ID: 1163657817

View in Genome Browser
Species Human (GRCh38)
Location 19:18557933-18557955
Sequence CCCCACCCCAAACTCGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3087
Summary {0: 1, 1: 0, 2: 2, 3: 150, 4: 2934}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163657817_1163657828 6 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657828 19:18557962-18557984 ACTCCAGGGCCGCGGGGAACCGG No data
1163657817_1163657839 30 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657839 19:18557986-18558008 CCGGGTCGGGCGCGGCCCCCGGG No data
1163657817_1163657837 29 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG No data
1163657817_1163657835 22 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657835 19:18557978-18558000 GAACCGGTCCGGGTCGGGCGCGG No data
1163657817_1163657834 17 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657834 19:18557973-18557995 GCGGGGAACCGGTCCGGGTCGGG No data
1163657817_1163657826 -1 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657826 19:18557955-18557977 GCTGGGGACTCCAGGGCCGCGGG No data
1163657817_1163657823 -9 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657823 19:18557947-18557969 GGGGTGGGGCTGGGGACTCCAGG No data
1163657817_1163657824 -8 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657824 19:18557948-18557970 GGGTGGGGCTGGGGACTCCAGGG No data
1163657817_1163657833 16 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657833 19:18557972-18557994 CGCGGGGAACCGGTCCGGGTCGG No data
1163657817_1163657825 -2 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657825 19:18557954-18557976 GGCTGGGGACTCCAGGGCCGCGG No data
1163657817_1163657827 0 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657827 19:18557956-18557978 CTGGGGACTCCAGGGCCGCGGGG No data
1163657817_1163657830 11 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657830 19:18557967-18557989 AGGGCCGCGGGGAACCGGTCCGG No data
1163657817_1163657831 12 Left 1163657817 19:18557933-18557955 CCGGGGCCGAGTTTGGGGTGGGG 0: 1
1: 0
2: 2
3: 150
4: 2934
Right 1163657831 19:18557968-18557990 GGGCCGCGGGGAACCGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163657817 Original CRISPR CCCCACCCCAAACTCGGCCC CGG (reversed) Intronic