ID: 1163657821

View in Genome Browser
Species Human (GRCh38)
Location 19:18557939-18557961
Sequence CCCCAGCCCCACCCCAAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 1, 2: 3, 3: 91, 4: 699}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163657821_1163657826 -7 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657826 19:18557955-18557977 GCTGGGGACTCCAGGGCCGCGGG No data
1163657821_1163657828 0 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657828 19:18557962-18557984 ACTCCAGGGCCGCGGGGAACCGG No data
1163657821_1163657830 5 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657830 19:18557967-18557989 AGGGCCGCGGGGAACCGGTCCGG No data
1163657821_1163657833 10 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657833 19:18557972-18557994 CGCGGGGAACCGGTCCGGGTCGG No data
1163657821_1163657837 23 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG No data
1163657821_1163657827 -6 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657827 19:18557956-18557978 CTGGGGACTCCAGGGCCGCGGGG No data
1163657821_1163657831 6 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657831 19:18557968-18557990 GGGCCGCGGGGAACCGGTCCGGG No data
1163657821_1163657825 -8 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657825 19:18557954-18557976 GGCTGGGGACTCCAGGGCCGCGG No data
1163657821_1163657834 11 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657834 19:18557973-18557995 GCGGGGAACCGGTCCGGGTCGGG No data
1163657821_1163657840 30 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657840 19:18557992-18558014 CGGGCGCGGCCCCCGGGCTGCGG No data
1163657821_1163657839 24 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657839 19:18557986-18558008 CCGGGTCGGGCGCGGCCCCCGGG No data
1163657821_1163657835 16 Left 1163657821 19:18557939-18557961 CCGAGTTTGGGGTGGGGCTGGGG 0: 1
1: 1
2: 3
3: 91
4: 699
Right 1163657835 19:18557978-18558000 GAACCGGTCCGGGTCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163657821 Original CRISPR CCCCAGCCCCACCCCAAACT CGG (reversed) Intronic