTGCGGGGGGATGTATGG 0: 1
1: 0
2: 0
3: 5
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163654584 Original CRISPR CCCTGAAGACGGCTGTGGAC GGG (reversed) Exonic
900577433 1:3390278-3390300 GGCTGAAGATGGCTGGGGACAGG + Intronic
902334524 1:15747418-15747440 TGCTGGAGAGGGCTGTGGACAGG - Intronic
902515725 1:16988473-16988495 ACCTGAAGAGAGGTGTGGACAGG + Exonic
903816386 1:26067195-26067217 CCCTGCAGAGGCCTCTGGACAGG - Intronic
908354357 1:63316843-63316865 CCCGGGACAGGGCTGTGGACAGG - Intergenic
909566254 1:77056661-77056683 CACAGAAGACGGGTGTGGAATGG + Intronic
910168627 1:84354393-84354415 CCCTGAAGACAGTTGTGGACAGG - Intronic
912491889 1:110066987-110067009 CCCTTGAGAGGGCTGTAGACTGG - Intronic
914833713 1:151190074-151190096 CCCGGAAGACCGCTGGGAACCGG - Exonic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
921029844 1:211327209-211327231 TCCAGAGGGCGGCTGTGGACCGG + Intronic
1063136924 10:3225395-3225417 CCCAGAAGAAGGCTGAAGACTGG + Intergenic
1063461333 10:6216553-6216575 CCCTGGAGAGGACTGTGGGCAGG + Intronic
1065365762 10:24935551-24935573 CCCTGAAGACCGCTGTCCCCTGG + Intronic
1065417206 10:25501589-25501611 GTCTGAAAACTGCTGTGGACTGG + Intronic
1066204894 10:33179397-33179419 CCCTGAACACGGCTGGCCACTGG - Exonic
1076507287 10:130986621-130986643 CACTGAAGACTCCTGTGTACAGG - Intergenic
1076579943 10:131500599-131500621 CTCTGAAGACCTCTGTGGATGGG + Intergenic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1076888511 10:133273265-133273287 GCCTGAAGACGGCTGCCGTCCGG + Exonic
1079312022 11:19375335-19375357 CCCAGAAGATGGCTGGGCACAGG + Intronic
1082024896 11:47565085-47565107 CCCTGAAGAGGACAGTGGAAGGG - Intronic
1082100593 11:48169911-48169933 TCCTGAAAAGGGCTGGGGACAGG + Intronic
1084578041 11:70003475-70003497 GCCTGAAGAGGGCTGTGGAAGGG - Intergenic
1084967290 11:72751413-72751435 CCTTGAAGACAGGTGTGGACAGG - Intronic
1085308749 11:75503579-75503601 CCCTGAGGCCTGCTGTGGGCTGG - Intronic
1091552502 12:1547249-1547271 CCCTGAACACTGCGGTGGAGAGG + Intronic
1096182036 12:49556382-49556404 CATTGAAGACGGCTGTGGCTCGG + Exonic
1096239257 12:49950842-49950864 CCCTGGAGAAGGCTATGGAGCGG - Exonic
1100161358 12:91864744-91864766 CCCTGAAGACAGATGTGTCCTGG + Intergenic
1100428611 12:94510215-94510237 CCCTGCTGATGGCTGTGGAAGGG - Intergenic
1101191046 12:102332918-102332940 CCTTGAAGAACGCTGGGGACAGG + Intergenic
1107555446 13:41513563-41513585 CCCACAAGACAGCTGAGGACAGG - Intergenic
1113649826 13:112027421-112027443 CCCAGAAGTCGGGTGGGGACAGG + Intergenic
1120840739 14:89082927-89082949 CTCTTAAGAAGTCTGTGGACTGG - Intergenic
1122904056 14:104793907-104793929 CCCTGACGACCTCTGTGGAATGG + Exonic
1124989775 15:34660150-34660172 CCCTGAAGAGGGCCATGGACTGG + Intergenic
1129908270 15:79205210-79205232 CCCTGAACACAGCTGGGGCCAGG + Intergenic
1130417317 15:83705803-83705825 CCCTCCAGACCGCTGTGGGCAGG + Intronic
1135512783 16:23101702-23101724 CCCTGAAGAATGCTGTGGCGAGG + Intronic
1137584941 16:49658714-49658736 CCCTGAAGGCAGCTGTGGCAGGG + Intronic
1137591113 16:49694553-49694575 CCCTGAAGGCAGCTGAGCACAGG - Intronic
1137715504 16:50595842-50595864 CCCTGATGTGGGCTGTTGACTGG + Intronic
1139911626 16:70400840-70400862 CCCTGATGAGGCCTGTGGGCGGG - Intronic
1141156044 16:81597822-81597844 CCCTGAAGATGGCTGGTGAGAGG - Intronic
1143394132 17:6578603-6578625 CCCAGATGACGGCACTGGACAGG + Exonic
1143865066 17:9917495-9917517 ACATGAAGAGGGCTGTGAACGGG + Intronic
1143963858 17:10742041-10742063 CCCAAAAGAGGGCTGAGGACTGG - Intergenic
1148161069 17:45450424-45450446 CCCTGCCCAAGGCTGTGGACAGG + Intronic
1150226008 17:63524745-63524767 TCCTGAAGACCTCTGTGGCCAGG + Intronic
1150392302 17:64797070-64797092 CCCTGCCCAGGGCTGTGGACAGG + Intergenic
1151749546 17:76028735-76028757 CCCTGAACTCGGCCGTGGAGAGG + Intergenic
1152261255 17:79268541-79268563 CCATGAAGATGGCAGAGGACTGG - Intronic
1154241781 18:12658752-12658774 CCCTGAAGATGGGAGTGGAGAGG - Exonic
1160750164 19:730195-730217 CCCTCCAGGCGGCTGTGGGCTGG + Intronic
1161153715 19:2721749-2721771 CCCTGAGGCCGGCTGGGGCCCGG + Intronic
1161298607 19:3532198-3532220 CCCTGCTGATGGCTGTGGAGTGG - Intronic
1162514264 19:11138727-11138749 CACTGCAGACAGCTGTGGTCTGG - Intronic
1163654584 19:18538367-18538389 CCCTGAAGACGGCTGTGGACGGG - Exonic
1163849343 19:19654556-19654578 CCATGCTGACGGCCGTGGACTGG - Exonic
1166369889 19:42294825-42294847 CCTGGAAGGCGGCTGTGGCCTGG - Exonic
1166547548 19:43642369-43642391 CCCTGAAGTAGGATGGGGACAGG - Intergenic
1167395185 19:49223802-49223824 CCCTGCACCCAGCTGTGGACTGG - Intergenic
925324805 2:3010046-3010068 CCCTGAAGACGGTCTTGGGCAGG + Intergenic
928126409 2:28619735-28619757 CCCTGAAGATTTGTGTGGACTGG + Intronic
934975052 2:98796190-98796212 CTGTGAAGCCCGCTGTGGACCGG - Exonic
941065604 2:160899203-160899225 CCCTGAAGAGGGCTGTCTCCAGG + Intergenic
941583049 2:167324014-167324036 CCATCAAGACGACTGTGGCCTGG - Intergenic
941697443 2:168568683-168568705 GCCTGAAGACGGCTGTAGAAAGG + Intronic
944878234 2:203984921-203984943 CCCTGAAGAGGGGTCTGGGCAGG - Intergenic
948178478 2:235961969-235961991 CCATGGAGACTGCTGGGGACAGG + Intronic
1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG + Intronic
1170126588 20:12970621-12970643 CACTGAAGATGGCTGAGAACAGG - Intergenic
1170164445 20:13346695-13346717 CCCTGATGACTGCTGAGGTCTGG - Intergenic
1170376834 20:15709225-15709247 CCCTGCAGATGGCGGTGAACGGG + Intronic
1171090690 20:22283451-22283473 CCCTAAGGATGGCTGGGGACCGG + Intergenic
1172383568 20:34516590-34516612 CCCTCAAGTCGGCTGGGGCCCGG - Intronic
1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG + Intergenic
1175258868 20:57662772-57662794 CCCTGGAGACAGCTGGGGAAGGG - Intronic
1175890378 20:62313338-62313360 AGCTGGACACGGCTGTGGACAGG - Exonic
1175909618 20:62398559-62398581 CCCTGAGGACGGCGCTGGCCTGG - Intronic
1180942834 22:19670847-19670869 ACCTGACGAGGGCTGTGGGCTGG - Intergenic
1180980531 22:19876195-19876217 CCCCCAAGATGCCTGTGGACAGG - Intronic
1180998699 22:19977976-19977998 CCCTGCAGTCGGCTGTGGGCCGG - Exonic
1181273312 22:21673412-21673434 CCATGAGGGCAGCTGTGGACAGG - Intronic
1183291852 22:37007512-37007534 CCGTCCAGACTGCTGTGGACTGG - Exonic
1183748515 22:39705889-39705911 CCCTGCAGACGTCTGGGGAGCGG - Intergenic
950706430 3:14785339-14785361 CACTGTAGAGGGCTGTGCACAGG - Intergenic
953574330 3:44101035-44101057 CCCTGAAGACGCCTGGGGACAGG + Intergenic
966999342 3:185317171-185317193 CCCTGAAAACAGCTTTGGAGAGG + Intronic
970454770 4:16212262-16212284 CCCTGTAGAGGGCTGAGGCCAGG + Intronic
982106428 4:152015600-152015622 CACTGAAGAAGGCTGAGGGCGGG - Intergenic
983855175 4:172634230-172634252 CCTTGAACACTGCTATGGACTGG - Intronic
984591252 4:181619869-181619891 CAATGAATACGGCTGTTGACGGG - Intergenic
985643210 5:1073346-1073368 CCATGATTACGGCTCTGGACGGG + Intronic
985964695 5:3330936-3330958 CCCTGAAGCCGGCGGTGGGAGGG - Intergenic
991124966 5:63059977-63059999 CCTTGGAGAGGGCTGTGGAAAGG + Intergenic
996604249 5:125302583-125302605 CCCTGCAGAGGGGTGTGTACAGG - Intergenic
998465768 5:142342529-142342551 CACTGAGGACGGATGTGGGCCGG + Intergenic
1001225345 5:169940063-169940085 CCCTGGTGACGGCTGTGGGTGGG + Intronic
1001328244 5:170744770-170744792 CCCTGAAGCCGGCGCTGGGCTGG - Intergenic
1002345138 5:178543581-178543603 CCCTGCAGCCGCCTGTGGAAGGG - Intronic
1003162406 6:3647204-3647226 CCCTGAAGGCGGGAGTGGCCGGG - Intergenic
1006054019 6:31367309-31367331 CCGTGAAGGCGCCTGTGGAGAGG + Intergenic
1006429070 6:33984106-33984128 CCCTGCACAGTGCTGTGGACAGG - Intergenic
1006443501 6:34066184-34066206 CCCTGGGGACGAGTGTGGACGGG - Intronic
1006671988 6:35735391-35735413 CCTTGAGGAGGGCTGAGGACAGG + Intergenic
1010490650 6:76472128-76472150 CCCTTTAGAAGGGTGTGGACAGG + Intergenic
1012421435 6:99070113-99070135 ACCTGAAGAAGGCTGGGGCCAGG - Intergenic
1019519923 7:1455980-1456002 TCCTGAAGACTACTGGGGACAGG + Intronic
1019915509 7:4129774-4129796 CCCTGAGGATGGCTGTGTGCAGG - Intronic
1026488900 7:70845851-70845873 TCCTTAAGAAGGCTGTGGCCAGG + Intergenic
1028981283 7:96970548-96970570 ACCTGGATAGGGCTGTGGACTGG - Intergenic
1030679675 7:112421933-112421955 CCCTGAAAGTGGCTGTGGAGTGG - Intergenic
1036212650 8:6854681-6854703 CTCTGCAGCCGGCTCTGGACTGG - Intergenic
1037653917 8:20866725-20866747 CCCTGAAGACAGCCCTGGAGAGG - Intergenic
1037762604 8:21751818-21751840 CCCTGCAGAGGGCTGTGCAGAGG - Intronic
1041558614 8:59188046-59188068 CCCCGAAGCCTGCTGTGGACTGG + Intergenic
1041616138 8:59908195-59908217 CCCTGAAGACAGCACAGGACTGG - Intergenic
1041727363 8:61030635-61030657 CCGAGAAGGTGGCTGTGGACAGG + Intergenic
1051600820 9:18871895-18871917 GCCTGAAGACGCCTGAAGACGGG - Intronic
1056760869 9:89414224-89414246 CTCTGGTGACAGCTGTGGACTGG + Intronic
1057083011 9:92186935-92186957 CCCAGAAGATGTCTGTGCACCGG - Intergenic
1059533565 9:115060158-115060180 TCCTGAAGACAACTGTGGCCAGG - Intronic
1199793572 X:151176171-151176193 CCCTGCTGGGGGCTGTGGACTGG + Intergenic